The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	90945	132878	4994377	transposase	Ostreococcus_lucimarinus_virus(20.0%)	31	NA	NA
WP_117231458.1|90945_91708_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407202.1|91715_93440_-	AarF/ABC1/UbiB kinase family protein	NA	A0A0P0CRE2	Ostreococcus_lucimarinus_virus	28.7	1.7e-34
WP_075238958.1|93680_94622_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_075238959.1|94814_96179_+	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_011257104.1|96175_97804_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_027703733.1|98277_99861_+	glycogen synthase GlgA	NA	NA	NA	NA	NA
WP_075238960.1|99857_102092_+	1,4-alpha-glucan branching enzyme	NA	NA	NA	NA	NA
WP_011257107.1|102094_103852_+	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_143699215.1|103908_105798_+	4-alpha-glucanotransferase	NA	NA	NA	NA	NA
WP_027703731.1|105794_108404_+	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_011407199.1|108426_108612_+	DUF2934 domain-containing protein	NA	NA	NA	NA	NA
WP_011257110.1|108726_110889_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_075238962.1|110905_111538_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075244499.1|111701_112199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407197.1|112339_113386_-	methylamine utilization protein	NA	NA	NA	NA	NA
WP_164993797.1|113484_114441_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.1	4.8e-42
WP_125168734.1|114547_114826_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_109182027.1|114822_115788_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|117502_118301_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080256644.1|119035_119494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704081.1|119493_119826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257122.1|119842_120103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041181902.1|120922_121138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024743401.1|121415_122825_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011407187.1|123173_123605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443638.1|123879_124215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257127.1|124654_125944_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.2	2.1e-40
WP_164993798.1|126562_127543_+|transposase	IS5-like element ISXoo7 family transposase	transposase	A0A077K814	Ralstonia_phage	55.9	5.3e-89
WP_012443642.1|128008_128332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443643.1|128273_128516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993799.1|131501_132878_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.9	4.1e-79
>prophage 2
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	136962	225954	4994377	tRNA,transposase	Ralstonia_phage(27.27%)	47	NA	NA
WP_164993800.1|136962_137919_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	4.8e-42
WP_011407239.1|138921_139611_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	1.3e-36
WP_011257145.1|139623_140781_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011257146.1|140793_142104_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_164993801.1|142783_143749_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703668.1|143979_144231_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_162866907.1|144683_145112_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_075239625.1|145108_145339_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_011407244.1|145405_146068_-	hemolysin III	NA	NA	NA	NA	NA
WP_041181908.1|146245_148741_+	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	36.0	1.5e-07
WP_011257154.1|148737_150564_+	exonuclease	NA	NA	NA	NA	NA
WP_011407248.1|151052_153197_-	avirulence protein	NA	NA	NA	NA	NA
WP_011407249.1|153387_154545_-	ROK family protein	NA	NA	NA	NA	NA
WP_075239658.1|154717_157306_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257157.1|157316_158102_+	DUF1868 domain-containing protein	NA	NA	NA	NA	NA
WP_027703672.1|158415_159606_-	saccharopine dehydrogenase	NA	NA	NA	NA	NA
WP_011407253.1|160705_161011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257160.1|161312_162566_-	DNA topoisomerase IB	NA	A0A0U2TSJ7	Niemeyer_virus	35.5	1.7e-39
WP_011257161.1|162622_163003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257162.1|163204_167677_+	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_048488471.1|167871_169353_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_164993802.1|169849_170815_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187715.1|172458_173221_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257172.1|173251_174628_-|transposase	IS5-like element ISXo9 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	52.7	3.4e-73
WP_075239359.1|176029_177088_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_041181912.1|177302_177830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042464354.1|178652_180836_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_075239358.1|180847_184198_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_011257178.1|184194_187311_-	DUF3416 domain-containing protein	NA	NA	NA	NA	NA
WP_011257184.1|194456_195977_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_011257185.1|195993_196272_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_011257186.1|196461_196800_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_011407279.1|197412_199398_+	beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_011257188.1|200317_201130_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_011257189.1|201322_201934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257190.1|202350_203208_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	31.5	2.9e-14
WP_011257191.1|203445_205332_+	arginine decarboxylase	NA	NA	NA	NA	NA
WP_094187715.1|205720_206483_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164993803.1|208472_211196_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.0	2.8e-71
WP_164993804.1|211263_213414_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.1	1.2e-27
WP_164993805.1|213410_215105_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|215101_215365_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_164993806.1|215426_217634_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.2	1.6e-19
WP_075247578.1|217630_219307_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075247211.1|219626_221828_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	30.1	3.4e-19
WP_075240359.1|221824_223516_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_012443704.1|224049_225954_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	270695	316447	4994377	transposase	Staphylococcus_prophage(28.57%)	31	NA	NA
WP_133264764.1|270695_271793_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164993807.1|272235_273555_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407313.1|273723_274782_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	45.7	3.0e-77
WP_011257237.1|275089_276163_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257238.1|276925_277978_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_011257239.1|278625_279756_+	glycoside hydrolase family 5 protein	NA	NA	NA	NA	NA
WP_117231470.1|280010_280967_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	2.0e-40
WP_011257241.1|281200_281590_+	YchJ family protein	NA	NA	NA	NA	NA
WP_011407316.1|281797_282004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239333.1|282297_284460_+	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_011407318.1|285015_286320_+	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_011407319.1|286379_286982_+	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_011257245.1|286978_288883_+	GAF domain-containing protein	NA	Q6XLU9	Feldmannia_irregularis_virus	27.7	3.9e-19
WP_075239683.1|298202_299018_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.8	9.8e-20
WP_164993808.1|299364_300327_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_109182012.1|300431_301194_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257253.1|302993_304052_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_011257254.1|304062_304353_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_011257255.1|304342_305005_-	organic solvent ABC transporter	NA	NA	NA	NA	NA
WP_012446379.1|305001_305553_-	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_012446378.1|305564_306314_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407332.1|306313_307108_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	27.8	1.7e-08
WP_011257259.1|307492_307780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703982.1|307798_308356_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_109182061.1|308373_309339_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_164993809.1|310184_311141_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.0	2.0e-40
WP_094187715.1|311212_311975_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_117231475.1|312014_312813_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164993810.1|312944_314159_+|transposase	IS4 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	32.9	5.0e-52
WP_117231476.1|314218_315049_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164993811.1|315211_316447_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	337676	398731	4994377	holin,tRNA,transposase	Acidithiobacillus_phage(14.29%)	49	NA	NA
WP_117328743.1|337676_339158_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	65.6	7.8e-100
WP_129215657.1|339350_340316_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_075239338.1|341142_343305_+	type III secretion system effector protein	NA	NA	NA	NA	NA
WP_075239339.1|343425_345594_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_011257288.1|346231_346861_-|holin	lysophosphatidylcholine acyltransferase	holin	NA	NA	NA	NA
WP_011257289.1|346863_347295_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011407361.1|347351_347930_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_027703865.1|348025_348778_-	pseudouridylate synthase	NA	NA	NA	NA	NA
WP_075239340.1|349002_349392_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011257293.1|349505_351179_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5EQY1	Bathycoccus_sp._RCC1105_virus	28.6	3.1e-28
WP_011257294.1|351175_351820_-	sterol-binding protein	NA	NA	NA	NA	NA
WP_027703866.1|352054_353164_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_011407366.1|355510_355795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187728.1|356146_356945_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257570.1|357462_358698_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_012446345.1|359124_360063_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_011407377.1|360181_360931_-	DUF3800 domain-containing protein	NA	A0A1W6JTE9	Pseudomonas_phage	44.4	5.6e-54
WP_012446343.1|360933_361725_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257314.1|361742_362738_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	31.0	9.4e-25
WP_027703500.1|362774_363602_+	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_027703501.1|363686_364676_-	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_011407380.1|364741_365014_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_153296754.1|365134_365296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703502.1|365499_366087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257320.1|366083_366284_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_027703503.1|366344_367946_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075239319.1|367977_368724_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.9	2.6e-19
WP_011257323.1|368720_369914_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407386.1|370323_371346_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_041181930.1|371485_373051_-	tryptophan 7-halogenase	NA	E3SL43	Synechococcus_phage	28.8	7.3e-40
WP_011257326.1|373061_374075_-	cupin-like domain-containing protein	NA	NA	NA	NA	NA
WP_011407388.1|374064_374766_-	SapC family protein	NA	NA	NA	NA	NA
WP_011407389.1|374949_377964_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011257330.1|378353_379043_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_069959690.1|379467_381705_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_012446330.1|381913_383704_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_027703507.1|383805_384264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257334.1|384928_385921_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_075239455.1|386108_387101_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_041181933.1|387193_388105_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407395.1|388232_388985_-	DNA/RNA non-specific endonuclease	NA	H6X497	Enterobacteria_phage	33.9	5.6e-22
WP_069965028.1|389218_391753_+	iron-uptake factor	NA	NA	NA	NA	NA
WP_027703509.1|392375_393257_-	TolB-like protein	NA	NA	NA	NA	NA
WP_011257342.1|393309_394161_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_011407398.1|394162_394549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257344.1|394583_394733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257345.1|395010_397143_+	ATP-dependent DNA helicase DinG	NA	NA	NA	NA	NA
WP_011407399.1|397416_397683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182027.1|397765_398731_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	420197	543299	4994377	tRNA,transposase	Acinetobacter_phage(23.08%)	106	NA	NA
WP_011257370.1|420197_421487_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257371.1|421539_422562_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_042464401.1|422949_424677_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_011257373.1|425177_425630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257375.1|426593_427502_+	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_011407417.1|427581_428697_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011257378.1|429397_429931_-	cytochrome b	NA	NA	NA	NA	NA
WP_012446301.1|429927_431019_-	catalase family peroxidase	NA	NA	NA	NA	NA
WP_012446300.1|431183_431699_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_075239666.1|432502_433873_-	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	31.2	3.1e-26
WP_011257383.1|433913_434651_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_075239667.1|434782_435889_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011257385.1|437024_437924_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_011257386.1|438197_438929_-	ComF family protein	NA	NA	NA	NA	NA
WP_011257387.1|438972_440007_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_011407420.1|440098_441304_+	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_164993812.1|441728_442787_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027704265.1|442966_443704_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	27.8	7.0e-09
WP_075239044.1|443852_444065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239045.1|444232_445855_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_024712381.1|445851_446673_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_024712382.1|446669_447443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239046.1|447442_448642_-	beta-ketoacyl-[acyl-carrier-protein] synthase family protein	NA	NA	NA	NA	NA
WP_075239048.1|448860_449121_+	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_075239047.1|449113_452434_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_041181939.1|452460_452790_+	phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_012446285.1|452853_454653_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_011407429.1|454649_456446_+	glucose-6-phosphate dehydrogenase	NA	M4SP85	Cyanophage	38.4	1.4e-79
WP_011258529.1|456601_457570_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_011407430.1|458086_459406_+|transposase	IS701-like element ISXo15 family transposase	transposase	NA	NA	NA	NA
WP_069965005.1|461028_462405_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	1.4e-79
WP_075239490.1|462553_464266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409585.1|464455_466687_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_094187806.1|467290_468393_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	1.1e-39
WP_011409581.1|469820_470402_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	59.3	3.2e-65
WP_011260499.1|470553_471183_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_011409580.1|471300_472338_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	44.1	7.2e-76
WP_011260497.1|472474_473272_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	52.9	7.5e-65
WP_011409579.1|473264_473981_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_011260495.1|474301_474994_-	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_011260494.1|475131_475926_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_011409578.1|476085_476400_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_011260492.1|476669_477323_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_011260491.1|477508_477937_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_005990700.1|477940_478333_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_011260490.1|478881_479499_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_027703893.1|479579_479795_+	bacterioferritin	NA	NA	NA	NA	NA
WP_003483093.1|480137_480608_+	bacterioferritin	NA	NA	NA	NA	NA
WP_109182027.1|480620_481586_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_164993916.1|481664_482644_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.9	4.3e-38
WP_075239386.1|482803_486004_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_075239385.1|486280_486757_+	DUF2244 domain-containing protein	NA	NA	NA	NA	NA
WP_075239384.1|486773_487727_+	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_011260484.1|487765_489370_+	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_011260483.1|489344_489524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443948.1|489520_490117_+	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_011260481.1|490155_491031_+	cytochrome c oxidase subunit 3	NA	NA	NA	NA	NA
WP_012443949.1|491123_491342_-	twin transmembrane helix small protein	NA	NA	NA	NA	NA
WP_012443950.1|491402_492122_+	SURF1 family protein	NA	NA	NA	NA	NA
WP_011260478.1|492149_492725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260477.1|492735_493899_+	heme A synthase	NA	NA	NA	NA	NA
WP_011409570.1|493901_494798_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_011409569.1|495186_496767_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_033013369.1|496950_497997_-	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_059317500.1|498221_498488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182298.1|498487_498733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239378.1|500060_501809_-	DNA primase	NA	A0A1S5RF71	Helicobacter_phage	34.5	4.2e-44
WP_012443989.1|501898_502861_-	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_011409564.1|504338_504785_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	45.2	1.0e-23
WP_002808376.1|505092_505308_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_069964611.1|505587_506652_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	56.6	4.3e-100
WP_011409563.1|506730_507087_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_011260467.1|507314_509486_+	beta-glucosidase	NA	NA	NA	NA	NA
WP_117231608.1|510088_510852_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_128896944.1|510976_511942_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409560.1|512635_513598_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_075239024.1|514593_515772_-	PQQ-dependent sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011260461.1|515946_516381_+	membrane protein	NA	NA	NA	NA	NA
WP_011260459.1|516941_517223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993813.1|517426_518189_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_027704068.1|518248_519565_-	amino acid permease	NA	NA	NA	NA	NA
WP_011260456.1|519561_520338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182294.1|521014_521977_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|522196_522994_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260454.1|523149_524247_-	dipeptide epimerase	NA	NA	NA	NA	NA
WP_012444005.1|524243_525656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756368.1|525879_526686_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_011409548.1|526778_527525_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260450.1|527831_528029_+	CPXCG motif-containing cysteine-rich protein	NA	NA	NA	NA	NA
WP_011260449.1|528239_528617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409547.1|528842_529184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260447.1|529390_529831_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_075239561.1|529868_530618_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409543.1|530755_531331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042465763.1|531455_532073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099051302.1|532115_532913_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260442.1|532921_533731_-	glycosyltransferase family 25 protein	NA	NA	NA	NA	NA
WP_012444011.1|533906_534710_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_027703938.1|534813_535791_+	uroporphyrin-III methyltransferase	NA	NA	NA	NA	NA
WP_011260439.1|535787_537053_+	porphyrin biosynthesis protein	NA	NA	NA	NA	NA
WP_011409538.1|537478_538003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239392.1|538132_539428_-	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_027703940.1|539517_540402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|540496_541259_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260435.1|541420_541801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115862289.1|542333_543299_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	564167	624394	4994377	transposase	Leptospira_phage(22.22%)	39	NA	NA
