The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017291	Corynebacterium pseudotuberculosis strain MEX30 chromosome, complete genome	2368140	1753330	1830744	2368140	protease,integrase,bacteriocin,tRNA	Agrobacterium_phage(15.38%)	57	1805497:1805524	1811402:1811429
WP_041478401.1|1753330_1756066_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.9	8.3e-140
WP_013242455.1|1756232_1757213_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014367460.1|1757815_1758574_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014367461.1|1758632_1759919_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.8e-132
WP_075142769.1|1760079_1762884_-	chorismate-binding protein	NA	A0A0B5J984	Pandoravirus	33.6	1.3e-79
WP_013242459.1|1762960_1763590_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1763605_1764205_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1764415_1765768_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1766556_1766799_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_075142770.1|1766935_1767712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1767798_1768809_-	pirin family protein	NA	NA	NA	NA	NA
WP_075142771.1|1768895_1769399_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_075142772.1|1769465_1770086_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075142773.1|1770419_1773038_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_151899125.1|1773174_1773480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075140858.1|1774157_1774550_+	globin	NA	NA	NA	NA	NA
WP_075142774.1|1774561_1775458_+	DMT family transporter	NA	NA	NA	NA	NA
WP_013242473.1|1775461_1776070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1776075_1776504_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1776711_1778382_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014367473.1|1778572_1779133_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_075142775.1|1779660_1781415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075142776.1|1781411_1782950_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367478.1|1782976_1784455_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_075142777.1|1787054_1788068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075142778.1|1788064_1789045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367482.1|1789083_1789254_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014367484.1|1790799_1791558_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1791554_1792478_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_075142779.1|1792568_1794614_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_075142780.1|1795206_1797492_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014367489.1|1797511_1797712_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_075142781.1|1800152_1801148_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014523547.1|1801274_1802078_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1802143_1802803_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014367495.1|1802982_1803810_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1803862_1805053_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
1805497:1805524	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_050494099.1|1805671_1806349_+	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_075140840.1|1806461_1806803_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032802512.1|1807253_1808258_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_052399380.1|1808254_1808692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367498.1|1810141_1810699_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_071437099.1|1811041_1811272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367502.1|1811741_1812740_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1811402:1811429	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1812939_1813494_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1813502_1813847_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013242498.1|1813968_1814244_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_075142782.1|1814332_1814812_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1814849_1815503_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242501.1|1815515_1815905_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_075142783.1|1816035_1825134_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_075142784.1|1825358_1825664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367507.1|1825824_1826940_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014367508.1|1826936_1827563_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014524035.1|1828820_1829579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075142785.1|1829670_1830000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075142786.1|1830078_1830744_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
