The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	11457	47480	4727085	portal,tail,head,integrase,terminase,lysis,capsid,holin,plate	Escherichia_phage(54.55%)	48	11300:11346	42855:42901
11300:11346	attL	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_000468308.1|11457_11676_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001598749.1|11757_12921_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	1.4e-205
WP_000978896.1|12920_13400_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_023993657.1|13414_15862_-|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	96.8	0.0e+00
WP_000785970.1|15854_15974_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|16006_16282_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|16338_16857_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286698.1|16869_18060_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.7	3.7e-225
WP_023993658.1|18119_18713_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	96.4	3.9e-103
WP_075323717.1|18740_19139_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	38.3	1.6e-12
WP_006673257.1|19141_19582_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.3	1.2e-51
WP_006673255.1|19553_20156_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.0	6.6e-98
WP_023993680.1|21481_22093_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	98.5	2.4e-116
WP_023993681.1|22085_22994_-|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.3	1.7e-161
WP_001389961.1|22998_23346_-	lysozyme family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001093731.1|23342_23978_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.5e-111
WP_023993682.1|24044_24497_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	5.9e-75
WP_000917182.1|24489_24957_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	99.4	1.9e-81
WP_001440152.1|24919_25093_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_023993683.1|25064_25490_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	6.1e-66
WP_023993684.1|25477_25903_-	hypothetical protein	NA	M1SV74	Escherichia_phage	98.6	5.5e-59
WP_001144101.1|25917_26415_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|26414_26696_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|26699_26903_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988636.1|26902_27412_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203461.1|27511_28255_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.4	8.6e-124
WP_016237184.1|28258_29332_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.7	5.1e-202
WP_023993685.1|29390_30245_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	99.6	6.4e-139
WP_023993686.1|30418_32191_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001620981.1|32190_33225_+|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.4	2.4e-201
WP_001161722.1|33651_34593_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	73.7	2.0e-133
WP_001389947.1|34675_35158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119270.1|35341_35827_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	37.1	6.0e-09
WP_001598736.1|36963_39240_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.3	0.0e+00
WP_000027673.1|39229_39505_-	hypothetical protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113277.1|39501_39726_-	hypothetical protein	NA	S4TRY6	Salmonella_phage	98.6	6.5e-35
WP_001277898.1|39728_40028_-	hypothetical protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_000557703.1|40027_40252_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|40315_40816_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_001308179.1|40985_41258_-	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000777029.1|41394_41688_+	helix-turn-helix domain-containing protein	NA	Q1JS37	Enterobacteria_phage	100.0	2.7e-49
WP_000985246.1|41757_42738_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	100.0	4.7e-186
WP_001233463.1|42923_43424_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
42855:42901	attR	GATAAAAAAAACCCCCACATCATGTGGGGGAAGACAGGGATGGTGTC	NA	NA	NA	NA
WP_001033731.1|43574_44273_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580402.1|44269_45643_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	7.2e-15
WP_000133440.1|45693_46089_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_011233226.1|46100_46853_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000122632.1|46859_47480_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	2.4e-63
>prophage 2