WP_011407587.1|564167_565202_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011409560.1|565663_566626_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_012444032.1|567164_568091_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0M4JBD3	Mollivirus	34.7	3.9e-49
WP_024711902.1|568299_568629_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_011260410.1|569023_569695_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_011260409.1|569691_570183_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260408.1|570417_571347_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_011409514.1|571937_573413_+	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.5	3.1e-40
WP_143701938.1|573447_574296_+	threonine aldolase	NA	NA	NA	NA	NA
WP_164993917.1|574344_575445_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.3	2.9e-43
WP_027704189.1|575643_576240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239510.1|576587_578171_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.3	7.2e-35
WP_075239511.1|578560_578752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113328116.1|580329_581019_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_075239513.1|581268_583593_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_012444041.1|585495_586587_-	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_011258802.1|586931_587900_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182865.1|588122_589196_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075240327.1|589093_589696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044757311.1|589787_590666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409500.1|590863_591739_+	DMT family transporter	NA	NA	NA	NA	NA
WP_075239194.1|592014_593787_-	cellulase family glycosylhydrolase	NA	NA	NA	NA	NA
WP_011260393.1|594195_595896_-	1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011260392.1|597062_598439_+	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_027703842.1|598532_599528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703841.1|599773_600685_+	magnesium transporter	NA	NA	NA	NA	NA
WP_012444053.1|601279_601564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409497.1|601894_602341_+	autotransporter	NA	NA	NA	NA	NA
WP_075239196.1|602884_604558_-	alpha,alpha-trehalase TreA	NA	NA	NA	NA	NA
WP_075239199.1|604811_605597_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_164993814.1|606644_607406_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075239266.1|607659_608664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182280.1|608702_609632_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_075239267.1|610179_613050_-	insulinase family protein	NA	NA	NA	NA	NA
WP_143700763.1|613304_615929_+	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_075239268.1|617163_618582_-	cellulase family glycosylhydrolase	NA	H2DE45	Erwinia_phage	32.3	7.3e-47
WP_012444070.1|618789_620277_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	56.9	1.6e-124
WP_011260378.1|621667_623317_+	M28 family peptidase	NA	NA	NA	NA	NA
WP_094187736.1|623630_624394_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	646684	771390	4994377	protease,transposase	Ralstonia_phage(13.64%)	87	NA	NA
WP_011260360.1|646684_647236_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_075239427.1|647346_648714_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	8.1e-43
WP_011260358.1|648887_649511_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011409473.1|649810_650530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444089.1|650701_652714_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_011409471.1|652835_653726_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_011409470.1|653898_654660_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_075239504.1|656398_657475_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_094187763.1|657600_658399_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069964753.1|659577_660078_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011260350.1|660074_660530_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_011260344.1|661723_662656_-	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_012444096.1|662931_663978_+	rod shape-determining protein	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.2	4.6e-06
WP_075239374.1|664150_665497_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_075239375.1|665493_665979_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_011409461.1|665982_668043_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_011260340.1|668039_669158_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_080496269.1|669923_672692_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_075239457.1|672688_674413_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2H4JIA8	uncultured_Caudovirales_phage	24.3	2.6e-22
WP_143700792.1|674418_675177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260336.1|676511_677651_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011260335.1|677647_679063_+	septal ring lytic transglycosylase RlpA family protein	NA	F5B3X9	Synechococcus_phage	50.6	4.3e-15
WP_011260334.1|679563_680769_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.9	4.6e-66
WP_011409453.1|681834_682113_+	YbeD family protein	NA	NA	NA	NA	NA
WP_011260332.1|682100_682799_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_011260331.1|682813_683827_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_011260328.1|684226_686410_+	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	31.6	2.8e-82
WP_103057229.1|686701_687556_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_075239459.1|687728_688784_+	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	46.8	1.9e-79
WP_011409450.1|688906_690310_+	nicotinate phosphoribosyltransferase	NA	A0A218M332	Acidovorax_phage	51.5	8.1e-131
WP_012444115.1|692566_693328_+	DUF2242 domain-containing protein	NA	NA	NA	NA	NA
WP_011409446.1|693452_693833_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_075239460.1|694004_695342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069964758.1|695362_696304_+	decarboxylating 6-phosphogluconate dehydrogenase	NA	M4SJX8	Cyanophage	44.6	1.7e-68
WP_011260318.1|696643_697696_-	oxidoreductase	NA	NA	NA	NA	NA
WP_011260317.1|697846_698218_+	BON domain-containing protein	NA	NA	NA	NA	NA
WP_011409443.1|698503_700315_+	PAS domain S-box protein	NA	A0A2K9L0Z8	Tupanvirus	28.3	3.5e-09
WP_011260315.1|700311_700752_+	response regulator	NA	NA	NA	NA	NA
WP_011260314.1|700755_702258_+	hybrid sensor histidine kinase/response regulator	NA	A0A2K9L5I4	Tupanvirus	26.2	1.1e-08
WP_011260313.1|702349_702865_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011260312.1|703033_703771_-	pteridine reductase	NA	NA	NA	NA	NA
WP_011260311.1|703838_705023_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_164993815.1|706458_707694_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_075239043.1|708425_711116_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011260306.1|711266_714164_+	glycoside hydrolase family 2 protein	NA	L0N6M2	Herpes_simplex_virus	25.2	8.8e-23
WP_011409433.1|716719_717886_+	DUF1624 domain-containing protein	NA	NA	NA	NA	NA
WP_011409432.1|718100_718868_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703724.1|718912_720190_+	sugar MFS transporter	NA	NA	NA	NA	NA
WP_011409431.1|720230_721307_+	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011260300.1|721303_722332_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_011409430.1|722334_723489_+	N-acetylglucosamine-6-phosphate deacetylase	NA	NA	NA	NA	NA
WP_012444131.1|723908_724514_-	poly-beta-1,6-N-acetyl-D-glucosamine biosynthesis protein PgaD	NA	NA	NA	NA	NA
WP_011260297.1|724510_725764_-	poly-beta-1,6 N-acetyl-D-glucosamine synthase	NA	NA	NA	NA	NA
WP_011409429.1|725765_727664_-	poly-beta-1,6-N-acetyl-D-glucosamine N-deacetylase PgaB	NA	NA	NA	NA	NA
WP_011409428.1|727665_729708_-	poly-beta-1,6 N-acetyl-D-glucosamine export porin PgaA	NA	NA	NA	NA	NA
WP_012444134.1|730331_730562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109182013.1|731029_731995_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011409423.1|735781_736744_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260292.1|736783_738016_-	multifunctional CCA addition/repair protein	NA	K4IEX3	Salmonella_phage	41.7	2.0e-72
WP_094187728.1|739662_740460_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012444143.1|741392_741659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_011407237.1|742417_743374_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|743450_744419_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075238956.1|744631_747196_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_151421363.1|747318_748308_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	3.7e-98
WP_011260285.1|750236_751004_-	endonuclease	NA	NA	NA	NA	NA
WP_011260284.1|751023_751839_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011409415.1|751930_752581_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_011260283.1|752674_753472_-	cytochrome c4	NA	NA	NA	NA	NA
WP_011409413.1|753616_754240_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_024744862.1|754334_755030_-	VIT family protein	NA	NA	NA	NA	NA
WP_103057733.1|755245_756610_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_075239687.1|756796_757435_-	histidine kinase	NA	W8CYF6	Bacillus_phage	23.4	1.9e-10
WP_075239686.1|757439_757703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239685.1|757660_758878_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_011409407.1|758940_759426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|759724_760681_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011409406.1|760885_761452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024712625.1|761451_762378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260274.1|762410_763910_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	3.3e-13
WP_027703214.1|763906_764686_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011260272.1|764764_765865_+	glycosyltransferase	NA	A0A142BZU7	Faustovirus	27.6	2.8e-14
WP_011260271.1|766986_767262_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_011409400.1|767326_768436_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	8.6e-35
WP_011260269.1|769137_769968_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_075239520.1|770097_770307_+	DUF4386 family protein	NA	NA	NA	NA	NA
WP_011258802.1|770421_771390_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 8
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	857768	927237	4994377	tRNA,transposase	Ralstonia_phage(18.18%)	57	NA	NA
WP_011258802.1|857768_858737_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011260196.1|860935_861934_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_041182594.1|862043_864236_-	carbohydrate-binding protein	NA	NA	NA	NA	NA
WP_011409356.1|864826_865777_-	ribokinase	NA	NA	NA	NA	NA
WP_011409355.1|865868_867167_-	nucleoside transporter NupC	NA	NA	NA	NA	NA
WP_153303323.1|867466_867841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|867916_868885_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011409354.1|872066_873035_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_027704205.1|873415_873655_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_094187715.1|874309_875072_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260189.1|875107_875755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260188.1|876056_876410_-	DMT family protein	NA	NA	NA	NA	NA
WP_012444225.1|879300_880218_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_011260186.1|880531_883015_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_011260185.1|883011_883611_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.2	1.5e-25
WP_012444227.1|883735_884389_+	arylesterase	NA	NA	NA	NA	NA
WP_002811889.1|884480_885194_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	2.5e-27
WP_011409346.1|885336_886608_+	HAMP domain-containing histidine kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.2	1.3e-10
WP_164993816.1|886911_887710_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260179.1|888033_888180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260178.1|888231_888735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409344.1|888917_889298_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_012444230.1|889393_890032_+	LemA family protein	NA	A0A0C5K8T5	Enterococcus_phage	25.4	2.5e-07
WP_164993817.1|890368_891178_+	YgcG family protein	NA	NA	NA	NA	NA
WP_011260174.1|891177_891669_+	membrane protein	NA	NA	NA	NA	NA
WP_011260173.1|891723_892614_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_011260172.1|892610_893405_+	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	67.8	3.0e-106
WP_027704106.1|893471_893759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260171.1|893755_894250_+	dihydrofolate reductase	NA	A0A1B2IBQ4	Erwinia_phage	46.9	3.0e-24
WP_011260170.1|894303_895260_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	S4TNS0	Salmonella_phage	25.3	1.3e-07
WP_011260169.1|895288_895672_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_011260168.1|895708_896497_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_075239525.1|896753_897725_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_011260166.1|897745_899137_-	chaperone SurA	NA	NA	NA	NA	NA
WP_012444236.1|899133_901575_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_075239524.1|901702_902611_-	histone deacetylase family protein	NA	A0A2K9L2T7	Tupanvirus	30.5	1.3e-36
WP_011260163.1|902648_903206_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011409335.1|903209_903788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409334.1|904086_905295_+	2-octaprenyl-6-methoxyphenyl hydroxylase	NA	NA	NA	NA	NA
WP_075239523.1|905291_906473_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_011409332.1|906600_907413_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_011260154.1|910098_910995_+	gallate dioxygenase	NA	NA	NA	NA	NA
WP_011409327.1|911431_912433_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703837.1|912617_914096_-	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.8	1.8e-40
WP_012444244.1|914298_915768_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011260150.1|915851_916679_-	p-hydroxycinnamoyl CoA hydratase/lyase	NA	NA	NA	NA	NA
WP_011260149.1|916724_917198_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011409323.1|917325_917733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703838.1|917932_918655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444246.1|918737_919616_-	gluconolactonase	NA	NA	NA	NA	NA
WP_012444247.1|919839_920949_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_011260144.1|921270_922314_-	23S rRNA (cytidine(2498)-2'-O)-methyltransferase RlmM	NA	NA	NA	NA	NA
WP_011260143.1|922350_922911_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_075239316.1|922910_923321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117328808.1|925091_926054_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_162886866.1|926108_926270_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_117231601.1|926474_927237_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	980874	1118244	4994377	protease,integrase,transposase	Bacillus_phage(19.05%)	110	982688:982747	1049059:1049119
WP_094187737.1|980874_981627_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|981628_982594_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
982688:982747	attL	CTTGCAGTTCATCCACCTGGCGTTCCTGGCACTGCTGCTCAGGAGATCGTGAACAGGTTC	NA	NA	NA	NA
WP_011257874.1|982857_983865_+	isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_075239314.1|984008_984770_-	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_012445939.1|988087_989380_+	trigger factor	NA	NA	NA	NA	NA
WP_002806026.1|989472_990099_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.4	1.0e-56
WP_011257881.1|990223_991510_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	59.9	9.0e-137
WP_012445937.1|991653_994125_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.2	1.7e-224
WP_002806049.1|994338_994611_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	64.0	2.2e-21
WP_011407728.1|995442_997413_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_143699387.1|997461_997797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407729.1|998167_999346_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_011257886.1|999342_1000110_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_011257887.1|1000122_1000779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257888.1|1000806_1001259_+	ribonuclease HI	NA	A0A1Q2U2R0	Vibrio_phage	55.4	2.8e-40
WP_011257889.1|1001267_1002002_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	40.4	8.7e-36
WP_011257891.1|1002437_1003142_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041181989.1|1003967_1004597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445927.1|1005488_1005689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993818.1|1006084_1008808_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	30.2	1.8e-70
WP_164993819.1|1008873_1011024_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	28.4	3.4e-27
WP_011407737.1|1011020_1012700_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1012696_1012960_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_164993820.1|1015224_1016904_+	DUF2875 family protein	NA	NA	NA	NA	NA
WP_075239641.1|1016900_1017164_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	43.4	7.5e-06
WP_164993821.1|1017225_1017783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993822.1|1017865_1018831_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407739.1|1018929_1019616_-|integrase	site-specific integrase	integrase	A0A077KET4	Ralstonia_phage	51.8	2.3e-54
WP_011257902.1|1019726_1020131_+	hypothetical protein	NA	A0A1C9C5K8	Heterosigma_akashiwo_virus	35.9	5.0e-17
WP_075239534.1|1020341_1021391_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_011257904.1|1021411_1022161_+	3-deoxy-D-manno-octulosonic acid kinase	NA	NA	NA	NA	NA
WP_011257905.1|1022160_1022910_+	MBL fold metallo-hydrolase	NA	A0A0A0RUN7	Bacillus_phage	26.0	2.4e-09
WP_011257906.1|1022909_1023941_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_011257907.1|1023958_1024318_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_075239535.1|1024342_1024840_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_014502241.1|1024836_1025082_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_075239536.1|1025078_1025525_+	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_011257911.1|1026086_1028183_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	40.7	4.1e-46
WP_011257912.1|1028189_1028510_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_011257913.1|1028607_1029201_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_011407744.1|1029302_1029653_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_011257915.1|1029772_1030306_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_075239537.1|1030302_1032255_-	DUF3488 domain-containing transglutaminase family protein	NA	NA	NA	NA	NA
WP_011257917.1|1032247_1033204_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011407746.1|1033209_1034163_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_012445908.1|1034201_1036070_+	membrane protein	NA	NA	NA	NA	NA
WP_044757517.1|1036841_1037264_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	61.9	5.2e-41
WP_011407749.1|1037585_1038101_+	peptide deformylase	NA	NA	NA	NA	NA
WP_041182379.1|1039848_1040595_+	cellulase	NA	NA	NA	NA	NA
WP_164993823.1|1040719_1041467_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407751.1|1041858_1043460_-	rhamnogalacturonase B	NA	NA	NA	NA	NA
WP_011257570.1|1044448_1045684_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_109182027.1|1046655_1047621_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|1048311_1049109_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407757.1|1049738_1050074_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
1049059:1049119	attR	CTTGCAGTTCATCCACCTGGCGTTCCTGGCACTGCTGCTCAGGAGATCGTGAACAGGTTCT	NA	NA	NA	NA
WP_011257932.1|1050405_1051332_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_075239617.1|1051392_1052169_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_011407759.1|1052470_1053142_-	methyltransferase	NA	NA	NA	NA	NA
WP_011407760.1|1053464_1054103_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_011257936.1|1054102_1055374_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_012445896.1|1055527_1056619_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_012445895.1|1056618_1057881_+	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_075239618.1|1058033_1058714_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_011407762.1|1058880_1060797_-	amylosucrase	NA	NA	NA	NA	NA
WP_075239619.1|1060831_1063276_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011407764.1|1063545_1064877_+	MFS transporter	NA	NA	NA	NA	NA
WP_011407765.1|1065117_1066149_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407766.1|1066389_1067130_-	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_011257945.1|1067241_1068570_-	CitMHS family transporter	NA	NA	NA	NA	NA
WP_011407767.1|1068797_1069991_-	porin	NA	NA	NA	NA	NA
WP_011407768.1|1070246_1070948_+	response regulator	NA	NA	NA	NA	NA
WP_075239620.1|1070940_1072326_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	23.7	1.1e-10
WP_011407770.1|1072325_1073375_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011257949.1|1073414_1074053_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011257951.1|1074253_1075108_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011407771.1|1075104_1075743_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011257953.1|1076051_1076954_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011257955.1|1076945_1077725_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011407772.1|1077721_1079071_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.3	1.5e-62
