The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016406	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 chromosome, complete genome	4727126	5250	41280	4727126	portal,plate,integrase,head,lysis,capsid,holin,tail,terminase	Escherichia_phage(55.81%)	47	5093:5139	36655:36701
5093:5139	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|5250_5469_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001598749.1|5550_6714_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	1.4e-205
WP_000978896.1|6713_7193_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_023993657.1|7207_9655_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.8	0.0e+00
WP_000785970.1|9647_9767_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|9799_10075_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|10131_10650_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286698.1|10662_11853_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_023993658.1|11912_12506_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	3.9e-103
WP_075323717.1|12533_12932_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	38.3	1.6e-12
WP_006673257.1|12934_13375_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.2e-51
WP_006673255.1|13346_13949_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	6.6e-98
WP_023993680.1|15281_15893_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	98.5	2.4e-116
WP_023993681.1|15885_16794_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	1.7e-161
WP_001389961.1|16798_17146_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001093731.1|17142_17778_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_023993682.1|17844_18297_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.9e-75
WP_000917182.1|18289_18757_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_023993683.1|18864_19290_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	6.1e-66
WP_023993684.1|19277_19703_-	hypothetical protein	NA	M1SV74	Escherichia_phage	98.6	5.5e-59
WP_001144101.1|19717_20215_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|20214_20496_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|20499_20703_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988636.1|20702_21212_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203461.1|21311_22055_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	8.6e-124
WP_016237184.1|22058_23132_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_023993685.1|23190_24045_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	99.6	6.4e-139
WP_023993686.1|24218_25991_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001620981.1|25990_27025_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.4	2.4e-201
WP_001161722.1|27451_28393_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	73.7	2.0e-133
WP_001389947.1|28475_28958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119270.1|29141_29627_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	37.1	6.0e-09
WP_001598736.1|30763_33040_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.3	0.0e+00
WP_000027673.1|33029_33305_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113277.1|33301_33526_-	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	6.5e-35
WP_001277898.1|33528_33828_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|33827_34052_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|34115_34616_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|34785_35058_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|35194_35488_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|35557_36538_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|36723_37224_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
36655:36701	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|37374_38073_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|38069_39443_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133440.1|39493_39889_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_000559229.1|39900_40590_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|40659_41280_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 2
NZ_CP016406	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 chromosome, complete genome	4727126	1407867	1416843	4727126	integrase	Enterobacteria_phage(85.71%)	10	1412636:1412651	1419458:1419473
WP_023993982.1|1407867_1410201_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_023993983.1|1410215_1410536_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216603.1|1410532_1410760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|1410756_1411308_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_000556594.1|1411304_1411571_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	69.3	3.7e-29
WP_000149860.1|1412108_1412846_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
1412636:1412651	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_000984209.1|1412842_1413085_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_023993984.1|1413101_1413668_+	bacteriophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.2e-56
WP_001604631.1|1414200_1415610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001604633.1|1415646_1416843_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
1419458:1419473	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
>prophage 3
NZ_CP016406	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 chromosome, complete genome	4727126	1708760	1742608	4727126	protease,lysis,coat,portal	Salmonella_phage(67.92%)	53	NA	NA
WP_023993447.1|1708760_1708964_-	transcriptional regulator	NA	I6RSG8	Salmonella_phage	95.5	6.1e-32
WP_023993446.1|1709122_1709395_-	hypothetical protein	NA	A0A2H4FNB3	Salmonella_phage	98.9	2.6e-38