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	1115383	1121832	4727085	tRNA,integrase	uncultured_Caudovirales_phage(33.33%)	7	1108426:1108437	1121098:1121109
1108426:1108437	attL	TTAACTTATTGA	NA	NA	NA	NA
WP_010989230.1|1115383_1116481_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003339.1|1116491_1118009_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	4.8e-89
WP_023218751.1|1118084_1118630_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_000244328.1|1118894_1119653_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
WP_023993954.1|1119970_1121074_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	57.5	1.2e-118
WP_023993955.1|1121228_1121579_+	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	51.9	1.1e-23
1121098:1121109	attR	TCAATAAGTTAA	NA	NA	NA	NA
WP_023993956.1|1121658_1121832_+	arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	67.9	5.8e-15
>prophage 3
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	1414075	1423051	4727085	integrase	Enterobacteria_phage(83.33%)	11	1418844:1418859	1425666:1425681
WP_023993982.1|1414075_1416409_-	bacteriophage P4 DNA primase	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
WP_023993983.1|1416423_1416744_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001216603.1|1416740_1416968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015701354.1|1416964_1417516_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_014344397.1|1418115_1418391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000149860.1|1418316_1419054_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	64.4	9.0e-81
1418844:1418859	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_000984209.1|1419050_1419293_+	transcriptional regulator	NA	Q7M294	Enterobacteria_phage	77.8	5.2e-30
WP_023993984.1|1419309_1419876_+	bacteriophage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	1.2e-56
WP_071737793.1|1419839_1420025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001604631.1|1420408_1421818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001604633.1|1421854_1423051_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.0	4.1e-107
1425666:1425681	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
>prophage 4
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	1714968	1748816	4727085	portal,protease,lysis,coat	Salmonella_phage(68.52%)	54	NA	NA
WP_023993447.1|1714968_1715172_-	transcriptional regulator	NA	I6RSG8	Salmonella_phage	95.5	6.1e-32
WP_023993446.1|1715330_1715603_-	hypothetical protein	NA	A0A2H4FNB3	Salmonella_phage	98.9	2.6e-38
WP_000582224.1|1716301_1717057_-	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_023993444.1|1717056_1717374_-	hypothetical protein	NA	I6RSM9	Salmonella_phage	87.9	8.1e-23
WP_023993443.1|1717370_1717772_-	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.0	1.3e-70
WP_023993442.1|1717768_1718461_-	HNH endonuclease	NA	C6ZR31	Salmonella_phage	90.7	1.2e-114
WP_023993441.1|1718448_1718619_-	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	98.2	1.8e-24
WP_023993440.1|1718629_1718923_-	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	94.8	6.8e-48
WP_023993439.1|1718969_1719254_-	hypothetical protein	NA	E7C9P9	Salmonella_phage	96.8	2.0e-44
WP_023993438.1|1719253_1719961_-	hypothetical protein	NA	I6R0N0	Salmonella_phage	94.9	9.1e-131
WP_000156731.1|1720090_1720279_-	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_001539176.1|1720259_1720433_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
WP_001748038.1|1720750_1721029_-	hypothetical protein	NA	C6ZR42	Salmonella_phage	100.0	1.3e-45
WP_075322247.1|1721062_1721782_-	pentapeptide repeat-containing protein	NA	Q76H35	Enterobacteria_phage	88.3	2.2e-44
WP_058649971.1|1721985_1722519_-	HNH endonuclease	NA	A0A2H4FNF1	Salmonella_phage	97.2	9.0e-99
WP_000947484.1|1722619_1723036_-	HNH endonuclease	NA	Q5G8U2	Enterobacteria_phage	40.3	1.2e-21
WP_000935320.1|1723347_1724100_-	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	63.8	7.8e-72
WP_001058406.1|1724140_1724374_+	hypothetical protein	NA	A0A0P0ZDD7	Stx2-converting_phage	67.5	5.6e-21
WP_000189606.1|1724524_1724821_+	hypothetical protein	NA	Q9MCQ0	Enterobacteria_phage	100.0	1.8e-48
WP_001125981.1|1724853_1725000_+	DUF2740 domain-containing protein	NA	A0A075B8K7	Enterobacteria_phage	100.0	1.5e-19
WP_075322246.1|1724992_1725826_+	replication protein	NA	A0A1R3Y5R9	Salmonella_virus	98.9	2.1e-150
WP_023167630.1|1725822_1727199_+	AAA family ATPase	NA	I6R0N4	Salmonella_phage	99.1	6.3e-253
WP_023993437.1|1727270_1727543_+	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	96.6	9.7e-41