WP_011257957.1|1079386_1082032_-	response regulator	NA	B5LWN0	Feldmannia_species_virus	28.1	4.4e-13
WP_011407774.1|1082353_1083526_-	porin	NA	NA	NA	NA	NA
WP_011407775.1|1083816_1085190_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011257960.1|1085387_1087697_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_164993824.1|1089702_1091178_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.1	2.2e-102
WP_075239098.1|1092650_1093169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143700863.1|1093183_1094251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993825.1|1094537_1095335_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_143706205.1|1095249_1095999_-	radical SAM protein	NA	NA	NA	NA	NA
WP_011407778.1|1099720_1100344_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_011257965.1|1100367_1100607_+	rubredoxin	NA	NA	NA	NA	NA
WP_011257966.1|1100656_1101538_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011407780.1|1101687_1102137_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_011257968.1|1102287_1102935_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_011257969.1|1103026_1103497_-	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_011407783.1|1103493_1104084_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_011257971.1|1104692_1104992_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_011407784.1|1104988_1105210_-	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_011407785.1|1105445_1105988_+	YecA family protein	NA	NA	NA	NA	NA
WP_011257974.1|1105998_1107339_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_162013040.1|1107856_1108015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703767.1|1108226_1109552_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_011257976.1|1109750_1110098_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_011407789.1|1110094_1112503_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011257978.1|1112681_1113839_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_011257979.1|1113854_1114454_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	C6K8R3	Cassava_brown_streak_virus	34.8	3.8e-13
WP_011257980.1|1114450_1114846_-	glyoxalase	NA	NA	NA	NA	NA
WP_075239531.1|1114842_1115568_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_011257982.1|1115677_1116538_+	YicC family protein	NA	NA	NA	NA	NA
WP_011257983.1|1116654_1117266_+	guanylate kinase	NA	A0A218KC48	Bacillus_phage	30.9	3.1e-10
WP_109181978.1|1117446_1118244_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	1135625	1189411	4994377	transposase	Arthrobacter_phage(16.67%)	40	NA	NA
WP_117231593.1|1135625_1136861_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_164993826.1|1136931_1137966_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258000.1|1138588_1139608_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_075239550.1|1139628_1140591_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_011258002.1|1140593_1141055_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_075239549.1|1141051_1142059_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_075239548.1|1142055_1143873_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_011407804.1|1143869_1145627_+	membrane protein	NA	NA	NA	NA	NA
WP_033013273.1|1145922_1146240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182384.1|1146488_1147718_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_075239547.1|1147937_1149938_+	transketolase	NA	NA	NA	NA	NA
WP_011258009.1|1150756_1151473_-	M23 family metallopeptidase	NA	A0A0M5M794	Arthrobacter_phage	34.2	2.7e-05
WP_011407808.1|1151475_1152468_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_042464574.1|1152787_1155502_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258012.1|1155631_1156807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703582.1|1159075_1159723_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_011407813.1|1159719_1161219_+	AMP-binding protein	NA	NA	NA	NA	NA
WP_011407815.1|1161905_1162745_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011407818.1|1163411_1164110_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.0	9.8e-29
WP_041182938.1|1164127_1165489_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_011407820.1|1165588_1165954_+	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407822.1|1167256_1167841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407823.1|1168183_1168798_-	molybdenum ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.0	2.1e-19
WP_011258026.1|1168797_1169490_-	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_011407824.1|1169500_1170277_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011258028.1|1170347_1171178_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_012445839.1|1171191_1171965_-	S1/P1 nuclease	NA	NA	NA	NA	NA
WP_094187763.1|1173101_1173899_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_153296750.1|1175891_1176032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407830.1|1176688_1177690_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_094187715.1|1178077_1178840_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109182067.1|1178929_1179895_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027704076.1|1180004_1181324_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011407833.1|1181786_1182464_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	27.4	7.4e-05
WP_027704066.1|1182543_1182933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407835.1|1183145_1184033_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	32.7	1.2e-31
WP_164993827.1|1184474_1185459_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.8	4.8e-98
WP_011407838.1|1185634_1187722_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_011407839.1|1187873_1188533_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_164993828.1|1188613_1189411_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	1261481	1325159	4994377	tRNA,transposase	Prochlorococcus_phage(22.22%)	59	NA	NA
WP_069964958.1|1261481_1262717_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011258093.1|1263103_1264504_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027703631.1|1264503_1265520_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011258095.1|1265580_1266378_-	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_011258096.1|1266528_1267890_-	magnesium transporter	NA	NA	NA	NA	NA
WP_012445788.1|1268177_1269908_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	24.1	1.3e-10
WP_005913389.1|1269966_1270236_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_011258098.1|1270228_1270621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154741215.1|1270686_1270851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258099.1|1271147_1272020_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	30.5	4.5e-07
WP_011258100.1|1272016_1272967_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_011407887.1|1272963_1273422_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_011258102.1|1273443_1273761_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_011407888.1|1273848_1275288_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_011258104.1|1275328_1276048_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.3	5.6e-27
WP_012445784.1|1276047_1276587_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_011258106.1|1276573_1277149_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_011407889.1|1277145_1277694_-	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_011258108.1|1277742_1278744_-	KpsF/GutQ family sugar-phosphate isomerase	NA	E3T535	Cafeteria_roenbergensis_virus	24.9	8.3e-13
WP_011258109.1|1278798_1279026_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_075239094.1|1279264_1280539_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_075239093.1|1280535_1280859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258112.1|1281947_1282631_-	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_011258113.1|1282634_1283462_-	DUF3108 domain-containing protein	NA	NA	NA	NA	NA
WP_075239091.1|1283527_1284196_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	36.4	2.7e-20
WP_011258115.1|1284182_1284800_-	DUF2238 domain-containing protein	NA	NA	NA	NA	NA
WP_011258116.1|1284822_1285284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258117.1|1285297_1286356_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	3.2e-71
WP_011407894.1|1286453_1287566_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_011258119.1|1287562_1288729_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_011258120.1|1288725_1289427_+	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_011258121.1|1289593_1290304_-	nucleotidyltransferase family protein	NA	A0A1D7XFC1	Escherichia_phage	33.9	1.5e-08
WP_011407895.1|1290300_1291320_-	phosphotransferase	NA	NA	NA	NA	NA
WP_011407896.1|1291377_1291650_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_109181890.1|1291874_1292931_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011407897.1|1293251_1294745_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_005919170.1|1294944_1295277_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_094187715.1|1295528_1296291_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080496958.1|1297795_1298713_+	HutD family protein	NA	NA	NA	NA	NA
WP_041182780.1|1299403_1300369_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258133.1|1300866_1302450_-	alpha-L-arabinofuranosidase	NA	NA	NA	NA	NA
WP_027704032.1|1302690_1303740_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_011407903.1|1304027_1304819_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_164993833.1|1304971_1305937_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407905.1|1306238_1307615_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_011407907.1|1309187_1310258_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_075239022.1|1310248_1311046_+	aminotransferase class IV family protein	NA	NA	NA	NA	NA
WP_011258141.1|1311155_1311413_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_011407909.1|1311456_1311969_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_011407910.1|1312034_1312814_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_005989873.1|1312937_1313345_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_011407911.1|1313970_1315461_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_011407912.1|1315801_1316209_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_075239653.1|1319105_1319381_-	glutathione transferase	NA	NA	NA	NA	NA
WP_011258151.1|1319410_1319716_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_075239654.1|1320161_1322747_+	ATP-dependent chaperone ClpB	NA	A0A1C3S747	Escherichia_phage	35.2	2.5e-125
WP_041182015.1|1322871_1323783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181892.1|1323813_1323963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993918.1|1324057_1325159_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.4	5.5e-42
>prophage 12
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	1346480	1405687	4994377	transposase	Acinetobacter_phage(27.27%)	45	NA	NA
WP_164993919.1|1346480_1347581_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	5.5e-42
WP_012445737.1|1347745_1349455_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_011407587.1|1349985_1351020_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_164993834.1|1351021_1351291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258177.1|1351669_1354069_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	33.3	4.9e-11
WP_011258178.1|1354401_1356789_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.9	9.2e-10
WP_075239026.1|1357062_1357518_-	VOC family protein	NA	NA	NA	NA	NA
WP_075239025.1|1357981_1360369_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.7	7.1e-10
WP_041182018.1|1360548_1362465_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	30.7	8.6e-67
WP_027703789.1|1362737_1363163_+	YcxB family protein	NA	NA	NA	NA	NA
WP_011258183.1|1363186_1364032_-	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	31.7	8.6e-11
WP_033013356.1|1365142_1365961_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_094187728.1|1366332_1367131_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257570.1|1368455_1369691_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069959773.1|1370243_1370525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239369.1|1370742_1371534_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_012445725.1|1371989_1372160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182747.1|1372295_1373726_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012445723.1|1373938_1375807_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	21.2	1.5e-15
WP_027703928.1|1375831_1378156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408397.1|1380945_1382130_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_075239694.1|1382221_1383574_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_011258198.1|1383639_1384575_-	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_011407946.1|1384641_1385241_-	LysE family translocator	NA	NA	NA	NA	NA
WP_011407947.1|1385275_1386136_-	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_011407948.1|1386153_1387194_-	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_011258200.1|1387220_1388543_-	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075239693.1|1388542_1389697_-	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_125168743.1|1389974_1390241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258205.1|1392795_1393125_-	non-heme iron oxygenase ferredoxin subunit	NA	NA	NA	NA	NA
WP_011258206.1|1393121_1393661_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075239469.1|1393876_1395121_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	41.9	2.3e-92
WP_011258208.1|1395117_1396380_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_011258209.1|1396379_1397144_-	Fe-S cluster assembly ATPase SufC	NA	W5SAS9	Pithovirus	29.1	9.2e-12
WP_011258210.1|1397401_1398859_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_011407954.1|1398874_1399333_-	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_003487757.1|1399504_1399972_+	SET domain-containing protein-lysine N-methyltransferase	NA	NA	NA	NA	NA
WP_011407955.1|1400076_1400295_+	peptidase	NA	NA	NA	NA	NA
WP_099051294.1|1400401_1400782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258212.1|1400899_1401496_-	DUF1439 domain-containing protein	NA	NA	NA	NA	NA
WP_011258213.1|1401551_1402094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407958.1|1402151_1402493_-	DUF3861 domain-containing protein	NA	NA	NA	NA	NA
WP_027703895.1|1402550_1403192_-	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_011258216.1|1403297_1403723_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_164993835.1|1404367_1405687_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	1416000	1573829	4994377	tRNA,transposase	Bacillus_phage(13.04%)	111	NA	NA
WP_011409560.1|1416000_1416963_-|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011258228.1|1417818_1418253_+	OsmC family protein	NA	NA	NA	NA	NA
WP_027703692.1|1418405_1419005_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_041182025.1|1419290_1420172_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_011258233.1|1421269_1423879_+	bifunctional aspartate kinase/diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_011258234.1|1423862_1424321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258235.1|1424317_1425673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258236.1|1425653_1427060_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_011258237.1|1427376_1428171_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011258238.1|1428355_1429354_-	octaprenyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_011258239.1|1429629_1430166_+	single-stranded DNA-binding protein	NA	A0A1B1W281	Salmonella_phage	58.5	3.6e-31
WP_075239234.1|1430448_1431933_-	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.9	1.1e-13
WP_094187728.1|1434082_1434880_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260092.1|1435677_1436256_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_075239665.1|1436671_1437322_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011409289.1|1437417_1437933_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_117231640.1|1440321_1441287_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_027703294.1|1441638_1442343_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_005926176.1|1442880_1443105_-	putative selenoprotein	NA	NA	NA	NA	NA
WP_011407979.1|1443104_1445177_-	carbon starvation protein A	NA	NA	NA	NA	NA
WP_012445686.1|1445408_1446266_+	pirin family protein	NA	NA	NA	NA	NA
WP_164993920.1|1447301_1449713_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	29.0	1.3e-40
WP_027704078.1|1449767_1450628_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_075239675.1|1450696_1451275_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_011409552.1|1451498_1452461_+|transposase	IS1595-like element ISXo2 family transposase	transposase	NA	NA	NA	NA
WP_011258251.1|1452818_1453052_+	DUF3304 domain-containing protein	NA	NA	NA	NA	NA
WP_075239011.1|1453048_1455457_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_011407999.1|1455788_1456250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444353.1|1456496_1457387_-	pirin family protein	NA	NA	NA	NA	NA
WP_131824943.1|1457564_1458077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444354.1|1458148_1458862_-	deoxyribonuclease V	NA	NA	NA	NA	NA
WP_012444355.1|1458965_1459715_+	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_103057495.1|1460063_1460318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239012.1|1460661_1462719_+	M13 family peptidase	NA	E3T4I7	Cafeteria_roenbergensis_virus	31.4	3.6e-79
WP_044757485.1|1464666_1465788_-	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_012444362.1|1465802_1466609_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_041182609.1|1466613_1467897_-	EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011258265.1|1467923_1468439_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_027703636.1|1468449_1470612_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	53.6	2.9e-10
WP_011258267.1|1470680_1472702_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_011258268.1|1472720_1473050_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_128415371.1|1473089_1473308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444366.1|1473539_1477004_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_014502625.1|1477408_1477951_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408011.1|1478362_1479271_-	23S rRNA (adenine(2030)-N(6))-methyltransferase RlmJ	NA	NA	NA	NA	NA
WP_042464653.1|1480558_1481278_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_164993836.1|1481433_1482453_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075240355.1|1482488_1483301_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_075251661.1|1484032_1484419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993837.1|1485742_1486774_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	42.3	1.5e-70
WP_011258280.1|1486861_1487674_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408018.1|1488190_1488574_+	membrane protein	NA	NA	NA	NA	NA
WP_011408019.1|1488696_1489860_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	2.6e-98
WP_011408020.1|1489890_1490703_-	C1 family peptidase	NA	NA	NA	NA	NA
WP_011408021.1|1490933_1491521_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_012444381.1|1491638_1492523_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_075239640.1|1493708_1495112_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011408024.1|1495125_1495632_+	Fur family transcriptional regulator	NA	NA	NA	NA	NA
WP_011408025.1|1496037_1496496_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011258291.1|1497273_1497477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258293.1|1499038_1499524_-	DUF456 domain-containing protein	NA	NA	NA	NA	NA
WP_011258294.1|1499751_1499967_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	59.7	6.5e-16
WP_011408030.1|1500217_1500697_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027704135.1|1500828_1501257_-	cytochrome c	NA	NA	NA	NA	NA
WP_011258297.1|1501329_1502160_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_011258298.1|1502221_1502989_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_012444391.1|1502988_1503204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408033.1|1503349_1504141_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_041182398.1|1504298_1505462_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_027704133.1|1507695_1508334_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011258305.1|1508509_1510450_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1B1ISV2	uncultured_Mediterranean_phage	30.5	4.4e-26
WP_011258306.1|1510666_1511221_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.3	1.1e-19
WP_011408037.1|1511442_1512873_+	replicative DNA helicase	NA	O80281	Escherichia_phage	53.4	8.5e-120
WP_075239383.1|1512975_1514394_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0S949	Catovirus	31.4	3.3e-47
WP_012444400.1|1514810_1515536_+	OmpA family protein	NA	G3M9Z0	Bacillus_virus	33.9	1.4e-09
WP_011258310.1|1515634_1516045_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_041182615.1|1516096_1517053_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.7	2.6e-40
WP_075239293.1|1517296_1519678_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258314.1|1522306_1522717_+	MerC domain-containing protein	NA	NA	NA	NA	NA
WP_011408042.1|1523016_1523199_+	30S ribosomal protein THX	NA	NA	NA	NA	NA