WP_000582224.1|1710093_1710849_-	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_023993443.1|1711162_1711564_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.0	1.3e-70
WP_023993442.1|1711560_1712253_-	HNH endonuclease	NA	C6ZR31	Salmonella_phage	90.7	1.2e-114
WP_023993441.1|1712240_1712411_-	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	98.2	1.8e-24
WP_023993440.1|1712421_1712715_-	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	94.8	6.8e-48
WP_023993439.1|1712761_1713046_-	hypothetical protein	NA	E7C9P9	Salmonella_phage	96.8	2.0e-44
WP_023993438.1|1713045_1713753_-	hypothetical protein	NA	I6R0N0	Salmonella_phage	94.9	9.1e-131
WP_000902089.1|1713749_1713893_-	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	1.6e-18
WP_000156731.1|1713882_1714071_-	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000141641.1|1714051_1714210_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_001748038.1|1714542_1714821_-	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
WP_075322247.1|1714854_1715574_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	88.3	2.2e-44
WP_058649971.1|1715777_1716311_-	HNH endonuclease	NA	A0A2H4FNF1	Salmonella_phage	97.2	9.0e-99
WP_000947484.1|1716411_1716828_-	HNH endonuclease	NA	Q5G8U2	Enterobacteria_phage	40.3	1.2e-21
WP_000935320.1|1717139_1717892_-	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	63.8	7.8e-72
WP_001058406.1|1717932_1718166_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	67.5	5.6e-21
WP_000189606.1|1718316_1718613_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_001125981.1|1718645_1718792_+	DUF2740 family protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_075322246.1|1718784_1719618_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.9	2.1e-150
WP_023167630.1|1719614_1720991_+	AAA family ATPase	NA	I6R0N4	Salmonella_phage	99.1	6.3e-253
WP_023993437.1|1721062_1721335_+	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	96.6	9.7e-41
WP_023993436.1|1721565_1721847_+	hypothetical protein	NA	I6R992	Salmonella_phage	64.2	9.4e-23
WP_001291852.1|1721849_1722050_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	98.5	1.4e-28
WP_023993435.1|1722052_1722475_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	99.3	1.1e-78
WP_001254236.1|1722482_1722659_+	NinE family protein	NA	A0A220NRK6	Escherichia_phage	94.8	1.9e-26
WP_000924596.1|1722661_1723063_+	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_000950998.1|1723055_1723232_+	protein ninF	NA	K7P6R5	Enterobacteria_phage	93.0	1.4e-24
WP_001089628.1|1723224_1723461_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	93.6	1.3e-36
WP_001185533.1|1723441_1723912_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	95.5	2.2e-88
WP_000337150.1|1723899_1724082_+	hypothetical protein	NA	C6ZR61	Salmonella_phage	98.3	7.2e-24
WP_000196508.1|1724078_1724321_+	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	93.8	5.8e-37
WP_001047569.1|1724478_1725258_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	95.3	1.2e-128
WP_000286100.1|1725679_1725883_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001748050.1|1725860_1726358_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	96.4	7.9e-89
WP_001748051.1|1726354_1726813_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	78.8	4.3e-57
WP_023994441.1|1727022_1727544_+	KilA-N domain-containing protein	NA	H6WRZ8	Salmonella_phage	98.3	1.8e-99
WP_023217190.1|1728017_1728260_+	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	98.8	1.9e-35
WP_058649961.1|1728262_1728667_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	3.4e-66
WP_000729924.1|1728670_1729159_+	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_017441431.1|1729136_1730636_+	DNA packaging protein	NA	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
WP_017441432.1|1730635_1732813_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
WP_017441433.1|1732826_1733738_+	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
WP_020899473.1|1733737_1735030_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
WP_000538675.1|1735070_1735631_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
WP_010835893.1|1735614_1736115_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
WP_023198766.1|1736074_1737493_+	packaged DNA stabilization protein gp10	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
WP_023198767.1|1737496_1738198_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	93.1	4.0e-70
WP_017441438.1|1738197_1738659_+	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	84.9	4.3e-73
WP_023198768.1|1738661_1739351_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	89.8	1.9e-88
WP_165398880.1|1739360_1740716_+	phage DNA ejection protein	NA	A0A220NR03	Salmonella_phage	97.1	2.3e-239
WP_001029862.1|1740715_1742608_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	78.3	5.1e-245
>prophage 4
NZ_CP016406	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 chromosome, complete genome	4727126	1869975	1877288	4727126	integrase,protease	Dickeya_phage(16.67%)	7	1871226:1871240	1882480:1882494
WP_001201750.1|1869975_1871094_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_023993622.1|1871090_1873037_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
1871226:1871240	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1873166_1873388_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1873711_1874032_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|1874062_1876339_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|1876551_1876749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993623.1|1876910_1877288_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.0e-19
1882480:1882494	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 5