WP_000987937.1|1727552_1727762_+	hypothetical protein	NA	A0A1R3Y5S8	Salmonella_virus	97.1	2.6e-30
WP_023993436.1|1727773_1728055_+	hypothetical protein	NA	I6R992	Salmonella_phage	64.2	9.4e-23
WP_001291852.1|1728057_1728258_+	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	98.5	1.4e-28
WP_023993435.1|1728260_1728683_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	99.3	1.1e-78
WP_001254236.1|1728690_1728867_+	NinE family protein	NA	A0A220NRK6	Escherichia_phage	94.8	1.9e-26
WP_000924596.1|1728869_1729271_+	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_000950998.1|1729263_1729440_+	protein ninF	NA	K7P6R5	Enterobacteria_phage	93.0	1.4e-24
WP_001089628.1|1729432_1729669_+	hypothetical protein	NA	C6ZR59	Salmonella_phage	93.6	1.3e-36
WP_001185533.1|1729649_1730120_+	hypothetical protein	NA	C6ZR60	Salmonella_phage	95.5	2.2e-88
WP_000337150.1|1730107_1730290_+	hypothetical protein	NA	C6ZR61	Salmonella_phage	98.3	7.2e-24
WP_000196508.1|1730286_1730529_+	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	93.8	5.8e-37
WP_001047569.1|1730686_1731466_+	antitermination protein	NA	Q76H66	Enterobacteria_phage	95.3	1.2e-128
WP_000286100.1|1731887_1732091_+	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001748050.1|1732068_1732566_+	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	96.4	7.9e-89
WP_001748051.1|1732562_1733021_+|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	78.8	4.3e-57
WP_023994441.1|1733230_1733752_+	DNA-binding protein	NA	H6WRZ8	Salmonella_phage	98.3	1.8e-99
WP_023217190.1|1734225_1734468_+	DUF2560 family protein	NA	A0A1R3Y5V5	Salmonella_virus	98.8	1.9e-35
WP_058649961.1|1734470_1734875_+	hypothetical protein	NA	C6ZR73	Salmonella_phage	98.5	3.4e-66
WP_000729924.1|1734878_1735367_+	hypothetical protein	NA	A8CGG1	Salmonella_phage	100.0	2.9e-88
WP_017441431.1|1735344_1736844_+	DNA packaging protein	NA	A0A0M4S5Z3	Salmonella_phage	99.6	3.1e-306
WP_017441432.1|1736843_1739021_+|portal	portal protein	portal	I6R968	Salmonella_phage	98.2	0.0e+00
WP_017441433.1|1739034_1739946_+	scaffold protein	NA	A0A1R3Y5R6	Salmonella_virus	99.7	1.1e-160
WP_020899473.1|1739945_1741238_+|coat	coat protein	coat	C6ZR10	Salmonella_phage	99.3	3.2e-243
WP_000538675.1|1741278_1741839_+	hypothetical protein	NA	I6S1J7	Salmonella_phage	98.4	7.0e-102
WP_010835893.1|1741822_1742323_+	Packaged DNA stabilization protein gp4	NA	I1TEJ0	Salmonella_phage	100.0	3.2e-90
WP_023198766.1|1742282_1743701_+	hypothetical protein	NA	I1TEJ1	Salmonella_phage	98.9	1.5e-273
WP_023198767.1|1743704_1744406_+	hypothetical protein	NA	C6ZR14	Salmonella_phage	93.1	4.0e-70
WP_017441438.1|1744405_1744867_+	DUF2824 family protein	NA	C6ZR15	Salmonella_phage	84.9	4.3e-73
WP_023198768.1|1744869_1745559_+	hypothetical protein	NA	B9UDK9	Salmonella_phage	89.8	1.9e-88
WP_058649962.1|1745601_1746924_+	DNA transfer protein	NA	A0A220NR03	Salmonella_phage	97.0	3.1e-233
WP_001029862.1|1746923_1748816_+	hypothetical protein	NA	E7C9U6	Salmonella_phage	78.3	5.1e-245
>prophage 5
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	1876183	1883496	4727085	protease,integrase	Dickeya_phage(16.67%)	7	1877434:1877448	1888688:1888702
WP_001201750.1|1876183_1877302_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	1.4e-08
WP_023993622.1|1877298_1879245_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	42.3	9.1e-40
1877434:1877448	attL	GGAAAATCAACGCTG	NA	NA	NA	NA
WP_000447499.1|1879374_1879596_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520789.1|1879919_1880240_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|1880270_1882547_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_001117984.1|1882759_1882957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993623.1|1883118_1883496_-|integrase	integrase	integrase	A0A077KET4	Ralstonia_phage	40.2	1.0e-19
1888688:1888702	attR	CAGCGTTGATTTTCC	NA	NA	NA	NA
>prophage 6
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	2887425	2898024	4727085	protease	Morganella_phage(25.0%)	12	NA	NA
WP_023993342.1|2887425_2888856_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_023993343.1|2888929_2889625_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.0	3.6e-07
WP_000107435.1|2889704_2890016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993344.1|2890664_2891861_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.6	4.3e-109
WP_024131109.1|2892119_2892308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208509.1|2892318_2892531_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_023993345.1|2892985_2894254_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	9.3e-227