WP_044756986.1|1523331_1524372_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011258317.1|1524444_1525890_-	chloride channel protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.5	4.9e-14
WP_011258319.1|1527579_1528125_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A1S5V092	Saudi_moumouvirus	51.9	4.1e-14
WP_075239291.1|1528121_1529585_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_011258323.1|1531047_1531302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027704130.1|1531704_1532238_+	DUF4019 domain-containing protein	NA	NA	NA	NA	NA
WP_075239290.1|1532263_1532665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408050.1|1532633_1533014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258326.1|1533010_1533253_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011258329.1|1534614_1536519_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	35.7	2.5e-58
WP_012444418.1|1536782_1539179_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	30.2	3.8e-11
WP_011258331.1|1539328_1540051_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_069959788.1|1540238_1541186_-	DMT family transporter	NA	NA	NA	NA	NA
WP_011258334.1|1543001_1543502_+	putative 4-hydroxy-4-methyl-2-oxoglutarate aldolase	NA	NA	NA	NA	NA
WP_075239289.1|1543443_1545120_+	serine hydrolase	NA	NA	NA	NA	NA
WP_011258336.1|1545266_1546532_+	potassium transporter	NA	NA	NA	NA	NA
WP_075239288.1|1546590_1547784_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	23.9	5.2e-22
WP_012444424.1|1547780_1548470_-	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.3	3.6e-07
WP_075239287.1|1548575_1550045_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_011258340.1|1550064_1550901_+	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_011258341.1|1550926_1552030_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_044756980.1|1552026_1555083_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011258343.1|1555148_1555739_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_075239286.1|1555870_1557703_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	6.2e-30
WP_094187715.1|1557778_1558542_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407713.1|1559644_1560880_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|1562915_1563884_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_125168746.1|1568168_1568660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|1568711_1569680_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187728.1|1570633_1571432_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408066.1|1572509_1573829_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	1624439	1713147	4994377	tRNA,transposase	Hokovirus(12.5%)	51	NA	NA
WP_011258399.1|1624439_1627271_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SGW1	Hokovirus	22.2	4.1e-41
WP_011408096.1|1627585_1628086_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_011258401.1|1628175_1629126_+	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_011258402.1|1629639_1630575_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_011408097.1|1630574_1632575_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011408098.1|1632577_1633204_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010365831.1|1633203_1633539_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_162013044.1|1633705_1635586_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_012444470.1|1635810_1638057_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	31.3	4.4e-54
WP_012444471.1|1638080_1639700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993838.1|1639843_1644538_+	type IV secretion protein Rhs	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	48.6	1.5e-24
WP_075239571.1|1644541_1645117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993921.1|1645370_1646555_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.7e-41
WP_157724567.1|1646696_1646969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993922.1|1648908_1650711_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_011408105.1|1653580_1656136_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.8	1.3e-30
WP_011258418.1|1659105_1660497_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_075239032.1|1661887_1663444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408111.1|1666027_1667266_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408112.1|1667706_1668000_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_011258426.1|1668497_1669274_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_011408113.1|1669431_1671198_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011258428.1|1671709_1672237_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027703718.1|1672336_1673014_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011258430.1|1673103_1673832_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_011258431.1|1673946_1674471_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_011258432.1|1674628_1675213_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011258433.1|1675412_1677320_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	34.1	3.4e-79
WP_010363979.1|1677448_1678486_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	2.7e-06
WP_011258434.1|1678538_1678997_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_012445351.1|1679008_1679788_+	protein TolQ	NA	NA	NA	NA	NA
WP_011408114.1|1679944_1680394_+	protein TolR	NA	NA	NA	NA	NA
WP_044756956.1|1680383_1681424_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_041182054.1|1681683_1683003_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_011408116.1|1683060_1683579_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_011258440.1|1683585_1684404_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_011408117.1|1684446_1685130_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	39.5	1.5e-37
WP_011408120.1|1686363_1687074_-	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_011408121.1|1687308_1687515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103057679.1|1689308_1689887_-	amino acid transporter	NA	NA	NA	NA	NA
WP_164993839.1|1692422_1693658_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|1694360_1695317_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_117231572.1|1695596_1696973_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	8.1e-59
WP_008578058.1|1697351_1698026_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.7	6.4e-25
WP_027703393.1|1698656_1699061_-	response regulator	NA	NA	NA	NA	NA
WP_011408165.1|1699139_1699637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258487.1|1699775_1701572_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.5	1.5e-81
WP_011408166.1|1702117_1702663_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_075239655.1|1702764_1706886_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	1.9e-47
WP_011407237.1|1708724_1709681_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011407587.1|1712112_1713147_-|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
>prophage 15
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	1864479	1907918	4994377	protease,transposase	Tupanvirus(18.18%)	37	NA	NA
WP_094187715.1|1864479_1865243_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445257.1|1865372_1867454_-	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_012445256.1|1867690_1868311_+	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_012445255.1|1868307_1869198_+	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_011408249.1|1869307_1870894_+|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	30.0	6.5e-28
WP_012445254.1|1871074_1872865_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	40.5	3.5e-22
WP_011258600.1|1872971_1873772_+	signal peptidase I	NA	NA	NA	NA	NA
WP_011258601.1|1873802_1874180_+	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_075239623.1|1874169_1874850_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	29.4	1.7e-17
WP_011258603.1|1874846_1875746_+	GTPase Era	NA	NA	NA	NA	NA
WP_011258604.1|1875969_1876692_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_075239622.1|1876840_1877563_-	hybrid sensor histidine kinase/response regulator	NA	NA	NA	NA	NA
WP_027703339.1|1877721_1879056_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	26.8	1.7e-29
WP_011258607.1|1879230_1879728_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_164993841.1|1879918_1881238_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258803.1|1881450_1882419_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.5e-99
WP_041182416.1|1882581_1883265_+	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_011408254.1|1883281_1884316_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011258611.1|1884496_1886074_+	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	25.6	2.2e-44
WP_075239481.1|1886190_1887195_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_075239479.1|1887194_1887749_+	hypoxanthine-guanine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_027703687.1|1887834_1888587_+	S-methyl-5'-thioinosine phosphorylase	NA	NA	NA	NA	NA
WP_003488188.1|1888673_1888880_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	70.1	9.3e-20
WP_012445240.1|1890402_1891047_-	ligase-associated DNA damage response endonuclease PdeM	NA	NA	NA	NA	NA
WP_012445239.1|1891036_1893538_-	ligase-associated DNA damage response DEXH box helicase	NA	NA	NA	NA	NA
WP_069970110.1|1893534_1895139_-	ATP-dependent DNA ligase	NA	A0A068CDF3	Rhizobium_phage	36.6	6.4e-15
WP_011258619.1|1895135_1895369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445237.1|1895365_1896388_-	ligase-associated DNA damage response exonuclease	NA	NA	NA	NA	NA
WP_011258621.1|1896724_1897090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239480.1|1897086_1897677_-	cell shape determination protein CcmA	NA	NA	NA	NA	NA
WP_011258623.1|1897774_1899484_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.5	2.1e-16
WP_011258624.1|1899592_1899919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408269.1|1900148_1900493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258625.1|1900615_1901791_-	thiolase family protein	NA	NA	NA	NA	NA
WP_011258626.1|1901946_1904775_+|protease	autotransporter serine protease	protease	A0A1V0SBG2	Catovirus	25.2	3.9e-07
WP_011258627.1|1904835_1905936_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_011407237.1|1906961_1907918_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
>prophage 16
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	1912825	1969971	4994377	tRNA,transposase	Acidithiobacillus_phage(33.33%)	46	NA	NA
WP_164993842.1|1912825_1914145_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258635.1|1914537_1914723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239027.1|1914912_1916289_-	Hsp70 family protein	NA	NA	NA	NA	NA
WP_069964916.1|1916428_1916902_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_117231593.1|1917077_1918313_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_027704229.1|1918560_1919610_-	cation transporter	NA	NA	NA	NA	NA
WP_011408280.1|1919724_1920060_+	alkylphosphonate utilization protein	NA	NA	NA	NA	NA
WP_075239156.1|1920348_1920639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408282.1|1921529_1922648_-	alkene reductase	NA	NA	NA	NA	NA
WP_011258642.1|1922868_1924080_+	MFS transporter	NA	NA	NA	NA	NA
WP_011258643.1|1924642_1925098_+	PA2169 family four-helix-bundle protein	NA	NA	NA	NA	NA
WP_094187728.1|1926176_1926974_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069960014.1|1927772_1928741_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_011408284.1|1928860_1929463_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_011258645.1|1929498_1930107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258646.1|1930166_1930361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258647.1|1930430_1931801_+	virulence factor family protein	NA	NA	NA	NA	NA
WP_075239076.1|1932424_1934989_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_011408290.1|1935969_1936317_+	RidA family protein	NA	NA	NA	NA	NA
WP_012445221.1|1936479_1937550_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011258653.1|1937567_1938350_-	DUF1295 domain-containing protein	NA	NA	NA	NA	NA
WP_011258654.1|1938346_1938892_-	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_011258655.1|1938888_1940184_-	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	32.4	3.9e-39
WP_011408295.1|1940180_1941065_-	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_075239077.1|1941064_1942315_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075239080.1|1942311_1943310_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_075239078.1|1943536_1944370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239079.1|1944366_1944930_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_012445216.1|1944988_1945357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258660.1|1945442_1946225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012445213.1|1946843_1947272_-	Rnf electron transport complex subunit RnfB	NA	NA	NA	NA	NA
WP_041182084.1|1947273_1947870_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_011258663.1|1948112_1950197_-|tRNA	methionine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_012445211.1|1950421_1950871_-	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_164993843.1|1951634_1952687_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_012445208.1|1952964_1954362_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_011258667.1|1954358_1955336_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_011258668.1|1955517_1957455_-	DUF885 family protein	NA	NA	NA	NA	NA
WP_011258669.1|1957875_1958652_-	queuosine precursor transporter	NA	R4TNY5	Halovirus	27.2	1.9e-09
WP_011258670.1|1958656_1959331_-	DUF502 domain-containing protein	NA	A0A2I7S9X1	Vibrio_phage	24.5	1.9e-08
WP_133265441.1|1960962_1962339_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.8	6.6e-77
WP_011408311.1|1962378_1962774_-	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_164993844.1|1962816_1964292_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	67.5	2.2e-102
WP_128415338.1|1966112_1966565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080256646.1|1966578_1966749_-	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
WP_109182027.1|1969005_1969971_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	1994041	2036817	4994377	protease,coat,transposase	Flavobacterium_phage(20.0%)	35	NA	NA
WP_011408324.1|1994041_1995388_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_011258694.1|1995414_1996605_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_011258695.1|1996607_1997435_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_027703358.1|1997431_1998193_-	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	32.6	3.6e-16
WP_011258697.1|1998210_1998768_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_011258698.1|1998948_1999671_-	UMP kinase	NA	NA	NA	NA	NA
WP_075239165.1|1999727_2000105_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011258700.1|2000232_2001111_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_011258701.1|2001280_2002084_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_011408326.1|2002459_2003185_-	molecular chaperone	NA	NA	NA	NA	NA
WP_041182086.1|2003187_2003520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239166.1|2003566_2004601_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_075239167.1|2004597_2006949_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_075239168.1|2006965_2007736_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011408331.1|2007744_2008269_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_011258707.1|2008588_2009365_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_011408332.1|2009361_2011971_+	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_075239169.1|2011987_2013184_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_011408334.1|2013646_2014003_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_011408335.1|2013999_2014500_+	GNAT family N-acetyltransferase	NA	A0A1X9I687	Streptococcus_phage	41.7	2.3e-27
WP_027703364.1|2014504_2015635_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_011258712.1|2015929_2017624_+	asparagine synthase B	NA	E5ERH5	Ostreococcus_lucimarinus_virus	38.6	2.5e-86
WP_027703366.1|2017692_2018745_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_011258714.1|2019175_2021302_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_094187715.1|2021864_2022628_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075239037.1|2022680_2025104_-	penicillin acylase family protein	NA	NA	NA	NA	NA
WP_143703055.1|2025199_2025736_+	bacterioferritin	NA	NA	NA	NA	NA
WP_011408339.1|2026191_2028435_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	5.0e-82
WP_075239035.1|2028495_2029347_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_012445167.1|2029468_2029909_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075239036.1|2029905_2031423_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_027703877.1|2031433_2032627_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_011258722.1|2032633_2034214_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_011407237.1|2034793_2035750_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_117231608.1|2036053_2036817_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	2157466	2294297	4994377	protease,tRNA,transposase	Ralstonia_phage(14.29%)	106	NA	NA
WP_109181928.1|2157466_2158432_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408397.1|2159012_2160197_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011257570.1|2160465_2161701_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011257310.1|2162029_2163265_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_027703931.1|2163596_2163797_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_011408759.1|2164281_2164560_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_027703932.1|2164547_2164838_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_004541336.1|2165098_2165296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015463309.1|2165439_2165619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259345.1|2166482_2166884_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_075239568.1|2167976_2169068_-	ribonuclease D	NA	NA	NA	NA	NA
WP_075239567.1|2169339_2171175_+	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	33.5	2.5e-23
WP_113001983.1|2171495_2172242_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011259340.1|2172459_2173722_+	virulence factor	NA	NA	NA	NA	NA
WP_075239003.1|2174017_2175355_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	36.2	1.3e-37
WP_075239002.1|2175500_2176568_-|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_011259337.1|2176592_2178080_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_075239001.1|2178076_2178577_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_011408751.1|2178629_2180363_+	N-acetylmuramoyl-L-alanine amidase	NA	A6XML1	Bacillus_virus	28.4	4.1e-15
WP_075239000.1|2180500_2182378_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	35.2	1.2e-84
WP_075238999.1|2182377_2183319_+	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_075238998.1|2183352_2184324_+	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_027703272.1|2184497_2185073_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_011408747.1|2185232_2185973_-	beta-ketoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_011259329.1|2186060_2186960_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_012444706.1|2187057_2187936_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_012444707.1|2188035_2190105_-	GGDEF and EAL domain-containing response regulator	NA	NA	NA	NA	NA
WP_011259326.1|2190328_2191510_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011259325.1|2191506_2192055_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_011408745.1|2192125_2192611_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_011408744.1|2192880_2193090_+	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	62.3	2.8e-16
WP_012444709.1|2193260_2193959_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_041182161.1|2194159_2195035_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_012444711.1|2195318_2196875_+	YdiU family protein	NA	NA	NA	NA	NA
WP_012444712.1|2196972_2197533_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.2	2.7e-29
WP_011259318.1|2197635_2199012_-	ATP-dependent RNA helicase DbpA	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	31.4	1.6e-54
WP_011259317.1|2199101_2200997_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	26.8	1.4e-48
WP_011259316.1|2201445_2201871_-	barstar family protein	NA	NA	NA	NA	NA
WP_011259315.1|2201867_2202308_-	ribonuclease	NA	NA	NA	NA	NA
WP_011259314.1|2202562_2203174_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	69.8	1.1e-79
WP_011408740.1|2203426_2204260_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011408739.1|2204378_2205143_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011259311.1|2205194_2206124_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011259310.1|2206120_2208238_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_164993846.1|2208456_2209530_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_002802373.1|2209585_2210152_+	elongation factor P	NA	NA	NA	NA	NA
WP_041182450.1|2210343_2211147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703270.1|2211166_2212504_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_011259306.1|2212534_2213254_+	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_075239639.1|2213327_2214032_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_011259304.1|2214060_2214750_+	phytoene synthase	NA	NA	NA	NA	NA
WP_011259303.1|2214966_2216637_-	glycoside hydrolase family 28 protein	NA	NA	NA	NA	NA
WP_012444725.1|2218221_2219403_-	putative acyl-CoA thioester hydrolase	NA	NA	NA	NA	NA