NZ_CP016406	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 chromosome, complete genome	4727126	2881216	2888467	4727126		Morganella_phage(33.33%)	8	NA	NA
WP_023993342.1|2881216_2882647_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_023993343.1|2882720_2883416_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	3.6e-07
WP_000107435.1|2883495_2883807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993344.1|2884455_2885652_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.6	4.3e-109
WP_024131109.1|2885910_2886099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2886109_2886322_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_023993345.1|2886776_2888045_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	9.3e-227
WP_000394197.1|2888047_2888467_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 6
NZ_CP016406	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 chromosome, complete genome	4727126	3046873	3056044	4727126	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_000195340.1|3046873_3048907_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3049147_3049606_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023993390.1|3049777_3050308_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	31.7	2.8e-15
WP_000950413.1|3050364_3050832_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3050878_3051598_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|3051594_3053280_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|3053502_3054234_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023993392.1|3054293_3054401_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3054381_3055113_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3055096_3056044_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 7
NZ_CP016406	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 chromosome, complete genome	4727126	3268017	3342532	4727126	tRNA,terminase,protease,head,capsid,lysis,tail,integrase	Salmonella_phage(66.2%)	94	3266426:3266439	3343164:3343177
3266426:3266439	attL	GAATCCCGGCGGGA	NA	NA	NA	NA
WP_000016631.1|3268017_3268830_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289141.1|3268829_3269843_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699176.1|3269910_3271047_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
WP_000553395.1|3271150_3272152_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127721.1|3272148_3273327_-	MFS transporter	NA	NA	NA	NA	NA
WP_001051261.1|3273506_3273881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433425.1|3274053_3274302_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	6.2e-18
WP_000118256.1|3274470_3274839_+	C40 family peptidase	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
WP_000847535.1|3274838_3275357_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_001142900.1|3275423_3276080_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000817161.1|3276177_3277392_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_023993415.1|3277551_3279552_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559749.1|3279603_3279879_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001066345.1|3279911_3280460_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_023993416.1|3280459_3281269_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_000750429.1|3281268_3282093_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918457.1|3282096_3283182_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001650203.1|3283217_3284150_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730794.1|3284315_3284867_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001195808.1|3284966_3285452_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_023993417.1|3285669_3287808_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_023993418.1|3287807_3289118_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030904.1|3289295_3289580_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001533060.1|3289950_3291258_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776787.1|3291318_3292074_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_023993419.1|3292362_3293304_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.3e-145
WP_023993420.1|3293617_3294787_+|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	98.7	1.5e-226
WP_023993421.1|3294858_3296157_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	96.8	7.5e-240
WP_023993422.1|3296167_3297127_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	3.6e-183
WP_023993423.1|3297135_3299856_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	96.0	0.0e+00
WP_023993424.1|3299855_3300254_-	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
WP_023993425.1|3300260_3300845_-	hypothetical protein	NA	S4TND4	Salmonella_phage	97.4	1.1e-105
WP_023993426.1|3300844_3301438_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.4	1.2e-107
WP_023993427.1|3301603_3301852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023993428.1|3301954_3305293_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	69.5	0.0e+00
WP_023993429.1|3305351_3305693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993430.1|3305747_3306026_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	88.0	6.0e-38
WP_023993431.1|3306034_3306424_-|tail	phage tail assembly protein	tail	K7PKV6	Enterobacterial_phage	85.3	7.3e-58
WP_023993432.1|3306451_3307156_-|tail	prophage major tail protein	tail	K7PHL2	Enterobacterial_phage	75.6	6.7e-94
WP_000133673.1|3307213_3307561_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	78.8	7.5e-46
WP_000573485.1|3307557_3308007_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	98.7	7.6e-75
WP_001007886.1|3308003_3308354_-|head	phage head closure protein	head	S4TND9	Salmonella_phage	87.9	1.1e-49
