The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018671	Klebsiella pneumoniae strain CAV1042 chromosome, complete genome	5424949	155532	161961	5424949		Escherichia_phage(100.0%)	7	NA	NA
WP_002210516.1|155532_156153_-	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
WP_004190239.1|156145_157411_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002903955.1|157422_158325_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_002210513.1|158585_159347_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004176269.1|159367_160228_-	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_004176262.1|160525_160786_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	98.8	5.4e-41
WP_074075326.1|160872_161961_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	99.7	6.8e-210
>prophage 2
NZ_CP018671	Klebsiella pneumoniae strain CAV1042 chromosome, complete genome	5424949	2344221	2422752	5424949	portal,head,protease,terminase,tRNA,integrase,capsid,tail	uncultured_Caudovirales_phage(55.0%)	81	2388661:2388681	2404798:2404818
WP_004188423.1|2344221_2344716_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	54.8	1.5e-26
WP_002918467.1|2344719_2345358_-	stringent starvation protein A	NA	NA	NA	NA	NA
WP_135801240.1|2345327_2345612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000829818.1|2345669_2346062_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002918559.1|2346077_2346506_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004144945.1|2346771_2347899_-	cell division protein ZapE	NA	NA	NA	NA	NA
WP_002918565.1|2348089_2348488_+	DUF1043 family protein	NA	NA	NA	NA	NA
WP_004174125.1|2348661_2350029_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.3	6.0e-22
WP_002918568.1|2350116_2351175_+	outer membrane-stress sensor serine endopeptidase DegS	NA	NA	NA	NA	NA
WP_071557112.1|2351200_2351911_-	triphosphoribosyl-dephospho-CoA synthase	NA	NA	NA	NA	NA
WP_023282161.1|2351970_2353272_-	oxalacetate decarboxylase subunit beta	NA	NA	NA	NA	NA
WP_071556492.1|2353287_2355060_-	sodium-extruding oxaloacetate decarboxylase subunit alpha	NA	NA	NA	NA	NA
WP_071557113.1|2355075_2355327_-	oxaloacetate decarboxylase subunit gamma	NA	NA	NA	NA	NA
WP_004188410.1|2355468_2356086_-	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_004181427.1|2356085_2356985_-	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_014906861.1|2357017_2358286_-	SLC13/DASS family transporter	NA	Q6A201	Oenococcus_phage	33.5	1.0e-60
WP_004181429.1|2358497_2359163_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071557114.1|2359149_2359779_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002918570.1|2359909_2360848_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002918625.1|2361262_2361733_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_002918626.1|2362108_2362372_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918627.1|2362470_2362737_+	peroxide/acid stress response protein YhcN	NA	NA	NA	NA	NA
WP_002918629.1|2362787_2363063_-	barstar family protein	NA	NA	NA	NA	NA
WP_002918632.1|2363142_2365110_-	p-hydroxybenzoic acid efflux pump subunit AaeB	NA	NA	NA	NA	NA
WP_002918639.1|2365115_2366048_-	p-hydroxybenzoic acid efflux pump subunit AaeA	NA	NA	NA	NA	NA
WP_002918640.1|2366055_2366259_-	AaeX family protein	NA	NA	NA	NA	NA
WP_002918641.1|2366390_2367320_+	HTH-type transcriptional activator AaeR	NA	NA	NA	NA	NA
WP_004144958.1|2367355_2368801_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_071557115.1|2368889_2372687_-	AsmA2 domain-containing protein YhdP	NA	NA	NA	NA	NA
WP_002918644.1|2372724_2374194_-	ribonuclease G	NA	NA	NA	NA	NA
WP_071557116.1|2374196_2374778_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002918648.1|2374785_2375274_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004149974.1|2375273_2376266_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002918653.1|2376336_2377380_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
WP_009309618.1|2377685_2379626_-	RNase E specificity factor CsrD	NA	NA	NA	NA	NA
WP_004144963.1|2379705_2379897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002918688.1|2380125_2381127_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_004185869.1|2381126_2381735_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_004174104.1|2381958_2382411_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_002918736.1|2382433_2382901_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_004174096.1|2382911_2384261_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002918740.1|2384371_2384614_+	YhdT family protein	NA	NA	NA	NA	NA
WP_004181435.1|2384603_2386055_+	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_004144971.1|2386066_2386948_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004144972.1|2387305_2388271_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_000462905.1|2388295_2388592_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
2388661:2388681	attL	TGACTACACCACTGACTACAC	NA	NA	NA	NA
WP_071557117.1|2388714_2388906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128316279.1|2388935_2389145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557118.1|2389150_2391448_-|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	46.6	5.7e-158