WP_000394197.1|2894256_2894676_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_001529333.1|2894802_2894964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598920.1|2895444_2896242_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_001736108.1|2896613_2896904_+	DUF4102 domain-containing protein	NA	B7SYF8	Stenotrophomonas_phage	49.1	3.0e-08
WP_023993346.1|2897550_2898024_+|protease	protease	protease	A0A0F6TJ61	Escherichia_coli_O157_typing_phage	76.6	2.1e-38
>prophage 7
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	3053082	3062253	4727085	tRNA	Enterobacteria_phage(71.43%)	10	NA	NA
WP_000195340.1|3053082_3055116_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	26.9	6.1e-55
WP_000703137.1|3055356_3055815_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_023993390.1|3055986_3056517_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	31.7	2.8e-15
WP_000950413.1|3056573_3057041_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|3057087_3057807_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000272850.1|3057803_3059489_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_001240418.1|3059711_3060443_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_023993392.1|3060502_3060610_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|3060590_3061322_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|3061305_3062253_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	3.7e-10
>prophage 8
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	3274226	3348741	4727085	tRNA,portal,integrase,head,tail,terminase,lysis,capsid,protease	Salmonella_phage(68.0%)	98	3272635:3272648	3349373:3349386
3272635:3272648	attL	GAATCCCGGCGGGA	NA	NA	NA	NA
WP_000016631.1|3274226_3275039_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289141.1|3275038_3276052_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699176.1|3276119_3277256_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.1	3.8e-22
WP_000553395.1|3277359_3278361_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127721.1|3278357_3279536_-	MFS transporter	NA	NA	NA	NA	NA
WP_001051261.1|3279715_3280090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000433425.1|3280262_3280511_+	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	60.0	6.2e-18
WP_000118256.1|3280679_3281048_+	hypothetical protein	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
WP_000847535.1|3281047_3281566_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_001142900.1|3281632_3282289_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000817161.1|3282386_3283601_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_076693829.1|3283700_3285761_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559749.1|3285812_3286088_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001066345.1|3286120_3286669_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_023993416.1|3286668_3287478_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_000750429.1|3287477_3288302_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_000918457.1|3288305_3289391_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
WP_001650203.1|3289426_3290359_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730794.1|3290524_3291076_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001195808.1|3291175_3291661_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_023993417.1|3291878_3294017_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_023993418.1|3294016_3295327_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_000030904.1|3295504_3295789_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_000245434.1|3296153_3297467_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776787.1|3297527_3298283_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_023993419.1|3298571_3299513_+	hypothetical protein	NA	E7DYY8	Enterobacteria_phage	87.8	1.3e-145
WP_023993420.1|3299826_3300996_+|integrase	tyrosine-type recombinase/integrase	integrase	I6R0M2	Salmonella_phage	98.7	1.5e-226
WP_023993421.1|3301067_3302366_-	hypothetical protein	NA	A0A1V0E5M2	Salmonella_phage	96.8	7.5e-240
WP_023993422.1|3302376_3303336_-	hypothetical protein	NA	H6WRW5	Salmonella_phage	99.4	3.6e-183
WP_023993423.1|3303344_3306065_-	DUF1983 domain-containing protein	NA	S4TTF5	Salmonella_phage	96.0	0.0e+00
WP_023993424.1|3306064_3306463_-	hypothetical protein	NA	S4TR39	Salmonella_phage	94.7	2.9e-70