WP_000571722.1|3308362_3308689_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	99.1	1.8e-54
WP_023242805.1|3311285_3313220_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	99.7	0.0e+00
WP_024134503.1|3313278_3314940_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	99.6	0.0e+00
WP_000954404.1|3314936_3315431_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_001096739.1|3315741_3316107_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	82.9	4.3e-52
WP_000983798.1|3316099_3316693_-	hypothetical protein	NA	S4TR53	Salmonella_phage	96.9	1.2e-112
WP_001124954.1|3316673_3317192_-	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	54.3	1.3e-46
WP_023993433.1|3317235_3318693_-	glycosyltransferase family 2 protein	NA	S4TSQ9	Salmonella_phage	99.6	2.3e-290
WP_000004347.1|3318702_3319476_-	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	97.7	3.1e-124
WP_000509527.1|3319596_3319932_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	100.0	8.0e-61
WP_001034848.1|3320008_3320554_+	hypothetical protein	NA	S4TR57	Salmonella_phage	100.0	5.0e-97
WP_001283924.1|3320698_3320956_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	3.8e-39
WP_000644477.1|3320952_3321450_-	KilA-N domain-containing protein	NA	S4TSR0	Salmonella_phage	100.0	8.1e-94
WP_001748051.1|3321659_3322118_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	78.8	4.3e-57
WP_001748050.1|3322114_3322612_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	96.4	7.9e-89
WP_000286100.1|3322589_3322793_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047569.1|3323214_3323994_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	95.3	1.2e-128
WP_000196508.1|3324151_3324394_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	93.8	5.8e-37
WP_000337150.1|3324390_3324573_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	98.3	7.2e-24
WP_001185533.1|3324560_3325031_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	95.5	2.2e-88
WP_001089627.1|3325011_3325248_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	94.9	4.3e-37
WP_000950998.1|3325240_3325417_-	protein ninF	NA	K7P6R5	Enterobacteria_phage	93.0	1.4e-24
WP_000924596.1|3325409_3325811_-	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_001254236.1|3325813_3325990_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	94.8	1.9e-26
WP_023993435.1|3325997_3326420_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	99.3	1.1e-78
WP_001291852.1|3326422_3326623_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	98.5	1.4e-28
WP_023993436.1|3326625_3326907_-	hypothetical protein	NA	I6R992	Salmonella_phage	64.2	9.4e-23
WP_023993437.1|3327137_3327410_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	96.6	9.7e-41
WP_023167630.1|3327481_3328858_-	AAA family ATPase	NA	I6R0N4	Salmonella_phage	99.1	6.3e-253
WP_000431305.1|3328854_3329715_-	replication protein	NA	G9L680	Escherichia_phage	65.0	3.6e-89
WP_023167632.1|3329777_3330038_-	hypothetical protein	NA	G9L679	Escherichia_phage	61.7	1.6e-21
WP_000424139.1|3330059_3330350_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	99.0	9.0e-45
WP_001180316.1|3330486_3330714_-	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000250476.1|3330791_3331502_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_000759585.1|3331737_3332757_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	36.0	3.5e-51
WP_000834179.1|3332903_3333113_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	7.2e-28
WP_023233618.1|3333480_3333843_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	88.3	1.1e-52
WP_000843522.1|3333859_3334303_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
WP_023233617.1|3334391_3335024_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	81.1	4.2e-79
WP_000141641.1|3335232_3335391_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.4e-23
WP_000156731.1|3335371_3335560_+	DUF5444 family protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_000902089.1|3335549_3335693_+	hypothetical protein	NA	A0A1R3Y5R4	Salmonella_virus	95.7	1.6e-18
WP_023993438.1|3335689_3336397_+	hypothetical protein	NA	I6R0N0	Salmonella_phage	94.9	9.1e-131
WP_023993439.1|3336396_3336681_+	hypothetical protein	NA	E7C9P9	Salmonella_phage	96.8	2.0e-44
WP_023993440.1|3336727_3337021_+	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	94.8	6.8e-48
WP_023993441.1|3337031_3337202_+	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	98.2	1.8e-24
WP_023993442.1|3337189_3337882_+	HNH endonuclease	NA	C6ZR31	Salmonella_phage	90.7	1.2e-114
WP_023993443.1|3337878_3338280_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.0	1.3e-70
WP_000582224.1|3338593_3339349_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_000509169.1|3340676_3340943_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_001556007.1|3341265_3341484_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3341461_3342532_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3343164:3343177	attR	GAATCCCGGCGGGA	NA	NA	NA	NA
>prophage 8
NZ_CP016406	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 chromosome, complete genome	4727126	4540153	4589897	4727126	transposase,tRNA,plate,tail	Burkholderia_phage(34.78%)	51	NA	NA
WP_023994022.1|4540153_4541140_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001147297.1|4541215_4542295_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