WP_071557119.1|2391459_2393121_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	94.0	2.7e-311
WP_071557120.1|2393104_2393461_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	97.5	1.6e-59
WP_004150957.1|2393589_2393742_-	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_071557121.1|2393734_2394178_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	90.5	9.5e-78
WP_025861186.1|2394177_2394471_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	85.6	3.8e-43
WP_071557122.1|2394463_2394805_-|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	46.1	4.8e-21
WP_074075397.1|2394801_2396037_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	94.6	5.7e-229
WP_071557124.1|2396038_2396599_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	92.5	2.0e-96
WP_071557125.1|2396650_2397811_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	93.8	6.5e-203
WP_071557126.1|2398047_2398308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557127.1|2398588_2400388_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.5	1.4e-127
WP_071557128.1|2400384_2400753_-	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	87.7	5.5e-55
WP_071557129.1|2400755_2401049_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_135726243.1|2401064_2401265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557130.1|2401257_2401467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077271523.1|2401459_2401660_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_071557131.1|2402512_2402719_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	77.6	4.0e-23
WP_074075398.1|2402796_2403552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071557133.1|2403548_2404772_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	84.0	2.8e-212
WP_021440791.1|2405047_2405701_-	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
2404798:2404818	attR	TGACTACACCACTGACTACAC	NA	NA	NA	NA
WP_002919101.1|2406079_2407219_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_071557134.1|2407231_2410342_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919103.1|2410634_2410856_+	membrane protein	NA	NA	NA	NA	NA
WP_002919123.1|2416830_2417385_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919125.1|2417360_2417618_-	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919126.1|2417614_2418433_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919132.1|2418436_2419009_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_004145330.1|2419013_2419556_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919137.1|2419582_2420056_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032428422.1|2420027_2421152_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_004174081.1|2421280_2421790_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	1.5e-18
WP_004150007.1|2421804_2422752_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
>prophage 3
NZ_CP018671	Klebsiella pneumoniae strain CAV1042 chromosome, complete genome	5424949	3338395	3383664	5424949	integrase,transposase	Acidithiobacillus_phage(16.67%)	36	3362102:3362117	3385641:3385656
WP_064161743.1|3338395_3339925_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	45.9	7.5e-122
WP_020802959.1|3339935_3340679_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	45.4	1.0e-55
WP_074075422.1|3340746_3342270_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004115509.1|3342294_3342696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004115504.1|3343288_3344083_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	93.2	1.8e-135
WP_004115503.1|3344082_3345255_-|transposase	IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	91.5	1.4e-213
WP_004115496.1|3346268_3346787_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_004115492.1|3346918_3347434_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.8	2.3e-30
WP_004115487.1|3349008_3349200_-	heavy-metal-associated domain-containing protein	NA	NA	NA	NA	NA
WP_074075423.1|3349287_3352455_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_172751438.1|3352454_3353666_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004115474.1|3353951_3357392_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_048286510.1|3357537_3357960_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_040118089.1|3358257_3359199_-	UDP-3-O-acyl-N-acetylglucosamine deacetylase	NA	NA	NA	NA	NA
WP_004115466.1|3359507_3359771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053287298.1|3359760_3360165_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004115463.1|3360244_3362779_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	1.7e-142
3362102:3362117	attL	GTTTTTCTTTTCACCA	NA	NA	NA	NA
WP_004115460.1|3362860_3363313_+	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004115457.1|3363410_3363875_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_004115454.1|3363885_3366384_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	33.8	1.0e-91
WP_004115452.1|3366594_3367605_+	cation diffusion facilitator family transporter	NA	A0A1V0SED0	Indivirus	26.0	9.3e-20
WP_004115449.1|3367654_3368014_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_097432954.1|3368282_3369402_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	4.1e-45