WP_164993847.1|2219762_2221082_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2221281_2222250_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_164993848.1|2222386_2223706_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_012444728.1|2223929_2224418_+	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_011259294.1|2224789_2225053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|2225078_2225842_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408729.1|2226740_2227580_-	M23 family metallopeptidase	NA	A0A075BS18	Microcystis_phage	41.2	2.4e-13
WP_011259290.1|2227579_2228929_-	dihydroorotase	NA	NA	NA	NA	NA
WP_033013281.1|2228925_2229213_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075239108.1|2229297_2230326_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_011259288.1|2230468_2231530_+	S41 family peptidase	NA	NA	NA	NA	NA
WP_011259287.1|2231597_2232848_-	MFS transporter	NA	NA	NA	NA	NA
WP_011408724.1|2232844_2233282_-	SufE family protein	NA	NA	NA	NA	NA
WP_012444736.1|2233779_2235204_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	1.1e-42
WP_027703614.1|2235380_2235875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259283.1|2236187_2237213_+	N-acetylornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_011408723.1|2237284_2238526_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_075239107.1|2238767_2239220_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_011408721.1|2239225_2240326_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_011259279.1|2240365_2241709_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_041182650.1|2242321_2243272_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_011408717.1|2243395_2244691_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_011408716.1|2244690_2245056_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011259275.1|2245055_2245316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408715.1|2245329_2246484_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	37.8	1.2e-47
WP_011408714.1|2246655_2247900_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.1	2.5e-91
WP_011259272.1|2248267_2250181_+	CocE/NonD family hydrolase	NA	NA	NA	NA	NA
WP_012444741.1|2250161_2251427_-	MFS transporter	NA	NA	NA	NA	NA
WP_011259269.1|2251647_2251758_-	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_011259267.1|2252136_2252400_-	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_069959883.1|2252448_2253549_-	cytochrome D ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_075239109.1|2253700_2255437_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	26.2	1.8e-15
WP_075239106.1|2255433_2257119_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	25.2	3.6e-16
WP_011408707.1|2257287_2258586_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_115801893.1|2258592_2259558_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011408705.1|2260350_2260527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153296779.1|2261261_2261660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259261.1|2262080_2262542_-	cytochrome c	NA	NA	NA	NA	NA
WP_011259260.1|2262550_2262943_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_011408700.1|2267799_2270271_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.9	4.4e-47
WP_011408699.1|2270310_2270868_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_125168757.1|2271076_2271556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155296491.1|2271662_2272982_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407175.1|2273181_2274150_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	59.7	5.6e-99
WP_075239581.1|2274201_2274486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993849.1|2274577_2279548_+	glutamate synthase	NA	NA	NA	NA	NA
WP_164993923.1|2280822_2284860_+	type IV secretion protein Rhs	NA	S5W9C6	Leptospira_phage	36.8	6.8e-13
WP_012445088.1|2285351_2285537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109181928.1|2285584_2286550_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_041182672.1|2286543_2286870_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_164993850.1|2291229_2291766_+	DUF3828 domain-containing protein	NA	NA	NA	NA	NA
WP_011258529.1|2291860_2292829_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_164993851.1|2292908_2294297_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	2374569	2475928	4994377	protease,tRNA,transposase	uncultured_Mediterranean_phage(27.27%)	72	NA	NA
WP_011259189.1|2374569_2375706_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_011408665.1|2375702_2376161_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005914463.1|2376411_2376732_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	1.0e-12
WP_011259186.1|2376875_2379158_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	44.6	8.7e-175
WP_002813418.1|2379438_2379657_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_042465566.1|2379737_2380490_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_011408662.1|2381917_2383039_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259181.1|2383096_2384065_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.5	5.9e-64
WP_011259180.1|2384348_2386709_+	DNA translocase FtsK	NA	G1D482	Mycobacterium_virus	45.8	2.5e-84
WP_011259179.1|2386871_2388800_+	DUF3857 and transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_027703232.1|2388864_2389536_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_011259177.1|2389648_2393815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259176.1|2394051_2395428_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.3	6.8e-74
WP_011259175.1|2395459_2395786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408660.1|2395782_2396190_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	49.1	5.7e-21
WP_069964891.1|2396221_2396572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239209.1|2396568_2397900_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	35.2	1.5e-41
WP_011259172.1|2398220_2399426_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_075239210.1|2399583_2401956_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259170.1|2401980_2402613_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002812972.1|2402831_2403257_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	1.1e-19
WP_075239211.1|2403275_2404481_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_011408658.1|2404491_2405280_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_075239212.1|2405276_2406137_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075239213.1|2406207_2406846_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_075239214.1|2406845_2408063_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_011259164.1|2408073_2409471_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_011259163.1|2409785_2411006_+	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_162013043.1|2415493_2415700_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_109181958.1|2415735_2417211_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.8	1.2e-76
WP_109181957.1|2417188_2418154_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_075239722.1|2418430_2419588_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_044756431.1|2420773_2422009_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_164993852.1|2423437_2424467_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011408651.1|2424555_2426460_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.8	1.0e-112
WP_075240370.1|2426700_2427321_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_011259147.1|2427317_2427824_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	4.8e-25
WP_027703974.1|2427870_2428368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012444765.1|2428599_2428884_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.4e-18
WP_075240371.1|2428880_2430674_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_117231538.1|2430680_2431712_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|2434284_2435253_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_164993853.1|2435452_2436745_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407913.1|2436858_2438073_+|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_075239522.1|2438374_2439007_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_164993792.1|2439663_2440149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2440159_2441128_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011259140.1|2443050_2444172_+	phytase	NA	NA	NA	NA	NA
WP_164993924.1|2444830_2446207_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	4.6e-78
WP_011259129.1|2447497_2448205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408638.1|2448549_2450046_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011259127.1|2450169_2450601_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_027703908.1|2450773_2451844_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_011259125.1|2451913_2453059_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.2	2.2e-86
WP_011259124.1|2453190_2453544_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_011259123.1|2453740_2455585_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_011259122.1|2455679_2456648_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	1.4e-28
WP_027703909.1|2456728_2457037_-	recombinase	NA	NA	NA	NA	NA
WP_164993854.1|2459709_2461098_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259117.1|2461546_2462182_-	ribonuclease T	NA	NA	NA	NA	NA
WP_075239435.1|2462465_2462861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408630.1|2462993_2463704_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_011259114.1|2463832_2464663_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	32.6	5.5e-18
WP_011259113.1|2464685_2465555_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_012444784.1|2465554_2466529_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_012444785.1|2466641_2467733_-	phosphate ABC transporter substrate-binding protein PstS	NA	E3SKK5	Synechococcus_phage	39.7	1.1e-47
WP_012444786.1|2467918_2468938_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4SNR3	Cyanophage	38.7	2.1e-48
WP_012444787.1|2469126_2470377_-	porin	NA	NA	NA	NA	NA
WP_041182144.1|2470716_2471037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_151421437.1|2471600_2472836_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_069960014.1|2473440_2474409_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_143698437.1|2474608_2475928_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	2545455	2629534	4994377	protease,transposase	Bacillus_phage(25.0%)	51	NA	NA
WP_011259046.1|2545455_2546424_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_075239507.1|2546640_2554770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259043.1|2555046_2555658_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027703759.1|2555654_2556677_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_011408577.1|2556795_2558280_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_075239506.1|2558276_2561369_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011408575.1|2561361_2562477_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_164993925.1|2566535_2567912_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	47.3	7.8e-62
WP_011408569.1|2570464_2571643_+	N-acetylmuramoyl-L-alanine amidase	NA	M1IEI0	Bacillus_phage	39.6	1.9e-08
WP_011408568.1|2571680_2572601_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_011259034.1|2573216_2574584_+	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	37.9	9.9e-25
WP_011259033.1|2574587_2575073_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_011259032.1|2575108_2575924_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	34.1	2.1e-30
WP_011259031.1|2575920_2576763_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_011259030.1|2576941_2577322_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_069964869.1|2577318_2578833_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_011259028.1|2578991_2579336_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_011408564.1|2579339_2579963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408563.1|2580197_2582153_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_075239334.1|2582586_2585199_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_075239335.1|2585191_2585449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408561.1|2585458_2587021_+	sodium/solute symporter	NA	A0A240F3J2	Aeromonas_phage	39.5	2.7e-87
WP_027703349.1|2587265_2589122_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_041182436.1|2590448_2592638_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_027703346.1|2592766_2594545_-	M14 family metallopeptidase	NA	NA	NA	NA	NA
WP_143700773.1|2594895_2595750_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	31.7	3.4e-15
WP_012444859.1|2595746_2596355_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011259018.1|2596773_2596962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408556.1|2597145_2597460_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011259016.1|2597510_2598344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239090.1|2598410_2598911_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_044757420.1|2599002_2599581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259013.1|2599742_2600243_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011259011.1|2601767_2602481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703343.1|2602732_2602972_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_011259009.1|2605428_2605914_+	glutathione peroxidase	NA	A0A1S7DM81	Molluscum_contagiosum_virus	36.2	2.8e-14
WP_011408551.1|2606064_2606844_-	ferredoxin--NADP reductase	NA	NA	NA	NA	NA
WP_012444869.1|2607032_2608913_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	38.0	2.3e-24
WP_011259006.1|2609246_2610764_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_075239088.1|2610900_2611536_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_011408549.1|2611964_2613098_-	phospholipase A	NA	NA	NA	NA	NA
WP_011259000.1|2616569_2617544_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.6	2.0e-19
WP_027704049.1|2617662_2617896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2620454_2621423_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_117231544.1|2621814_2622846_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075239631.1|2623519_2626915_-	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	27.8	2.9e-25
WP_011258994.1|2627129_2627510_-	response regulator	NA	NA	NA	NA	NA
WP_012444899.1|2627777_2627954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239633.1|2628139_2628529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703995.1|2628525_2628729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187736.1|2628771_2629534_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	2647607	2696544	4994377	transposase	Xanthomonas_phage(50.0%)	33	NA	NA
WP_117231546.1|2647607_2648573_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011408527.1|2648826_2651235_+	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_011408526.1|2651263_2651926_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_011258975.1|2651929_2652394_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011258974.1|2652390_2654160_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	28.0	9.4e-52
WP_011258973.1|2654156_2655197_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_011258972.1|2655488_2656268_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_011258971.1|2656264_2656729_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_011258970.1|2656752_2658171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011258969.1|2658167_2660024_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_011258968.1|2660023_2660656_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_012444921.1|2661130_2661637_-	glyoxalase	NA	NA	NA	NA	NA
WP_041182131.1|2661803_2662703_-|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.1	2.8e-36
WP_011408760.1|2662753_2663938_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_041182130.1|2664246_2668347_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_117231547.1|2668324_2669290_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_164993855.1|2669434_2670400_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	3.3e-99
WP_143677904.1|2670511_2670943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113397211.1|2672088_2672640_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	40.0	7.8e-21
WP_012444927.1|2672636_2672813_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_164993856.1|2673031_2677048_-	avirulence protein	NA	NA	NA	NA	NA
WP_011408491.1|2677272_2677572_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_042464821.1|2677575_2677770_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	82.3	3.9e-20
WP_164993857.1|2678000_2678764_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408491.1|2682831_2683131_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_041182100.1|2683134_2683329_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_164993858.1|2683597_2687194_-	Avirulence protein AvrBs3	NA	NA	NA	NA	NA
WP_011408491.1|2687333_2687633_-	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	91.3	1.9e-45
WP_041182100.1|2687636_2687831_-	hypothetical protein	NA	A0A1W6DXV7	Xanthomonas_phage	80.6	2.5e-19
WP_164993859.1|2688099_2691897_-	avirulence protein	NA	NA	NA	NA	NA
WP_011258188.1|2693172_2694141_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_117231519.1|2694353_2695673_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|2695780_2696544_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	2877750	2890218	4994377	tRNA,transposase	Ralstonia_phage(25.0%)	9	NA	NA
WP_011258802.1|2877750_2878719_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407913.1|2878990_2880205_-|transposase	IS4-like element ISXo14 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	33.4	1.8e-54
WP_164993867.1|2880318_2881611_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_094187728.1|2882050_2882848_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258822.1|2882998_2884348_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.6	4.5e-94
WP_012445101.1|2884459_2885119_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027704061.1|2885479_2885947_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_164993926.1|2886133_2887235_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	39.2	1.2e-36
WP_109181932.1|2889252_2890218_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	2917603	2987866	4994377	transposase	Ralstonia_phage(37.5%)	44	NA	NA
WP_012444654.1|2917603_2918587_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	60.5	2.0e-96
WP_075239563.1|2919035_2924060_-	glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_027703873.1|2924337_2924997_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259394.1|2925011_2926316_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_075239562.1|2926328_2929499_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_116101037.1|2930474_2931431_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_094187736.1|2931555_2932318_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011408798.1|2932953_2933949_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_059317461.1|2934109_2936626_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	28.5	6.3e-09
WP_011259401.1|2936622_2937579_+	1-phosphofructokinase family hexose kinase	NA	NA	NA	NA	NA
WP_011259402.1|2937737_2939480_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_012444645.1|2939657_2940935_+	carbohydrate porin	NA	NA	NA	NA	NA
WP_011259046.1|2941601_2942570_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_143703067.1|2943919_2944573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117231526.1|2944595_2946938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239635.1|2946962_2947700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011258802.1|2948230_2949199_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_164993868.1|2949313_2951230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182173.1|2951254_2951992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993869.1|2952017_2954852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444637.1|2954848_2955778_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_164993870.1|2955786_2958549_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	4.3e-43
WP_164993871.1|2960114_2962520_-	avirulence protein	NA	NA	NA	NA	NA
WP_041182637.1|2962559_2962949_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_041182637.1|2967710_2968100_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_011408814.1|2969146_2969461_+	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_129593080.1|2969688_2971008_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_027703777.1|2971074_2971467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239610.1|2971849_2974951_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_041182176.1|2975940_2976393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182177.1|2976647_2978453_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_128415369.1|2978454_2978802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408824.1|2978877_2979585_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	51.2	1.1e-51
WP_011259416.1|2979736_2980129_+	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_075239609.1|2980151_2980667_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_027703781.1|2980663_2981017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259417.1|2981105_2981846_+	flagellar motor protein	NA	NA	NA	NA	NA
WP_011259418.1|2981852_2982713_+	flagellar motor protein MotD	NA	NA	NA	NA	NA
WP_075239608.1|2982828_2983611_+	ParA family protein	NA	Q8JL10	Natrialba_phage	37.7	1.0e-13
