The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017292	Corynebacterium pseudotuberculosis strain MEX31, complete genome	2367880	1753087	1830501	2367880	tRNA,integrase,bacteriocin,protease	Agrobacterium_phage(14.29%)	58	1805253:1805280	1811164:1811191
WP_041478401.1|1753087_1755823_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.9	8.3e-140
WP_013242455.1|1755989_1756970_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014367460.1|1757572_1758331_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014367461.1|1758389_1759676_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.8e-132
WP_014523534.1|1759836_1762641_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1762717_1763347_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1763362_1763962_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1764172_1765525_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1766313_1766556_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1766692_1767469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1767555_1768566_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1768682_1769156_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1769222_1769843_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014367469.1|1770176_1772792_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_014523536.1|1773213_1773792_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_075140858.1|1773910_1774303_+	globin	NA	NA	NA	NA	NA
WP_013242473.1|1775213_1775822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1775827_1776256_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1776463_1778134_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014367473.1|1778323_1778884_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014367476.1|1779412_1781167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1781163_1782702_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367478.1|1782728_1784207_+	nitroreductase	NA	NA	NA	NA	NA
WP_014367479.1|1784203_1786807_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1786806_1787820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1787816_1788797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367482.1|1788835_1789006_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014733038.1|1789079_1790531_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1790552_1791311_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1791307_1792231_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367486.1|1792321_1794367_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014367488.1|1794959_1797245_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014367489.1|1797264_1797465_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367490.1|1797805_1799632_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_014733040.1|1799907_1800903_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014523547.1|1801029_1801833_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1801898_1802558_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014367495.1|1802737_1803565_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1803618_1804809_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1805253:1805280	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_080713377.1|1806047_1806560_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_032802512.1|1807011_1808016_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_048480960.1|1808012_1808504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052399378.1|1809126_1809600_+	hypothetical protein	NA	A0A2H4J297	uncultured_Caudovirales_phage	61.5	4.6e-14
WP_014367498.1|1809902_1810460_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_014367502.1|1811503_1812502_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1811164:1811191	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_013242496.1|1812641_1813256_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	7.6e-17
WP_014800825.1|1813264_1813609_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013242498.1|1813730_1814006_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1814094_1814574_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1814611_1815265_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242501.1|1815277_1815667_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014367505.1|1815797_1824896_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1825120_1825426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367507.1|1825586_1826702_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014367508.1|1826698_1827325_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014367509.1|1827368_1828400_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014524035.1|1828581_1829340_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050859096.1|1829838_1830501_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP017292	Corynebacterium pseudotuberculosis strain MEX31, complete genome	2367880	1985013	1993474	2367880	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014367621.1|1985013_1986762_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
WP_014367622.1|1986739_1987408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1987415_1987802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1987798_1988314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1988324_1988771_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367625.1|1988767_1989223_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1989224_1989566_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1989552_1990335_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1990336_1990900_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_014367629.1|1990892_1992896_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.8e-111
WP_014300955.1|1992892_1993474_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