WP_004115425.1|3369715_3370696_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	79.1	1.6e-149
WP_004115446.1|3370922_3372362_-	FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.0	2.3e-48
WP_004115442.1|3372481_3373057_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004115439.1|3373299_3373509_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_110229045.1|3374193_3374382_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_004115436.1|3374384_3375257_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_032705156.1|3375243_3377007_+	FUSC family protein	NA	NA	NA	NA	NA
WP_004115430.1|3376996_3377785_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_074075424.1|3378745_3378940_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071882578.1|3379077_3379338_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_004115426.1|3379568_3380585_-	nickel/cobalt efflux transporter RcnA	NA	NA	NA	NA	NA
WP_004115425.1|3380676_3381657_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	79.1	1.6e-149
WP_026056053.1|3382764_3383664_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
3385641:3385656	attR	TGGTGAAAAGAAAAAC	NA	NA	NA	NA
>prophage 4
NZ_CP018671	Klebsiella pneumoniae strain CAV1042 chromosome, complete genome	5424949	4062510	4073458	5424949	integrase	Enterobacteria_phage(50.0%)	12	4058014:4058034	4069401:4069421
4058014:4058034	attL	ATACCCCCATAAGTACCCCCA	NA	NA	NA	NA
WP_004191845.1|4062510_4064274_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	43.8	2.5e-105
WP_071556536.1|4064270_4064585_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_014830796.1|4064595_4064799_-	hypothetical protein	NA	K7PHG9	Enterobacteria_phage	53.2	1.3e-13
WP_048336901.1|4064914_4065790_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_071531908.1|4065782_4065971_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_023301290.1|4066328_4066901_-	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	65.7	1.6e-56
WP_023301291.1|4066921_4067134_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.6	4.9e-08
WP_099147915.1|4067249_4067864_-	protein kinase	NA	NA	NA	NA	NA
WP_020686322.1|4068154_4069369_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.7e-132
WP_023316495.1|4069724_4070978_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
4069401:4069421	attR	ATACCCCCATAAGTACCCCCA	NA	NA	NA	NA
WP_004144574.1|4070988_4072092_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_004144576.1|4072405_4073458_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	57.9	1.4e-111
>prophage 5
NZ_CP018671	Klebsiella pneumoniae strain CAV1042 chromosome, complete genome	5424949	4759787	4772347	5424949	protease,transposase	Stx2-converting_phage(25.0%)	13	NA	NA
WP_023283478.1|4759787_4761326_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	91.4	1.1e-271
WP_117044057.1|4761322_4761973_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_117044058.1|4762426_4762540_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_074075460.1|4762558_4762702_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023283480.1|4762949_4763471_+	CSS-motif domain-containing protein	NA	NA	NA	NA	NA
WP_167876298.1|4763653_4764505_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_077254091.1|4766236_4766476_+	GrpB family protein	NA	NA	NA	NA	NA
WP_023283484.1|4766434_4766977_-	AAA family ATPase	NA	A0A219VHB7	Ochrobactrum_phage	55.8	1.2e-21
WP_101982579.1|4767662_4768891_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	5.2e-166
WP_032416054.1|4769083_4770082_+	nitrilase family protein	NA	NA	NA	NA	NA
WP_032415961.1|4770169_4770568_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023283488.1|4770945_4771545_-	LysE family translocator	NA	NA	NA	NA	NA
WP_070083046.1|4771738_4772347_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	38.0	4.0e-26
>prophage 6
NZ_CP018671	Klebsiella pneumoniae strain CAV1042 chromosome, complete genome	5424949	4845212	4854676	5424949	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_071556640.1|4845212_4846328_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_071556641.1|4846324_4848265_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896516.1|4848341_4848563_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|4848888_4849206_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896522.1|4849236_4851516_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_001040187.1|4851636_4851855_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002898014.1|4852208_4852910_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_023158537.1|4852954_4854676_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
>prophage 7
NZ_CP018671	Klebsiella pneumoniae strain CAV1042 chromosome, complete genome	5424949	5092188	5200105	5424949	portal,holin,head,protease,plate,terminase,tRNA,integrase,capsid,tail	Enterobacteria_phage(28.21%)	133	5158352:5158369	5194861:5194878
WP_004150803.1|5092188_5093295_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004150802.1|5093351_5093810_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004150801.1|5093826_5094477_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004150800.1|5094717_5095968_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_000741346.1|5096080_5097223_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	82.2	9.1e-173