WP_011259420.1|2983607_2984630_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_011259421.1|2984730_2985039_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_002806565.1|2985035_2985401_+	response regulator	NA	W8CYM9	Bacillus_phage	39.3	2.7e-14
WP_011259422.1|2985434_2987444_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_069960094.1|2987611_2987866_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	2994164	3062243	4994377	tRNA,transposase	uncultured_Caudovirales_phage(35.71%)	42	NA	NA
WP_164993872.1|2994164_2995130_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_075240975.1|2995369_2997616_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.2	2.9e-13
WP_164993927.1|2998343_3000455_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.8	3.2e-14
WP_143700845.1|3001139_3003215_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	1.3e-12
WP_075239038.1|3003808_3006070_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.9	9.3e-12
WP_075239039.1|3006463_3008725_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.5	1.3e-10
WP_075239041.1|3009694_3010480_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_011408841.1|3010615_3011098_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_117231488.1|3012540_3013860_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3014072_3015041_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_164993873.1|3015177_3016497_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011259437.1|3017101_3017425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407587.1|3017681_3018716_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_011408845.1|3021254_3022121_+	chemotaxis protein CheR	NA	NA	NA	NA	NA
WP_011259439.1|3022117_3022714_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_011259440.1|3022710_3023787_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_011408846.1|3023895_3026139_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011259442.1|3026794_3027610_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_075239232.1|3027963_3030555_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_011259444.1|3030620_3031031_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_003486316.1|3031027_3031276_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075239231.1|3031423_3034189_+	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_075239230.1|3034838_3036521_+	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	26.8	4.2e-33
WP_011408848.1|3036697_3037567_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_011259451.1|3037578_3039756_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.8	3.0e-47
WP_011408849.1|3040120_3041257_-	two-component system response regulator	NA	NA	NA	NA	NA
WP_012444590.1|3041398_3042916_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	39.7	5.5e-85
WP_014503214.1|3043119_3044245_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.7	9.4e-05
WP_027703619.1|3044498_3045446_-	LytTR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075239233.1|3045605_3046856_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_011259457.1|3048253_3048955_+|transposase	DDE transposase	transposase	A9YX10	Burkholderia_phage	32.9	1.9e-16
WP_011408855.1|3049115_3049493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161629172.1|3049674_3050160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993874.1|3050283_3051603_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011408857.1|3052149_3053889_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	27.8	1.3e-42
WP_075239697.1|3053885_3054806_-	phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_011408858.1|3054822_3055299_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_011259463.1|3055295_3058538_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_012444585.1|3058546_3058990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259464.1|3058989_3060114_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.2	7.8e-44
WP_011408860.1|3060353_3061070_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_094187715.1|3061479_3062243_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3098704	3110479	4994377	tRNA	Escherichia_phage(22.22%)	13	NA	NA
WP_011259503.1|3098704_3099004_-	endolysin	NA	A0A1W6JT17	Escherichia_phage	66.7	1.5e-15
WP_011259504.1|3099046_3099277_-	endolysin	NA	D5LH07	Escherichia_phage	63.8	4.7e-20
WP_011259505.1|3099520_3100270_-	isopentenyl transferase	NA	NA	NA	NA	NA
WP_012444561.1|3100274_3100970_-	replicative DNA helicase	NA	E5DV83	Deep-sea_thermophilic_phage	41.0	5.6e-16
WP_164993875.1|3100905_3101088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444559.1|3101155_3101455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103057523.1|3101842_3102370_-	helix-turn-helix domain-containing protein	NA	A0A1W6JTD5	Pseudomonas_phage	57.4	1.2e-34
WP_003481884.1|3102972_3103185_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	76.5	1.3e-13
WP_011259507.1|3103324_3105973_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.6	3.7e-84
WP_012444556.1|3106074_3106563_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_011408884.1|3106865_3107900_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	60.7	6.2e-112
WP_011408885.1|3108072_3108714_-	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_011408886.1|3108802_3110479_-	2-polyprenylphenol 6-hydroxylase	NA	E5EQ95	Micromonas_sp._RCC1109_virus	27.2	3.3e-38
>prophage 27
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3186991	3234159	4994377	plate,transposase	Acidithiobacillus_phage(25.0%)	28	NA	NA
WP_164993878.1|3186991_3188467_-|transposase	IS5-like element ISXoo5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	66.4	2.7e-100
WP_075239395.1|3188549_3191138_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_044756724.1|3192431_3193010_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075239394.1|3194516_3196604_+	type III effector	NA	NA	NA	NA	NA
WP_164993928.1|3196989_3198087_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240329.1|3198503_3201584_+	histidine kinase	NA	NA	NA	NA	NA
WP_033013236.1|3204616_3205324_+	response regulator	NA	NA	NA	NA	NA
WP_011259588.1|3205320_3206313_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_075239189.1|3206309_3208769_+	two-component system VirA-like sensor kinase	NA	NA	NA	NA	NA
WP_011259590.1|3208882_3209863_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012444505.1|3209871_3210900_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_012444504.1|3211072_3211399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069964829.1|3211395_3214299_-	protein kinase	NA	A0A2R8FF19	Brazilian_cedratvirus	25.0	2.5e-09
WP_011259593.1|3214295_3215018_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_041182189.1|3215014_3215662_-	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_075239190.1|3215658_3219117_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_011259596.1|3219120_3220437_-	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_011408949.1|3220438_3221776_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_075239191.1|3221772_3223212_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_011408951.1|3223208_3223748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239192.1|3223756_3225694_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	28.4	3.8e-38
WP_011408952.1|3225958_3226417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143700746.1|3226816_3227311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075238997.1|3227376_3227874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027703475.1|3228062_3230768_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.3	1.1e-80
WP_012444495.1|3230800_3231811_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_075238996.1|3231774_3233652_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_075238995.1|3233655_3234159_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 28
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3238958	3295628	4994377	transposase	Ralstonia_phage(50.0%)	45	NA	NA
WP_011407587.1|3238958_3239993_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.8	8.0e-43
WP_151420375.1|3240051_3241371_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011257031.1|3241583_3242552_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	4.3e-99
WP_164993793.1|3242603_3242822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|3242805_3243762_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_033013546.1|3244369_3245107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407713.1|3245546_3246782_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_164993879.1|3246818_3248792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239678.1|3248816_3249554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993880.1|3249584_3252419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239285.1|3253076_3254963_-	transmembrane repetitive protein	NA	NA	NA	NA	NA
WP_075239284.1|3254976_3255576_-	NfuA family Fe-S biogenesis protein	NA	NA	NA	NA	NA
WP_075239283.1|3255664_3256021_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_075239282.1|3256017_3256440_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_012445384.1|3256455_3256689_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_103057594.1|3256739_3256976_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_075239281.1|3257324_3259109_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_027704269.1|3259141_3260128_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_041182694.1|3260538_3264246_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_094187715.1|3264771_3265535_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445389.1|3265638_3266286_-	response regulator	NA	NA	NA	NA	NA
WP_011408973.1|3266507_3267269_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_011408974.1|3267368_3267734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239225.1|3267792_3268224_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_011259625.1|3268235_3269498_+	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011408976.1|3269481_3270774_-	nucleotide sugar dehydrogenase	NA	NA	NA	NA	NA
WP_011408977.1|3271143_3271914_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_094187715.1|3272252_3273016_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257570.1|3273486_3274722_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011408979.1|3276020_3276278_-	stress-induced protein	NA	NA	NA	NA	NA
WP_011408980.1|3276717_3277701_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	61.2	7.5e-99
WP_011407237.1|3277722_3278679_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_011258802.1|3279074_3280043_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_041182696.1|3281414_3282377_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_153296740.1|3282626_3282785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182195.1|3282816_3282996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182196.1|3283360_3284326_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011259636.1|3285533_3286511_+	siroheme synthase	NA	NA	NA	NA	NA
WP_012445407.1|3287319_3287514_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011408987.1|3288907_3289270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011408988.1|3289253_3289823_-	molybdenum cofactor guanylyltransferase	NA	NA	NA	NA	NA
WP_012445412.1|3289860_3291114_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_011408989.1|3291319_3291697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164993881.1|3292254_3293220_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_044756360.1|3294392_3295628_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3438354	3499310	4994377	protease,tRNA,transposase	Burkholderia_virus(12.5%)	52	NA	NA
WP_094187728.1|3438354_3439153_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409063.1|3439273_3439702_-	group 1 truncated hemoglobin	NA	NA	NA	NA	NA
WP_011259756.1|3440837_3443204_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011409066.1|3443200_3443875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259758.1|3444084_3445023_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_011259759.1|3445145_3446495_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_011259760.1|3446491_3447379_-	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_012445542.1|3447698_3448505_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011259762.1|3448950_3450168_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_011409068.1|3450273_3451242_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	24.1	3.2e-09
WP_011259764.1|3451577_3452246_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_075239115.1|3452242_3453016_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_075239116.1|3453589_3455542_-	ferrous iron transporter B	NA	NA	NA	NA	NA
WP_011259769.1|3456222_3457248_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_011409070.1|3457332_3458406_-	D-glycerate dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.2	2.1e-14
WP_011259771.1|3458398_3459502_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	40.4	1.6e-73
WP_027703263.1|3459512_3460439_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_011259773.1|3460519_3461170_+	SCO family protein	NA	NA	NA	NA	NA
WP_027703264.1|3461166_3462015_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_041182211.1|3462565_3464149_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	31.5	4.2e-11
WP_143700830.1|3464335_3464791_+	DUF853 family protein	NA	A0A248XCZ8	Klebsiella_phage	45.7	1.7e-13
WP_011409074.1|3464859_3465327_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_011259777.1|3465571_3466789_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_153296738.1|3466749_3467037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409076.1|3467147_3467654_+	transcription elongation factor GreB	NA	NA	NA	NA	NA
WP_044756621.1|3467775_3469176_-	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_012445553.1|3469438_3470014_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_011409078.1|3470010_3470445_+	HIT family protein	NA	NA	NA	NA	NA
WP_011259782.1|3470472_3470640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259783.1|3471242_3471428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259784.1|3471462_3472032_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	70.1	2.6e-72
WP_011259785.1|3472124_3472976_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_011259787.1|3474363_3476379_+	M13 family metallopeptidase	NA	NA	NA	NA	NA
WP_012445555.1|3476649_3477348_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_011409081.1|3477388_3477796_-	methylated-DNA--protein-cysteine methyltransferase	NA	NA	NA	NA	NA
WP_075239598.1|3480480_3481731_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011409085.1|3481738_3482983_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_011259794.1|3483210_3483690_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_027704197.1|3483800_3484337_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.5	3.2e-19
WP_011259796.1|3484446_3485196_+	C40 family peptidase	NA	A0A0K2SUC1	Clostridium_phage	38.5	1.2e-19
WP_011259797.1|3485403_3485895_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_011409088.1|3487008_3488328_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_075239599.1|3488471_3490178_+	alkaline phosphatase	NA	NA	NA	NA	NA
WP_012445566.1|3490211_3491516_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011259802.1|3491547_3491808_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_011409091.1|3491809_3492685_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_027704198.1|3494519_3494984_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_012445570.1|3495035_3495224_-	DUF4870 domain-containing protein	NA	NA	NA	NA	NA
WP_075251445.1|3495196_3495517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042465665.1|3495513_3496881_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_075239081.1|3497026_3497608_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_011259808.1|3497864_3499310_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
>prophage 30
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3507395	3559051	4994377	tRNA,integrase,transposase	Ralstonia_phage(40.0%)	37	3546497:3546556	3563787:3564810
WP_151427526.1|3507395_3508205_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_041182215.1|3508492_3511606_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409102.1|3513021_3513492_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_012445580.1|3514076_3514256_+	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_011259821.1|3514581_3515697_-	J domain-containing protein	NA	NA	NA	NA	NA
WP_011259822.1|3515708_3516125_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_027703805.1|3516181_3517081_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_011259823.1|3517077_3518106_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_011409105.1|3518128_3518764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259825.1|3519277_3521920_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.7	2.7e-172
WP_011259826.1|3521992_3522604_-	DUF998 domain-containing protein	NA	NA	NA	NA	NA
WP_012445586.1|3522808_3523666_+	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	41.8	1.3e-11
WP_011409108.1|3523921_3524371_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_109181928.1|3524670_3525636_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_075239714.1|3526317_3526611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259829.1|3527084_3527318_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_011409111.1|3527351_3528365_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011259831.1|3528332_3528524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993883.1|3528614_3529934_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|3530099_3531068_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_094187728.1|3532021_3532820_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075239712.1|3533611_3533794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075252168.1|3533870_3534662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187728.1|3534648_3535447_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|3537348_3538317_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_075247605.1|3538319_3538874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257570.1|3538926_3540162_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_164993884.1|3540510_3541830_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239467.1|3542889_3545022_+	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_164993885.1|3545525_3546491_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
3546497:3546556	attL	TGTCAAAAAGCTATCAACACCTCAGTGCGGAAGAGCGCGCAATGCTCCAGATCGAGAGGG	NA	NA	NA	NA
WP_011409118.1|3548516_3548909_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_027704094.1|3548999_3549392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239728.1|3552353_3552773_+|integrase	tyrosine-type recombinase/integrase	integrase	C8CLF4	Xylella_phage	65.2	5.1e-41
WP_012445601.1|3554489_3556274_-	autotransporter domain-containing esterase	NA	NA	NA	NA	NA
WP_014504350.1|3556464_3556665_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011409125.1|3557200_3557995_+	thiazole synthase	NA	NA	NA	NA	NA
WP_011259853.1|3558292_3559051_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
3563787:3564810	attR	TGTCAAAAAGCTATCAACACCTCAGTGCGGAAGAGCGCGCAATGCTCCAGATCGAGAGGGGGCGCGGTCAAAGTGTGCGCGCGATTTCCAGGATTTTAGGCAGGAGCCCGTCGACATTGAGTCGGGAATTGGCCAAGCAGGACAGTACCACCTATTGCGCGCGCAGTGCGGGCAAGCGCTACCGCGCACGGCGTCAGCTTAGCGTCCGGCAGCGGCGACTGACGCCAGGAACGCCGTTATTCCAGCTGGTGCGAGATCATCTGGTGCTATGGCGCTGGTCGCCCCAGCAGATTGCTGCCAAGCTCTCGCATATGTATCCGGATGATCCTGCCCAGCGCGTCAGCCACGAAACCATTTACGCTAGCATCTACGCGCATCCGCGTGGGGGCTTGAAGAAGGAACTGGTCCAGGCCCTGCGTCAGCACAAGCCCAAACGCGGATGACGGCGTACAACGGCGGCCACACGCAGCTGGGTGCCGGAGGAGTTGCGGATTGTGCATCGCCCCGAAGAAGTGCAGACGCGCTTGGTCCCAGGTCATTGGGAAGGCGACTTGATCAAGGGCGCATTCAATCGTTCTTGCGTGGGCACGTTGGTGGAACGCAAGACGCGCTTTGTCGTGCTGTGCCGCATGGATGGCTGCACGGCCGCAGATGCGCTGGAAGGGTTTACCCGGCAAATGAAGAAACTGCCGGCCTCAATGCGGACAAGTCTGACCTACGATCGCGGTACCGAGCTCACGTGCTACGCCGAGCTGATGCAAGGATTGAACATCGACGTGTGGTTCGCTGATCCACATGCGCCGTGGCAGCGGGGAAGTAACGAGAACACCAACGGCCTGCTGCGCCAATTCCTGCCCAAGGGCGCCGACCTGTCCACTGTCAGCCAAGAGTATCTCAATCACATCGCACTGCTGATGAATACCCGCCCTCGTCAGACGCTCGGATGGAAGACACCAAGCGAGGCAATGGAGGAAGAAATCGCAGCACTCAAATCACGTGTTGCACTTGAATCTTGAGACTGCCC	NA	NA	NA	NA
>prophage 31
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3610678	3698819	4994377	plate,transposase	Liberibacter_phage(14.29%)	58	NA	NA
WP_133264714.1|3610678_3611680_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011259891.1|3612706_3614812_+	catalase	NA	A0A2K9L572	Tupanvirus	48.1	5.1e-137
WP_027703311.1|3615637_3616876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011259893.1|3617103_3619236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239597.1|3619352_3621494_-	outer protein P	NA	NA	NA	NA	NA
WP_011259895.1|3622326_3623052_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_011259896.1|3623183_3623645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027704153.1|3625759_3627880_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_027704154.1|3628146_3628992_-	transporter	NA	NA	NA	NA	NA
WP_011259903.1|3630116_3632087_-	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
WP_011259904.1|3632515_3633913_+	endoproteinase ArgC	NA	NA	NA	NA	NA
WP_027704156.1|3634025_3634844_-	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_012445640.1|3635154_3638406_-	error-prone DNA polymerase	NA	A0A1B1PA77	Streptomyces_phage	24.8	1.8e-80
WP_075239010.1|3638392_3638575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259908.1|3638587_3640006_-	DNA polymerase Y family protein	NA	NA	NA	NA	NA
WP_011259909.1|3640015_3640666_-	translesion DNA synthesis-associated protein ImuA	NA	NA	NA	NA	NA
WP_011259910.1|3640667_3641273_-	repressor LexA	NA	A0A1W6JNS2	Morganella_phage	39.2	8.6e-13