WP_000918353.1|4542326_4543742_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235550.1|4543806_4544790_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891414.1|4544964_4545207_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_001182224.1|4545374_4546373_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039342.1|4546460_4547771_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4548017_4548533_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4548631_4548841_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4548862_4548976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128112.1|4548972_4550298_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4550476_4551085_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4551193_4551562_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4551732_4554153_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4554251_4555124_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4555137_4555635_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4555815_4556733_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4556896_4558255_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4558343_4559453_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4559814_4561005_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4561136_4562681_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4562695_4563586_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4563751_4564162_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4564304_4566401_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023993545.1|4566400_4567135_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4567131_4567800_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_023994532.1|4567833_4568076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790024.1|4568519_4570169_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4570513_4571863_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4571993_4572341_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4572917_4573205_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_023993546.1|4573207_4573813_+	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	5.5e-60
WP_000777266.1|4573825_4574140_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_023993547.1|4574299_4574755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023993548.1|4574751_4574949_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	50.0	1.3e-07
WP_023993549.1|4574938_4576366_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
WP_000907494.1|4576365_4576890_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001600578.1|4576941_4577259_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001728452.1|4577218_4577347_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023993550.1|4577443_4579798_+|tail	tail protein	tail	A4JWL0	Burkholderia_virus	30.4	4.4e-65
WP_000271425.1|4579797_4580751_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_023993551.1|4580750_4580960_+|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	2.2e-16
WP_000818147.1|4580947_4581991_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.9e-76
WP_000679393.1|4582000_4582723_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4583050_4583413_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703634.1|4583409_4584339_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_058649929.1|4584338_4585886_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_001093501.1|4586049_4586409_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_023993552.1|4586399_4587515_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_023993553.1|4587507_4588140_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_023994534.1|4588142_4589897_+|tail	tail fiber protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	4.2e-52
>prophage 1
NZ_CP016407	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence	323122	83028	160098	323122	transposase,integrase	Tupanvirus(13.33%)	40	148935:148949	165938:165952
WP_088348988.1|83028_84127_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
WP_020833646.1|84985_86101_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_020833650.1|90380_91208_-	streptomycin 3''-kinase	NA	NA	NA	NA	NA
WP_020833651.1|91344_91530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110613438.1|92529_92829_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020833652.1|92765_93980_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_020833653.1|94008_95307_-	transporter	NA	NA	NA	NA	NA
WP_020833654.1|95420_96617_-	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	28.4	9.3e-27
WP_024143068.1|97501_97759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833656.1|98257_99046_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.2	2.8e-08
WP_020833657.1|99381_101403_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_020833658.1|101533_103111_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	A0A2K9KZV5	Tupanvirus	22.8	2.0e-08
WP_023994194.1|103114_103918_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_023994193.1|103914_105015_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_020833661.1|105011_114509_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_020833662.1|114596_120704_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9KZV5	Tupanvirus	28.2	3.4e-40
WP_020833663.1|120894_121854_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_020833664.1|122311_124024_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	27.4	2.8e-32
WP_023994191.1|124010_125813_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.1	2.7e-22
WP_020833666.1|125805_127086_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_020833667.1|127113_128445_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_020833668.1|129102_129402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833669.1|129636_131124_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_020833670.1|131208_132069_+	alpha/beta fold hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.8	5.9e-07