WP_000089156.1|5097212_5097449_-	excisionase	NA	NA	NA	NA	NA
WP_040176407.1|5097749_5097968_-	hypothetical protein	NA	G8C7S3	Escherichia_phage	53.4	3.5e-09
WP_040176408.1|5097960_5098356_-	hypothetical protein	NA	A0A077K9V6	Edwardsiella_phage	33.8	1.0e-06
WP_004864289.1|5098352_5098868_-	hypothetical protein	NA	A0A0P0ZBM8	Stx2-converting_phage	76.4	2.9e-70
WP_074075471.1|5099471_5100548_-	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	74.1	8.0e-147
WP_023158881.1|5100675_5101461_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	50.6	2.2e-61
WP_040149782.1|5101460_5101760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004184742.1|5102232_5103387_-	type I restriction enzyme HsdR N-terminal domain-containing protein	NA	A0A1S5SAB0	Streptococcus_phage	28.2	1.5e-34
WP_074075472.1|5103558_5104035_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	45.3	1.1e-12
WP_004197463.1|5104136_5104400_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	47.9	3.7e-13
WP_004184739.1|5104428_5104881_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.8	1.5e-67
WP_071557781.1|5105118_5105331_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	6.4e-16
WP_074075473.1|5105287_5106202_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	56.3	2.4e-30
WP_074075474.1|5106198_5107008_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	1.6e-110
WP_000779146.1|5107017_5107395_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	2.3e-48
WP_074075475.1|5107407_5108388_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	66.9	7.1e-134
WP_032447794.1|5108401_5108980_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	57.2	1.3e-50
WP_074075476.1|5109055_5109652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017145563.1|5109781_5110177_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	98.5	2.6e-63
WP_019705280.1|5110163_5110445_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	3.9e-37
WP_040221211.1|5110444_5111074_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.9	3.1e-106
WP_074075477.1|5111081_5111357_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	57.3	1.2e-17
WP_072060439.1|5111737_5112088_+	HNH endonuclease	NA	K7PHK9	Enterobacteria_phage	77.6	8.6e-50
WP_065877869.1|5112220_5112715_+|terminase	phage terminase small subunit P27 family	terminase	Q8HAD7	Salmonella_phage	90.7	2.3e-80
WP_064143754.1|5112711_5114442_+|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	82.0	1.3e-292
WP_165381876.1|5114438_5114600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074075479.1|5114589_5115816_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.5	1.2e-210
WP_000999827.1|5115808_5116408_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_004104235.1|5116417_5117656_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_019705272.1|5117733_5118051_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.9	7.4e-24
WP_019705271.1|5118059_5118398_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	68.8	6.6e-39
WP_019705270.1|5118394_5118844_+	HK97 gp10 family phage protein	NA	Q9MCS9	Enterobacteria_phage	82.6	6.7e-63
WP_016530186.1|5118840_5119188_+	DUF3168 domain-containing protein	NA	K7PKL6	Enterobacterial_phage	63.7	2.8e-32
WP_023313062.1|5119244_5119949_+	immunoglobulin domain-containing protein	NA	K7PHL2	Enterobacterial_phage	66.9	5.5e-80
WP_021313622.1|5119979_5120384_+|tail	phage tail protein	tail	K7PKV6	Enterobacterial_phage	57.7	8.5e-33
WP_032409576.1|5120395_5120692_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	63.9	2.5e-26
WP_016530182.1|5120764_5120998_+	hypothetical protein	NA	K7PH16	Enterobacteria_phage	47.2	1.9e-08
WP_074075480.1|5121058_5124445_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	57.9	2.5e-303
WP_023301979.1|5124465_5124939_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	60.8	4.6e-54
WP_023301978.1|5124925_5125411_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	66.2	4.0e-53
WP_021313617.1|5125420_5125801_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	80.2	2.1e-57
WP_032441726.1|5125797_5128881_+	kinase	NA	A0A286S259	Klebsiella_phage	71.7	0.0e+00
WP_181960471.1|5128942_5131039_+	hypothetical protein	NA	A0A1U9ZA50	Proteus_phage	36.5	3.1e-17
WP_074075481.1|5131050_5131305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074075482.1|5131367_5131556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074075483.1|5131760_5132606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024623019.1|5134233_5134605_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	50.0	3.5e-25
WP_004892953.1|5134783_5134936_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	3.8e-18
WP_004892950.1|5135208_5135922_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023159861.1|5135918_5136311_-	ACT domain protein	NA	NA	NA	NA	NA
WP_065808332.1|5136303_5136627_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_004225560.1|5136746_5136923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071556683.1|5137076_5137304_-	DUF1272 domain-containing protein	NA	NA	NA	NA	NA