WP_011259911.1|3641422_3641644_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_011409165.1|3641653_3642079_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	48.5	5.8e-08
WP_011409167.1|3643593_3644373_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_011409168.1|3644587_3645217_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027704159.1|3645277_3646033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182227.1|3646361_3647138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239446.1|3647545_3649120_+	protein kinase	NA	NA	NA	NA	NA
WP_075239445.1|3649368_3649635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239444.1|3649913_3653093_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	30.8	1.4e-74
WP_075239443.1|3653092_3654604_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_044756558.1|3654596_3655031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239449.1|3655041_3656571_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	29.3	2.5e-45
WP_075239442.1|3656873_3657866_-	restriction endonuclease	NA	A0A1B1IUE7	uncultured_Mediterranean_phage	29.5	3.9e-31
WP_011259923.1|3657918_3658227_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_075239441.1|3658233_3658497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239440.1|3658806_3662280_+	type I restriction-modification system endonuclease	NA	A0A1B1IW48	uncultured_Mediterranean_phage	21.9	1.9e-08
WP_075239439.1|3662419_3663418_+	Abi family protein	NA	NA	NA	NA	NA
WP_075239438.1|3663464_3665009_+	type I restriction-modification system subunit M	NA	A0A220A2U5	Liberibacter_phage	24.2	4.4e-13
WP_080496265.1|3664989_3666354_+	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_075239436.1|3666387_3666696_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_011259930.1|3666702_3666966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993886.1|3667687_3668443_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_080496274.1|3669122_3670028_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_164993887.1|3669969_3672648_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	26.9	8.4e-28
WP_075239699.1|3672665_3673397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011259046.1|3673635_3674604_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_164993888.1|3674614_3676927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239652.1|3676944_3677142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407237.1|3677445_3678402_+|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_164993889.1|3678893_3679856_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_164993890.1|3679869_3682188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239063.1|3682205_3682940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993891.1|3682964_3685310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075246717.1|3685327_3686080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993892.1|3686102_3688937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012444637.1|3688933_3689863_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_164993893.1|3689871_3692634_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	27.6	4.3e-43
WP_011259938.1|3692726_3693080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239668.1|3693110_3695843_-	type VI secretion system ATPase TssH	NA	A0A223W0B1	Agrobacterium_phage	29.7	1.9e-91
WP_011259940.1|3695928_3697020_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_075239669.1|3696983_3698819_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 32
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3829911	3895176	4994377	tRNA,transposase	Bacillus_phage(25.0%)	59	NA	NA
WP_011260042.1|3829911_3830496_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_011260043.1|3830547_3831183_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_011409260.1|3831292_3832252_-	ribose-phosphate diphosphokinase	NA	A0A2K9L8D8	Tupanvirus	34.6	5.5e-38
WP_011260045.1|3832459_3833347_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_011260046.1|3833328_3833982_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_011409262.1|3833978_3835667_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011260048.1|3835732_3837031_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_075239532.1|3837008_3838094_+	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	43.3	2.5e-07
WP_075239533.1|3838090_3839797_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_094187715.1|3840200_3840964_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260051.1|3841297_3841816_+	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_011260052.1|3841848_3842631_+	polyphosphate kinase 2	NA	NA	NA	NA	NA
WP_011260053.1|3842612_3843842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409264.1|3843927_3844194_-	acylphosphatase	NA	NA	NA	NA	NA
WP_011260055.1|3844193_3844796_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_011260056.1|3844792_3846070_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_005925984.1|3846181_3846778_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_041182600.1|3846774_3847122_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_011409266.1|3847330_3848551_-	xylanase	NA	NA	NA	NA	NA
WP_011409267.1|3849064_3849550_+	asparaginase	NA	NA	NA	NA	NA
WP_012444282.1|3849554_3850028_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_075239072.1|3850235_3851936_-	S8 family serine peptidase	NA	A0A1B0T6A2	Bacillus_phage	33.1	9.1e-28
WP_075239071.1|3852279_3853644_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	35.2	1.4e-31
WP_075239070.1|3855389_3856475_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_011260066.1|3856539_3857094_-	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_011409271.1|3857280_3857700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703428.1|3857814_3858039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260068.1|3858970_3860458_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_011409274.1|3860454_3860760_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_075239544.1|3860883_3861459_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011260071.1|3861455_3861806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703741.1|3861811_3862297_+	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_011409276.1|3862694_3863792_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_011260076.1|3863937_3866277_-	DUF1631 domain-containing protein	NA	NA	NA	NA	NA
WP_011409277.1|3866644_3867220_+	nitroreductase	NA	NA	NA	NA	NA
WP_011260078.1|3867216_3868203_+	exodeoxyribonuclease IX	NA	A0A2H4IAS6	Erwinia_phage	27.0	2.8e-13
WP_011260079.1|3868199_3868751_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_011260080.1|3868731_3869529_+	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_011260081.1|3869729_3870671_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_011409278.1|3870759_3871065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703739.1|3871178_3871556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260082.1|3871566_3871893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993899.1|3872202_3872965_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011260084.1|3873388_3874234_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010381556.1|3874435_3874999_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_011409282.1|3875194_3876787_+	alkyl hydroperoxide reductase subunit F	NA	A0A1W6JNB4	Lactococcus_phage	28.4	1.9e-19
WP_012444268.1|3876878_3877820_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075239229.1|3878246_3878663_+	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_012444266.1|3878725_3879694_+	transaldolase	NA	NA	NA	NA	NA
WP_109181928.1|3880357_3881323_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011260092.1|3882756_3883335_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_075239665.1|3883750_3884401_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_011409289.1|3884496_3885012_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_103057581.1|3888997_3889726_+	glycerophosphodiester phosphodiesterase family protein	NA	A0A0S2MYI4	Enterococcus_phage	37.5	1.4e-06
WP_094187715.1|3889758_3890521_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_012445975.1|3890515_3890758_+	glycerophosphodiester phosphodiesterase	NA	NA	NA	NA	NA
WP_011407721.1|3891306_3891768_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_011409177.1|3892028_3892997_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_094187731.1|3894377_3895176_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3909551	3982547	4994377	protease,transposase	Staphylococcus_prophage(14.29%)	51	NA	NA
WP_011257310.1|3909551_3910787_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011407710.1|3911400_3912291_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_012445986.1|3912380_3912521_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|3913723_3914689_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_109182089.1|3916978_3918298_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_041182948.1|3919043_3919967_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	33.1	1.3e-36
WP_117231626.1|3921047_3922013_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011257859.1|3922314_3923892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187804.1|3923959_3924723_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_094187731.1|3928042_3928840_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257831.1|3929812_3930697_-	membrane protein	NA	NA	NA	NA	NA
WP_027703752.1|3930843_3931440_-|protease	ATP-dependent protease	protease	NA	NA	NA	NA
WP_011257829.1|3931439_3932798_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_011257828.1|3933164_3933728_-	adenylate kinase	NA	A0A1B4XWI3	Tenacibaculum_phage	31.4	3.6e-13
WP_011257827.1|3933887_3935144_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_164993900.1|3935715_3936681_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_012446005.1|3936824_3937316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109182120.1|3937600_3937774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041182780.1|3937770_3938736_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407697.1|3940989_3941472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257818.1|3941668_3942205_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	53.6	3.6e-47
WP_011257817.1|3942318_3943467_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_011407696.1|3944081_3947048_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	24.9	8.7e-42
WP_011407695.1|3947096_3947990_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075239593.1|3948100_3950452_-	biopolymer transporter Tol	NA	NA	NA	NA	NA
WP_075239592.1|3950877_3952755_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_011257812.1|3954031_3955033_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_011257811.1|3955076_3956798_+	acetolactate synthase 2 catalytic subunit	NA	E4WLQ6	Ostreococcus_tauri_virus	32.9	6.1e-64
WP_011257810.1|3956781_3957039_+	acetolactate synthase	NA	NA	NA	NA	NA
WP_011407691.1|3957114_3958239_+	threonine dehydratase	NA	NA	NA	NA	NA
WP_011407690.1|3958235_3959798_+	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	24.4	4.3e-08
WP_011257808.1|3960128_3961202_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_012446015.1|3961238_3962024_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011257807.1|3962020_3962668_-	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_011257806.1|3962735_3964184_-	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_027703665.1|3964304_3965189_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_115862292.1|3966180_3967146_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011407687.1|3967314_3967776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257800.1|3968045_3968699_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011407686.1|3968827_3969484_+	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_075239650.1|3969504_3970884_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_011257797.1|3971156_3972473_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_011257796.1|3972549_3973470_+	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferase	NA	NA	NA	NA	NA
WP_011257795.1|3973703_3975038_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_075239651.1|3975018_3976131_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_011257793.1|3976140_3976338_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_103057263.1|3976463_3976997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239682.1|3978676_3979399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257791.1|3979398_3980034_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_164993932.1|3980277_3981654_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	56.2	4.6e-78
WP_011257788.1|3981764_3982547_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 34
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	3987848	4049860	4994377	protease,transposase	Ralstonia_phage(40.0%)	49	NA	NA
WP_027703756.1|3987848_3988712_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_011407680.1|3988711_3989839_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_011257782.1|3990468_3990855_-	response regulator	NA	W8CYM9	Bacillus_phage	31.8	9.6e-10
WP_011257781.1|3991094_3991994_-	DnaJ domain-containing protein	NA	A0A2L0UZR4	Agrobacterium_phage	27.7	5.9e-18
WP_011407679.1|3992404_3992881_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_075239120.1|3993043_3993526_+	peroxiredoxin	NA	A0A1D8KSL1	Synechococcus_phage	35.6	6.8e-21
WP_011257778.1|3993568_3994129_+	bacterioferritin	NA	NA	NA	NA	NA
WP_011407678.1|3994262_3995225_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.7e-42
WP_117231466.1|3995569_3996889_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407676.1|3996959_3997496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041182786.1|3997995_3998943_-	glycerophosphodiester phosphodiesterase family protein	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	28.5	4.9e-07
WP_075239721.1|3999117_4002105_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_164993901.1|4002370_4003339_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	1.9e-99
WP_011257767.1|4003788_4004988_-	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_011407669.1|4005260_4005398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446043.1|4005469_4005637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239471.1|4005720_4008312_-	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_012446045.1|4008499_4009654_-	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_011257763.1|4009729_4010626_-	methylisocitrate lyase	NA	NA	NA	NA	NA
WP_075239470.1|4010771_4012370_+	propionate catabolism operon regulatory protein PrpR	NA	NA	NA	NA	NA
WP_011407665.1|4012605_4012932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187784.1|4013096_4013860_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407663.1|4013951_4014425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257760.1|4014947_4015301_-	type IV fimbriae assembly protein	NA	NA	NA	NA	NA
WP_012446049.1|4015297_4016257_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_011257758.1|4016253_4017327_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_075239127.1|4017387_4018743_-	aminodeoxychorismate synthase component I	NA	NA	NA	NA	NA
WP_011407661.1|4018913_4020149_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_010368407.1|4020290_4020530_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	44.6	5.9e-10
WP_011407660.1|4020734_4021478_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.7	5.2e-12
WP_075239128.1|4021560_4022505_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_075239129.1|4022782_4023223_-	MEKHLA domain-containing protein	NA	NA	NA	NA	NA
WP_011257752.1|4023452_4024430_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_010368401.1|4024519_4024714_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_011407659.1|4024812_4025322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257750.1|4025434_4026010_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_151420377.1|4026400_4027366_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011258529.1|4027510_4028479_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.0	8.7e-100
WP_117231466.1|4028678_4029998_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239361.1|4030114_4032406_+	CRISPR-associated helicase/endonuclease Cas3	NA	NA	NA	NA	NA
WP_011257746.1|4032533_4033208_+	type I-C CRISPR-associated protein Cas5	NA	NA	NA	NA	NA
WP_011257745.1|4033204_4035049_+	type I-C CRISPR-associated protein Cas8c/Csd1	NA	NA	NA	NA	NA
WP_011257744.1|4035045_4035912_+	type I-C CRISPR-associated protein Cas7/Csd2	NA	NA	NA	NA	NA
WP_011257743.1|4035931_4036564_+	CRISPR-associated protein Cas4	NA	NA	NA	NA	NA
WP_011257741.1|4037615_4037906_+	CRISPR-associated endonuclease Cas2	NA	NA	NA	NA	NA
WP_011407652.1|4043695_4044535_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011407650.1|4045145_4046303_+	phosphotransferase	NA	NA	NA	NA	NA
WP_069964990.1|4046338_4048501_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011258802.1|4048891_4049860_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
>prophage 35
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	4083558	4135065	4994377	tRNA,transposase	Enterobacteria_phage(25.0%)	40	NA	NA
WP_011257710.1|4083558_4086501_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	34.8	6.4e-130
WP_027704099.1|4086508_4086811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099051304.1|4087437_4088539_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.2	6.5e-43
WP_075239157.1|4088724_4089042_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_115801909.1|4089092_4090412_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4090566_4091523_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_012446083.1|4091682_4092651_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_094187728.1|4093541_4094340_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011257702.1|4095278_4096319_+	pectate lyase	NA	NA	NA	NA	NA
WP_027704044.1|4096585_4098559_-	transglycosylase SLT domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	36.7	7.9e-15
WP_117231466.1|4098863_4100183_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_011258802.1|4100332_4101301_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_011407624.1|4104751_4105234_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257696.1|4105230_4105698_-	alanine acetyltransferase	NA	NA	NA	NA	NA
WP_011407623.1|4105708_4106482_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_075239590.1|4106613_4107018_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_075239589.1|4107129_4108824_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011407621.1|4108966_4109428_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_011257691.1|4109489_4110749_-	threonine/serine exporter	NA	NA	NA	NA	NA
WP_011407620.1|4110918_4112031_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011257689.1|4112116_4112959_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	30.1	9.1e-13
WP_011257688.1|4112961_4113888_+	MCE family protein	NA	NA	NA	NA	NA
WP_011257687.1|4113884_4114529_+	ABC transporter	NA	NA	NA	NA	NA
WP_011257686.1|4115079_4115688_-	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	A0A2K9L0M4	Tupanvirus	31.4	1.8e-23
WP_075239588.1|4115803_4117453_+	electron transfer flavoprotein-ubiquinone oxidoreductase	NA	NA	NA	NA	NA
WP_011407618.1|4117449_4119537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012446094.1|4119594_4120224_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_011407617.1|4120223_4120955_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_011407616.1|4121088_4122435_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	26.9	2.6e-33
WP_011257680.1|4122481_4123885_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	2.5e-47
WP_011407615.1|4124001_4124910_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	35.1	1.8e-27
WP_075239216.1|4124906_4125464_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	47.5	2.3e-44
WP_011407613.1|4125460_4126348_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	2.2e-94
WP_011407612.1|4126403_4127459_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	48.0	4.3e-84
WP_011257675.1|4127684_4128431_+	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011257674.1|4128430_4129372_+	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011407611.1|4129594_4130413_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011407610.1|4130402_4131716_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.6	3.8e-13
WP_011408760.1|4132245_4133430_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.4	1.0e-41
WP_164493037.1|4133745_4135065_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 36
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	4254405	4293245	4994377	integrase,transposase	Enterobacteria_phage(33.33%)	30	4251539:4251555	4295932:4295948
4251539:4251555	attL	ACATGCGCGAAATGGGC	NA	NA	NA	NA
WP_011257570.1|4254405_4255641_-|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_075239151.1|4256361_4257693_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.4	2.1e-19
WP_075239152.1|4257967_4259182_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_012446188.1|4259490_4259685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_117231519.1|4260208_4261528_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_075239005.1|4265002_4265383_+	response regulator	NA	NA	NA	NA	NA
WP_011257545.1|4265351_4265618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012446194.1|4265617_4266898_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_075239004.1|4268022_4269423_+	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_011257537.1|4271548_4271713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239431.1|4272104_4272419_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011257535.1|4272428_4272650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257534.1|4273070_4273283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012443985.1|4273621_4274359_+	DUF3348 domain-containing protein	NA	NA	NA	NA	NA