WP_077914832.1|133150_133441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994189.1|133443_134457_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	36.7	4.4e-46
WP_139142178.1|134882_135011_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_139142176.1|134974_135142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023994187.1|136553_136856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049885068.1|139361_140750_-	MFS transporter	NA	NA	NA	NA	NA
WP_023994181.1|141077_141446_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_023994180.1|141944_142970_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_023994221.1|144377_145355_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	59.9	3.7e-74
WP_023994222.1|145804_147142_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_023994223.1|147380_148454_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_058649965.1|148772_151040_-	arginine decarboxylase	NA	NA	NA	NA	NA
148935:148949	attL	AGGAATTCCCGGCGG	NA	NA	NA	NA
WP_023994225.1|152726_153035_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	68.6	9.6e-29
WP_078024491.1|155166_156018_+	3'-5' exoribonuclease	NA	K7RFY5	Vibrio_phage	37.3	4.3e-26
WP_001067855.1|158259_158964_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|159084_160098_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
165938:165952	attR	AGGAATTCCCGGCGG	NA	NA	NA	NA
>prophage 2
NZ_CP016407	Salmonella enterica subsp. enterica serovar Infantis strain FSIS1502169 plasmid pFSIS1502169, complete sequence	323122	236046	283685	323122	transposase,integrase	Escherichia_phage(31.58%)	52	229457:229471	272991:273005
229457:229471	attL	ATTTTGCTCTGATTT	NA	NA	NA	NA
WP_000038334.1|236046_236961_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.7e-66
WP_001247862.1|237025_237292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|237384_237819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000117627.1|238547_239048_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.1	1.9e-05
WP_000978005.1|239510_240107_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	60.3	6.9e-15
WP_001276261.1|240103_240823_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845898.1|240819_241254_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_058649951.1|241308_243267_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	1.6e-20
WP_000006024.1|243325_243559_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.3	3.3e-05
WP_001276125.1|243616_244144_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_001027516.1|244914_245106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271741.1|245102_245525_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001198941.1|245571_245997_-	antirestriction protein	NA	NA	NA	NA	NA
WP_072686770.1|245969_246542_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_000274421.1|247229_247664_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|247677_247899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086137.1|247899_248583_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.3e-30
WP_001330417.1|248967_249870_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000618110.1|250287_250536_+	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|250532_250970_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457496.1|250969_252241_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000340829.1|252245_252638_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_001103690.1|252642_253614_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|253842_254487_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|254480_254756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249540.1|254893_255679_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	2.6e-54
WP_000535297.1|255723_256503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302628.1|256555_256870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|257550_258546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|258549_259482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952231.1|259779_260868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000253407.1|260869_261739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741348.1|261795_263361_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001261287.1|263668_263899_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|263895_264312_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_075322282.1|264473_266612_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000343085.1|266965_267223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|267222_267813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058649952.1|268075_269632_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000521603.1|269822_270440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502555.1|270732_271770_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|271874_272198_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024159726.1|272298_273009_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	3.1e-94
272991:273005	attR	AAATCAGAGCAAAAT	NA	NA	NA	NA
WP_001286342.1|273017_273563_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011117603.1|273638_274001_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_023171140.1|274027_275779_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_011117601.1|275852_276221_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|276407_277112_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001067858.1|277693_278398_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_013188475.1|279351_280227_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|280261_281230_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|282980_283685_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