WP_004140529.1|5137416_5138610_-	glutathione-dependent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_004190907.1|5138677_5139013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150795.1|5139232_5139418_+	general stress protein	NA	NA	NA	NA	NA
WP_071556684.1|5139508_5140003_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004140514.1|5140029_5140536_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_004179357.1|5140552_5141440_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_004140511.1|5141495_5142902_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004140509.1|5142898_5143909_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_004140506.1|5144024_5144222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150791.1|5144788_5145421_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004140501.1|5145460_5145640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150790.1|5146037_5146724_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_020804938.1|5146836_5147001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004140497.1|5147034_5148543_-	UbiD family decarboxylase	NA	NA	NA	NA	NA
WP_004150788.1|5148663_5149554_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071556685.1|5149560_5151345_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	36.1	5.8e-17
WP_071556686.1|5151418_5152627_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_004892909.1|5152929_5153973_+	type II asparaginase	NA	NA	NA	NA	NA
WP_004148038.1|5154634_5155549_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	50.4	1.1e-72
WP_004150783.1|5155638_5156277_+	leucine efflux protein LeuE	NA	NA	NA	NA	NA
WP_004140489.1|5156407_5156671_+	DUF2534 family protein	NA	NA	NA	NA	NA
WP_004140488.1|5156730_5156856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004213093.1|5156973_5157048_-	protein YoaJ	NA	NA	NA	NA	NA
WP_004150782.1|5157047_5157149_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_016531463.1|5157206_5158220_-	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	33.8	1.1e-12
5158352:5158369	attL	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_004131512.1|5158485_5159469_-|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	80.1	8.4e-151
WP_004213095.1|5159584_5159884_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	77.8	6.5e-38
WP_004131514.1|5160004_5160283_+	regulatory phage cox family protein	NA	Q1JS60	Enterobacteria_phage	88.8	5.3e-42
WP_004131515.1|5160303_5160522_+	hypothetical protein	NA	A0A0M5M1I3	Salmonella_phage	49.1	4.7e-06
WP_032720057.1|5160537_5160915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071556688.1|5160930_5161203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071556689.1|5161271_5161496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004131524.1|5161492_5162059_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	34.1	5.5e-14
WP_071556690.1|5162291_5163245_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	56.0	2.4e-86
WP_071556691.1|5163244_5163514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_176678610.1|5163513_5163669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071556692.1|5163644_5164673_+	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	56.6	1.0e-98
WP_071556693.1|5164665_5167263_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	56.4	2.5e-242
WP_071556694.1|5167265_5167784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071556695.1|5168117_5169965_-	ATP-binding protein	NA	E5E3R2	Burkholderia_phage	22.0	2.5e-07
WP_024359494.1|5170603_5171665_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	68.7	2.8e-144
WP_004213105.1|5171658_5173386_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	68.3	3.1e-233
WP_074075487.1|5173542_5174382_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	66.3	1.5e-95
WP_071556697.1|5174392_5175427_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	49.7	1.8e-95
WP_064380603.1|5175476_5176343_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	58.5	4.4e-71
WP_048024509.1|5176447_5176963_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	50.0	1.8e-40
WP_045854925.1|5176962_5177163_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	64.6	1.6e-16
WP_004213110.1|5177153_5177438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048299353.1|5177434_5177980_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	44.1	7.4e-32
WP_165790250.1|5178166_5178502_+	peptidase	NA	NA	NA	NA	NA
WP_032720044.1|5178502_5178970_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	59.5	7.0e-47
WP_071556698.1|5178966_5179602_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	50.5	7.3e-55
WP_071556699.1|5179598_5180186_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	56.0	1.4e-52
WP_071556700.1|5180182_5180533_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	54.8	3.5e-27
WP_071556701.1|5180534_5181458_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	42.9	4.9e-52
WP_074075488.1|5181447_5184477_+|tail	phage tail protein I	tail	D5LGZ2	Escherichia_phage	40.7	8.4e-24
WP_024359481.1|5184473_5184689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071556703.1|5184673_5185771_+|tail	phage tail protein	tail	A0A1J0GW57	Streptomyces_phage	67.3	4.0e-08