WP_011407521.1|4274369_4277027_+	DUF802 domain-containing protein	NA	NA	NA	NA	NA
WP_011257531.1|4277023_4277698_+	OmpA family protein	NA	NA	NA	NA	NA
WP_011257530.1|4277694_4278360_+	DUF2894 domain-containing protein	NA	NA	NA	NA	NA
WP_075239432.1|4278444_4280586_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_011407518.1|4280675_4281944_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_075239433.1|4281943_4283380_-	DUF3526 domain-containing protein	NA	NA	NA	NA	NA
WP_011407516.1|4283390_4284113_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	1.2e-16
WP_094187728.1|4284680_4285478_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_109181928.1|4286203_4287169_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407513.1|4287491_4287881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044756360.1|4287949_4289185_+|transposase	ISL3-like element ISXoo13 family transposase	transposase	NA	NA	NA	NA
WP_011257523.1|4290847_4290976_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_011407508.1|4291119_4291365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257521.1|4291361_4291634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257520.1|4291630_4291837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407507.1|4292057_4293245_+|integrase	integrase	integrase	V9IQN0	Stenotrophomonas_phage	50.3	1.0e-110
4295932:4295948	attR	GCCCATTTCGCGCATGT	NA	NA	NA	NA
>prophage 37
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	4296381	4371339	4994377	tRNA,transposase	Ralstonia_phage(25.0%)	56	NA	NA
WP_011257505.1|4296381_4296822_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_011407504.1|4296922_4297837_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_011407503.1|4298036_4298558_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_011257502.1|4298800_4299934_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.1e-28
WP_048488816.1|4300043_4300553_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_011257500.1|4300549_4302016_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_059317527.1|4302181_4303237_-	CDP-glycerol glycerophosphotransferase	NA	NA	NA	NA	NA
WP_011257498.1|4303240_4304065_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_011257497.1|4304262_4305540_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_011257496.1|4305704_4307426_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_011407500.1|4307476_4308790_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011257494.1|4308789_4309713_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_027703439.1|4310107_4310620_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	43.0	2.6e-18
WP_011407499.1|4310752_4311889_+	LysM peptidoglycan-binding domain-containing protein	NA	G3MBQ1	Bacillus_virus	57.1	1.7e-09
WP_011257491.1|4311960_4313103_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_011257490.1|4313145_4313619_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_075239049.1|4313659_4314382_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_075239050.1|4314423_4315698_+	RDD family protein	NA	NA	NA	NA	NA
WP_075239051.1|4315880_4318373_+	DNA topoisomerase I	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	35.1	3.2e-114
WP_011257486.1|4318383_4318947_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_011407497.1|4319170_4319944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407496.1|4319940_4320615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407495.1|4320776_4321553_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011257482.1|4321659_4321875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027703443.1|4322060_4323962_-	signal peptide peptidase SppA	NA	A0A291AUM2	Sinorhizobium_phage	28.3	8.1e-09
WP_027703444.1|4324046_4325423_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_151421302.1|4325695_4325986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257479.1|4325936_4326782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012443959.1|4327112_4327715_-	DUF3106 domain-containing protein	NA	NA	NA	NA	NA
WP_011257477.1|4327698_4328724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257476.1|4329189_4331412_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_011257475.1|4331814_4332330_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_011407278.1|4332859_4334179_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_109182013.1|4334646_4335612_+|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
WP_011407487.1|4335796_4336129_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_075239514.1|4336134_4338459_+	cytochrome C biogenesis protein	NA	NA	NA	NA	NA
WP_011407485.1|4339298_4339745_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_075239515.1|4339843_4340314_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_011407484.1|4340346_4340754_+	four helix bundle protein	NA	NA	NA	NA	NA
WP_010368143.1|4340789_4342157_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_011257468.1|4342295_4342661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187861.1|4342657_4343050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011407482.1|4343118_4343583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257466.1|4344528_4345470_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_027703754.1|4345616_4346132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257464.1|4346275_4346653_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075239516.1|4347363_4348209_+	DUF3426 domain-containing protein	NA	NA	NA	NA	NA
WP_011257462.1|4348315_4348588_+	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
WP_164993902.1|4353557_4354356_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011407237.1|4355337_4356294_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_117231484.1|4356414_4357650_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_113343766.1|4363863_4364847_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	57.4	3.6e-77
WP_094187715.1|4366419_4367182_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075240308.1|4368122_4368374_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_011258802.1|4368851_4369820_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	8.7e-100
WP_117231466.1|4370019_4371339_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
>prophage 38
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	4444104	4514103	4994377	tRNA,transposase	Listeria_phage(17.65%)	54	NA	NA
WP_075239474.1|4444104_4445316_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257439.1|4445487_4446906_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	36.9	2.0e-12
WP_011257438.1|4447276_4448410_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_011257437.1|4448447_4448675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239473.1|4448733_4450029_-	MFS transporter	NA	NA	NA	NA	NA
WP_012446253.1|4450348_4451149_-	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	28.7	1.2e-25
WP_011257434.1|4451276_4451936_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_027703571.1|4451979_4452639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011257432.1|4452752_4453550_+	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	31.0	4.3e-20
WP_011257431.1|4453549_4454479_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	34.9	1.0e-12
WP_011257430.1|4454514_4454823_+	mitomycin resistance protein	NA	NA	NA	NA	NA
WP_041181942.1|4455028_4455994_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SKV4	Klosneuvirus	30.2	4.2e-30
WP_011407452.1|4456348_4457071_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_010374733.1|4457070_4457412_+	membrane protein	NA	NA	NA	NA	NA
WP_033013268.1|4457829_4458378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012446260.1|4458485_4460834_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	29.7	4.0e-50
WP_011407449.1|4460847_4461315_-	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	96.7	1.1e-79
WP_044757180.1|4461311_4462586_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	31.4	6.8e-36
WP_011407447.1|4462682_4463360_+	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_012446263.1|4463447_4465136_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_011257421.1|4465315_4466197_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011257420.1|4466203_4466668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011407443.1|4466762_4467518_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075239606.1|4468485_4469346_-	serine protein kinase RIO	NA	NA	NA	NA	NA
WP_044757182.1|4470702_4471542_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_011407440.1|4471812_4472226_-	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_011257413.1|4472251_4473034_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_075239605.1|4473044_4474397_-	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_011257411.1|4474897_4475461_-	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_011257410.1|4475465_4476194_-	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_011257409.1|4476272_4477481_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_164993933.1|4477992_4479095_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.5	2.6e-39
WP_011257407.1|4479308_4479635_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_075239486.1|4479606_4480101_-	flavodoxin	NA	A0A068CFW0	Listeria_phage	35.4	1.0e-16
WP_075239487.1|4480120_4481104_-	5'-nucleotidase	NA	NA	NA	NA	NA
WP_012446275.1|4481149_4482193_-	ribonucleotide-diphosphate reductase subunit beta	NA	A8ASV9	Listeria_phage	75.4	2.5e-153
WP_075239488.1|4482368_4484867_-	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A088FNW1	Listeria_phage	67.1	6.4e-304
WP_011407433.1|4485463_4486507_-	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	51.8	8.2e-80
WP_044757189.1|4486613_4489322_-	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_125168736.1|4489371_4489596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257401.1|4489608_4490223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011257400.1|4490294_4491662_-	magnesium transporter	NA	NA	NA	NA	NA
WP_012446282.1|4492339_4494157_+	potassium transporter	NA	NA	NA	NA	NA
WP_115801909.1|4494256_4495576_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_069960014.1|4495775_4496744_-|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_117231611.1|4496910_4497882_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.5e-38
WP_011408397.1|4498074_4499259_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	44.8	5.0e-41
WP_011260517.1|4499726_4500542_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	35.8	7.4e-36
WP_069960034.1|4501300_4502617_-	amidohydrolase	NA	NA	NA	NA	NA
WP_011260520.1|4502876_4504121_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_075239201.1|4504213_4507462_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_011409597.1|4507595_4510736_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_011409598.1|4511025_4512393_-	VOC family protein	NA	NA	NA	NA	NA
WP_109181957.1|4513137_4514103_-|transposase	IS1595-like element ISXo5 family transposase	transposase	NA	NA	NA	NA
>prophage 39
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	4685765	4785273	4994377	tRNA,transposase	Pike_perch_iridovirus(12.5%)	59	NA	NA
WP_094187728.1|4685765_4686564_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075239061.1|4692137_4694222_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_011260668.1|4694321_4696349_-	acetyl/propionyl/methylcrotonyl-CoA carboxylase subunit alpha	NA	NA	NA	NA	NA
WP_075239060.1|4696591_4698202_-	methylcrotonoyl-CoA carboxylase	NA	A0A1B2ITV7	Pike_perch_iridovirus	51.5	1.1e-19
WP_011260670.1|4698212_4699376_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_011409694.1|4699504_4700125_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012443812.1|4700455_4700644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260672.1|4700686_4701022_-	DUF3325 domain-containing protein	NA	NA	NA	NA	NA
WP_075239059.1|4702646_4702958_-	DUF3649 domain-containing protein	NA	NA	NA	NA	NA
WP_011409699.1|4704076_4704595_+	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_075239058.1|4704866_4706585_+	ExeM/NucH family extracellular endonuclease	NA	NA	NA	NA	NA
WP_011260679.1|4706675_4707062_-	MerC family mercury resistance protein	NA	NA	NA	NA	NA
WP_075239057.1|4707123_4708449_+	GTP-binding protein	NA	NA	NA	NA	NA
WP_075239056.1|4708563_4709877_-	type III effector protein XopR	NA	NA	NA	NA	NA
WP_011260682.1|4709975_4710701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239062.1|4710917_4711580_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075239055.1|4711658_4712753_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_033013219.1|4714253_4717013_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.8	2.1e-146
WP_011260686.1|4717265_4718867_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_012443798.1|4718866_4721104_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_012443796.1|4721393_4722302_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_011260689.1|4722391_4724206_+	type II/IV secretion system protein	NA	NA	NA	NA	NA
WP_164993908.1|4724591_4733375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164993909.1|4733516_4734314_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011409712.1|4734859_4735612_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_075239582.1|4735671_4736571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011260694.1|4736722_4737478_-	twin-arginine translocase subunit TatC	NA	NA	NA	NA	NA
WP_011409714.1|4737474_4738110_-	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_003484969.1|4738125_4738353_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_011409715.1|4738425_4739328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409716.1|4739482_4740448_+	ferrochelatase	NA	NA	NA	NA	NA
WP_075239583.1|4740545_4741301_+	alpha/beta hydrolase	NA	G1DB77	Mycobacterium_phage	35.2	9.7e-06
WP_011409719.1|4742111_4742897_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_011260701.1|4743523_4744429_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	32.9	3.1e-43
WP_012443789.1|4744492_4745410_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	62.5	4.1e-83
WP_011259480.1|4746013_4747351_+	xylose isomerase	NA	NA	NA	NA	NA
WP_011409721.1|4747576_4748644_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012443784.1|4748819_4751015_+	alpha-glucuronidase	NA	NA	NA	NA	NA
WP_041182560.1|4751011_4752976_+	9-O-acetylesterase	NA	NA	NA	NA	NA
WP_011409724.1|4752987_4754247_+	D-galactonate dehydratase family protein	NA	Q6A202	Oenococcus_phage	26.0	3.5e-40
WP_011260707.1|4754246_4755947_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_080496266.1|4755949_4758664_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_011260709.1|4758886_4760359_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	32.1	4.5e-47
WP_011260711.1|4761336_4762392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011260712.1|4762619_4764038_-	glucuronate isomerase	NA	NA	NA	NA	NA
WP_075239187.1|4764078_4765056_-	endo-1,4-beta-xylanase	NA	NA	NA	NA	NA
WP_069960285.1|4766473_4767775_-	MFS transporter	NA	NA	NA	NA	NA
WP_075239186.1|4768236_4771170_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_011409728.1|4771268_4772756_+	MFS transporter	NA	NA	NA	NA	NA
WP_011260718.1|4772787_4773822_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_109182041.1|4775753_4776551_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_010374782.1|4777427_4777604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4778484_4779247_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_113090107.1|4779376_4780366_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011260725.1|4780431_4781553_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_075239663.1|4781562_4782639_-	ferredoxin reductase	NA	NA	NA	NA	NA
WP_011260727.1|4782731_4783412_+	HTH-type transcriptional repressor FabR	NA	NA	NA	NA	NA
WP_094187801.1|4783444_4784243_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_133264481.1|4784316_4785273_+|transposase	IS30 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	34.4	2.9e-39
>prophage 40
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	4811320	4820057	4994377	tail	Arthrobacter_phage(50.0%)	6	NA	NA
WP_075239174.1|4811320_4815424_-	autotransporter domain-containing protein	NA	F5B3Z3	Synechococcus_phage	47.2	2.0e-20
WP_011409756.1|4815679_4816225_+|tail	phage tail protein	tail	A0A0U4JXW2	Arthrobacter_phage	32.9	1.9e-11
WP_011260754.1|4816293_4816821_+|tail	phage tail protein	tail	A0A218M5J0	Arthrobacter_phage	33.1	1.2e-15
WP_075239175.1|4816879_4817416_+|tail	phage tail protein	tail	A0A0U4JYA4	Arthrobacter_phage	32.5	1.6e-10
WP_075239306.1|4818751_4819384_-	superoxide dismutase family protein	NA	M1ICI8	Paramecium_bursaria_Chlorella_virus	41.0	7.8e-17
WP_012443745.1|4819454_4820057_-	superoxide dismutase family protein	NA	I3XM75	Mamestra_brassicae_nuclear_polyhedrosis_virus	40.6	7.7e-14
>prophage 41
NZ_CP040604	Xanthomonas oryzae pv. oryzae strain IXO704 chromosome, complete genome	4994377	4861591	4923095	4994377	transposase	Staphylococcus_phage(22.22%)	53	NA	NA
WP_164993910.1|4861591_4862560_+|transposase	IS5-like element ISXo1 family transposase	transposase	A0A077K814	Ralstonia_phage	60.3	1.5e-99
WP_012446412.1|4864773_4864920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239538.1|4865401_4866205_-	2,5-didehydrogluconate reductase DkgB	NA	A0A2H4PQR8	Staphylococcus_phage	35.4	3.3e-36
WP_011260800.1|4866266_4867295_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011260801.1|4867433_4868405_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_011409786.1|4868637_4869492_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_011409787.1|4869584_4870157_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_011260804.1|4870479_4870920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011409789.1|4871082_4873584_-	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	25.4	6.0e-20
WP_011260806.1|4874272_4874746_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	48.7	2.1e-35
WP_011409790.1|4875058_4876378_-	L-fuconate dehydratase	NA	NA	NA	NA	NA
WP_011260808.1|4876871_4877729_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_011260809.1|4877898_4878669_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_011409791.1|4878665_4879538_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_011409792.1|4879534_4880545_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_012446418.1|4880656_4880824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239540.1|4880857_4881955_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_012446420.1|4882088_4882292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075239541.1|4883207_4883876_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_011409795.1|4884137_4886081_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	38.2	1.3e-83
WP_011409796.1|4886378_4886732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075239542.1|4886728_4887769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409798.1|4887855_4888173_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_011260819.1|4888169_4889897_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_094187728.1|4890505_4891304_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_069970168.1|4891356_4892001_-	ROK family protein	NA	NA	NA	NA	NA
WP_011260821.1|4892414_4893194_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_011409800.1|4893190_4893628_+	GFA family protein	NA	NA	NA	NA	NA
WP_011409801.1|4893689_4893941_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_014501576.1|4894067_4894664_+	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_011260825.1|4894682_4896254_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011260826.1|4896430_4898059_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_011260827.1|4898281_4898920_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_011260828.1|4899988_4900348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002809459.1|4900532_4900769_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002809462.1|4900782_4900950_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_027703420.1|4901382_4902405_-	amidohydrolase	NA	NA	NA	NA	NA
WP_075239342.1|4902633_4903689_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_075239343.1|4903681_4904362_-	4-carboxy-4-hydroxy-2-oxoadipate aldolase/oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_075239344.1|4904463_4905771_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012446434.1|4905787_4907206_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_012446436.1|4907777_4909172_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_012446437.1|4909519_4911706_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.5	3.8e-111
WP_012446438.1|4911881_4912106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153296756.1|4912514_4912658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094187715.1|4912732_4913495_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_164993911.1|4913502_4914468_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_011260840.1|4914643_4916059_-	amino acid permease	NA	NA	NA	NA	NA
WP_012446442.1|4916549_4918874_+	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_041182970.1|4919279_4919642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011409815.1|4920019_4920565_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	33.9	2.6e-16
WP_011407237.1|4920615_4921572_-|transposase	IS30-like element IS1112a family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.2	2.1e-42
WP_164993934.1|4921718_4923095_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	55.1	2.3e-77