WP_071556704.1|5186208_5187192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071004935.1|5187522_5187990_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	62.7	5.0e-53
WP_071556705.1|5188005_5190981_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	46.2	1.2e-219
WP_053086776.1|5190967_5191105_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	65.9	5.8e-10
WP_071556706.1|5191125_5191443_-|tail	phage tail protein	tail	B9A7B2	Serratia_phage	53.8	1.8e-17
WP_032720030.1|5191488_5192004_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.8	7.4e-58
WP_048978256.1|5192003_5193176_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	70.2	8.5e-158
WP_071556707.1|5193330_5194470_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	70.7	6.1e-145
WP_071556708.1|5194513_5194765_+	ogr/Delta-like zinc finger family protein	NA	A0A2I8TV89	Erwinia_phage	49.2	3.4e-08
WP_004176548.1|5195029_5195269_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
5194861:5194878	attR	AAAAAAAGCCCCGTCGGG	NA	NA	NA	NA
WP_014343000.1|5195258_5195597_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_004176547.1|5195601_5196111_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_004140471.1|5196256_5196949_+	CTP synthase	NA	NA	NA	NA	NA
WP_020324105.1|5196980_5198156_-	CynX/NimT family MFS transporter	NA	NA	NA	NA	NA
WP_004224197.1|5198263_5199058_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002901080.1|5199041_5199488_-	DUF441 domain-containing protein	NA	NA	NA	NA	NA
WP_002901088.1|5199604_5200105_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	0	5005	183432		Ochrobactrum_phage(100.0%)	6	NA	NA
WP_029497408.1|766_1249_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_094645258.1|1236_1524_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_074075300.1|1748_2114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008460272.1|2157_2895_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_004196322.1|2908_3598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196363.1|3628_5005_-	chromate efflux transporter	NA	A0A219VHC2	Ochrobactrum_phage	64.6	1.6e-27
>prophage 2
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	12224	32323	183432	transposase	Escherichia_phage(25.0%)	25	NA	NA
WP_094645257.1|12224_13594_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	70.0	3.8e-77
WP_004182064.1|13793_14168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194231.1|14223_14550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015065618.1|14546_15275_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004194235.1|15271_15703_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_020277924.1|15747_17805_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	5.3e-22
WP_032431380.1|17874_18123_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_063445496.1|18171_18714_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	1.0e-49
WP_032431403.1|19432_19753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|19787_20042_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_001568047.1|20228_20420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013214014.1|20462_20969_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_032435770.1|21011_21440_-	antirestriction protein	NA	NA	NA	NA	NA
WP_013214013.1|22119_22887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568043.1|22940_23360_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|23369_23591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|23590_24292_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
WP_001568040.1|24728_24959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032435767.1|25021_25693_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_064182005.1|25695_26667_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568036.1|26900_27332_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	2.1e-29
WP_074075301.1|27331_28603_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.8e-152
WP_001568034.1|28684_29659_-	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	53.5	1.4e-86
WP_011977818.1|29658_30864_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.3	5.3e-163
WP_042938944.1|31567_32323_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.6	3.4e-136
>prophage 3
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	39504	90720	183432	transposase,integrase	Stx2-converting_phage(47.37%)	56	35716:35731	66047:66062
35716:35731	attL	TTGGATTGCCATTTTT	NA	NA	NA	NA
WP_032741643.1|39504_40440_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.8	9.6e-72
WP_077274102.1|40585_41374_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	2.5e-49
WP_074075305.1|41370_42051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124074497.1|42093_42429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074075320.1|42575_43037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|42993_43224_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|43220_43637_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004206609.1|43710_45273_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000361404.1|45257_46280_+	helicase UvrD	NA	NA	NA	NA	NA
WP_031592169.1|46817_47732_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_004187110.1|47917_48268_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	51.4	6.0e-19
WP_074075306.1|48415_48847_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555737.1|49097_50573_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000697969.1|50565_51246_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	2.1e-31
WP_023292107.1|51435_52821_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|52849_53203_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004098959.1|53316_54609_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|54619_57766_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|57852_58293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|58419_60867_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|60907_61105_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|61138_61876_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|62164_62614_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|62847_64665_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001378118.1|64670_65561_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|65600_65981_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|65985_66915_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
66047:66062	attR	TTGGATTGCCATTTTT	NA	NA	NA	NA
WP_001188930.1|66969_67650_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_074075307.1|67646_69047_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	5.4e-18
WP_074075308.1|69264_69699_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_064163798.1|69826_71398_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.9	5.8e-170
WP_000624622.1|71417_71765_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_001339397.1|71764_72442_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_004118688.1|72784_72883_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004118349.1|72869_73049_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_009310051.1|73362_73626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310052.1|73622_74189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310053.1|74219_74714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009310054.1|74757_75126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098931.1|75156_75360_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004098928.1|75408_75666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118702.1|75741_75996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076611902.1|76205_77552_+|transposase	ISNCY-like element ISLad2 family transposase	transposase	NA	NA	NA	NA
WP_032414145.1|77610_78414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032414142.1|78427_79789_+	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_016239970.1|79941_80382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072030980.1|80399_81206_+	SecC motif-containing protein	NA	NA	NA	NA	NA
WP_064357852.1|81456_82233_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_017899891.1|82473_82797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013023770.1|84192_85374_+	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_074075310.1|85808_87398_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	2.1e-188
WP_032414478.1|87427_87778_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	3.1e-39
WP_015632445.1|87774_88182_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	40.2	1.4e-14
WP_023290558.1|88385_89924_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.3	3.9e-280
WP_074075311.1|89983_90319_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	1.5e-59
WP_023290559.1|90315_90720_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
>prophage 4
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	95584	98483	183432		Tupanvirus(50.0%)	3	NA	NA
WP_064357907.1|95584_96697_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	25.6	8.1e-09
WP_064357835.1|97045_97510_+	RpiB/LacA/LacB family sugar-phosphate isomerase	NA	NA	NA	NA	NA
WP_064357833.1|97532_98483_+	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	36.7	4.6e-13
>prophage 5
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	104523	105270	183432		Planktothrix_phage(100.0%)	1	NA	NA
WP_032693911.1|104523_105270_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	4.1e-25
>prophage 6
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	110330	114326	183432	transposase	Wolbachia_phage(33.33%)	3	NA	NA
WP_048338015.1|110330_110810_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	34.0	3.1e-18
WP_071836379.1|110793_113796_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	62.5	0.0e+00
WP_003100847.1|113768_114326_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	63.2	3.3e-59
>prophage 7
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	118036	129941	183432		uncultured_Caudovirales_phage(77.78%)	13	NA	NA
WP_004118540.1|118036_118594_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	47.2	8.4e-39
WP_004118538.1|118725_119058_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011977829.1|119411_120560_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	65.9	1.7e-123
WP_004118534.1|120834_121209_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	56.0	4.5e-28
WP_001549953.1|121737_122934_+	MFS transporter	NA	NA	NA	NA	NA
WP_004118529.1|123005_123833_-	universal stress protein	NA	NA	NA	NA	NA
WP_001549885.1|123851_125330_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	74.0	1.6e-198
WP_001549886.1|125813_126167_+	metalloregulator ArsR/SmtB family transcription factor	NA	A0A2H4J145	uncultured_Caudovirales_phage	57.1	5.9e-22
WP_001549887.1|126262_127546_+	arsenic transporter	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.6	2.9e-175
WP_001549888.1|127595_128024_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	2.3e-52
WP_025801347.1|128081_128795_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	73.4	5.1e-97
WP_001549890.1|128800_129133_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_009309887.1|129629_129941_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	40.0	2.1e-15
>prophage 8
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	166813	171770	183432	transposase	Escherichia_phage(33.33%)	5	NA	NA
WP_000019445.1|166813_167794_+|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.4	1.0e-185
WP_020805752.1|168440_168833_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_020316636.1|169264_169744_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_020277941.1|169781_170312_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	32.6	4.4e-05
WP_020277940.1|170936_171770_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	34.7	3.1e-21
>prophage 9
NZ_CP018670	Klebsiella pneumoniae strain CAV1042 plasmid pCAV1042-183, complete sequence	183432	176221	180420	183432	transposase	uncultured_Caudovirales_phage(66.67%)	5	NA	NA
WP_000323025.1|176221_176509_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|176508_176748_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_020277922.1|177010_177934_-	cation transporter	NA	NA	NA	NA	NA
WP_001515348.1|178133_178706_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_003030308.1|179181_180420_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	22.4	2.4e-09
>prophage 1
NZ_CP018669	Klebsiella pneumoniae strain CAV1042 plasmid pKPC_CAV1042-89, complete sequence	88688	21782	52662	88688	transposase,protease,integrase	Escherichia_phage(44.44%)	36	19409:19423	25804:25818
19409:19423	attL	ACGAACAGGGGGAAT	NA	NA	NA	NA
WP_004187383.1|21782_22523_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	51.6	9.5e-22
WP_020316874.1|22541_22745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004187390.1|22786_23272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206901.1|23268_23856_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_004187394.1|23848_24097_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	53.0	1.6e-10
WP_004206900.1|24083_24554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206899.1|24694_25240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206898.1|25392_25800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015062853.1|25801_26380_-	hypothetical protein	NA	NA	NA	NA	NA
25804:25818	attR	ATTCCCCCTGTTCGT	NA	NA	NA	NA
WP_004206896.1|26357_26714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004206895.1|27241_28516_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_004206894.1|28533_28791_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004206893.1|28791_29475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187411.1|29519_29738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187413.1|29740_29950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004187425.1|31324_31759_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	55.3	1.2e-29
WP_147810693.1|31851_32217_-	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_004187429.1|32185_32443_-	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_004206890.1|32534_33188_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_004206889.1|33267_33651_+	DUF1496 domain-containing protein	NA	NA	NA	NA	NA
WP_004187436.1|33755_34151_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_004206887.1|34195_35458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004206886.1|35468_36419_+	DsbC family protein	NA	NA	NA	NA	NA
WP_004206885.1|36431_38519_+	conjugal transfer protein TrbC	NA	NA	NA	NA	NA
WP_000509966.1|39101_39707_-	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_000427623.1|42289_43294_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_002210513.1|44133_44895_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_020316986.1|44915_45776_-	class A extended-spectrum beta-lactamase SHV-7	NA	A0A077SL40	Escherichia_phage	99.0	6.4e-155
WP_000654805.1|45896_46865_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.9	7.7e-181
WP_000732275.1|46930_47206_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|47233_47659_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_001067855.1|47854_48559_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|48680_49586_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|49582_50821_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|50820_51405_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|51897_52662_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