WP_023993425.1|3306469_3307054_-	hypothetical protein	NA	S4TND4	Salmonella_phage	97.4	1.1e-105
WP_023993426.1|3307053_3307647_-	hypothetical protein	NA	S4TSP7	Salmonella_phage	95.4	1.2e-107
WP_023993427.1|3307812_3308061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023993428.1|3308163_3311502_-|tail	phage tail tape measure protein	tail	K7P7L6	Enterobacteria_phage	69.5	0.0e+00
WP_023993429.1|3311560_3311902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023993430.1|3311956_3312235_-	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	88.0	6.0e-38
WP_023993431.1|3312243_3312633_-|tail	phage tail assembly protein	tail	K7PKV6	Enterobacterial_phage	85.3	7.3e-58
WP_023993432.1|3312660_3313365_-|tail	prophage major tail protein	tail	K7PHL2	Enterobacterial_phage	75.6	6.7e-94
WP_000133673.1|3313422_3313770_-	DUF3168 domain-containing protein	NA	S4TTG3	Salmonella_phage	78.8	7.5e-46
WP_000573485.1|3313766_3314216_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	98.7	7.6e-75
WP_001007886.1|3314212_3314563_-|head	phage head closure protein	head	S4TND9	Salmonella_phage	87.9	1.1e-49
WP_000571722.1|3314571_3314898_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S4TSQ3	Salmonella_phage	99.1	1.8e-54
WP_001005702.1|3314894_3315938_-	hypothetical protein	NA	S4TNN1	Salmonella_phage	100.0	2.0e-134
WP_000267319.1|3315934_3317290_-|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	100.0	2.8e-261
WP_023242805.1|3317494_3319429_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	99.7	0.0e+00
WP_024134503.1|3319487_3321149_-|terminase	terminase large subunit	terminase	S4TSQ6	Salmonella_phage	99.6	0.0e+00
WP_000954404.1|3321145_3321640_-|terminase	terminase small subunit	terminase	S4TNN3	Salmonella_phage	100.0	1.7e-83
WP_001096739.1|3321950_3322316_-	HNH endonuclease	NA	S4TTG9	Salmonella_phage	82.9	4.3e-52
WP_000983798.1|3322308_3322902_-	hypothetical protein	NA	S4TR53	Salmonella_phage	96.9	1.2e-112
WP_001124954.1|3322882_3323401_-	HNH endonuclease	NA	K7PJS8	Enterobacterial_phage	54.3	1.3e-46
WP_023993433.1|3323444_3324902_-	glycosyltransferase family 2 protein	NA	S4TSQ9	Salmonella_phage	99.6	2.3e-290
WP_000004347.1|3324911_3325685_-	DUF1983 domain-containing protein	NA	S4TNN5	Salmonella_phage	97.7	3.1e-124
WP_000509527.1|3325805_3326141_-	hypothetical protein	NA	S4TTH3	Salmonella_phage	100.0	8.0e-61
WP_001034848.1|3326217_3326763_+	hypothetical protein	NA	S4TR57	Salmonella_phage	100.0	5.0e-97
WP_001283924.1|3326907_3327165_-	hypothetical protein	NA	A0A1V0E5Q1	Salmonella_phage	100.0	3.8e-39
WP_000644477.1|3327161_3327659_-	DNA-binding protein	NA	S4TSR0	Salmonella_phage	100.0	8.1e-94
WP_001748051.1|3327868_3328327_-|lysis	lysis protein	lysis	A0A2L1IV55	Escherichia_phage	78.8	4.3e-57
WP_001748050.1|3328323_3328821_-	lysozyme	NA	A0A1R3Y5W5	Salmonella_virus	96.4	7.9e-89
WP_000286100.1|3328798_3329002_-	hypothetical protein	NA	I6R0S9	Salmonella_phage	100.0	1.1e-33
WP_001047569.1|3329423_3330203_-	antitermination protein	NA	Q76H66	Enterobacteria_phage	95.3	1.2e-128
WP_000196508.1|3330360_3330603_-	hypothetical protein	NA	A0A1V0E5R3	Salmonella_phage	93.8	5.8e-37
WP_000337150.1|3330599_3330782_-	hypothetical protein	NA	C6ZR61	Salmonella_phage	98.3	7.2e-24
WP_001185533.1|3330769_3331240_-	hypothetical protein	NA	C6ZR60	Salmonella_phage	95.5	2.2e-88
WP_001089627.1|3331220_3331457_-	hypothetical protein	NA	C6ZR59	Salmonella_phage	94.9	4.3e-37
WP_000950998.1|3331449_3331626_-	protein ninF	NA	K7P6R5	Enterobacteria_phage	93.0	1.4e-24
WP_000924596.1|3331618_3332020_-	hypothetical protein	NA	G9L690	Escherichia_phage	86.5	7.1e-64
WP_001254236.1|3332022_3332199_-	NinE family protein	NA	A0A220NRK6	Escherichia_phage	94.8	1.9e-26
WP_023993435.1|3332206_3332629_-	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	99.3	1.1e-78
WP_001291852.1|3332631_3332832_-	hypothetical protein	NA	A0A2H4FUS3	Salmonella_phage	98.5	1.4e-28
WP_023993436.1|3332834_3333116_-	hypothetical protein	NA	I6R992	Salmonella_phage	64.2	9.4e-23
WP_000987937.1|3333127_3333337_-	hypothetical protein	NA	A0A1R3Y5S8	Salmonella_virus	97.1	2.6e-30
WP_023993437.1|3333346_3333619_-	DUF4752 family protein	NA	A0A220NQX8	Salmonella_phage	96.6	9.7e-41
WP_023167630.1|3333690_3335067_-	AAA family ATPase	NA	I6R0N4	Salmonella_phage	99.1	6.3e-253
WP_000431305.1|3335063_3335924_-	replication protein	NA	G9L680	Escherichia_phage	65.0	3.6e-89
WP_023167632.1|3335986_3336247_-	hypothetical protein	NA	G9L679	Escherichia_phage	61.7	1.6e-21
WP_000424139.1|3336268_3336559_-	hypothetical protein	NA	I6RSP4	Salmonella_phage	99.0	9.0e-45
WP_001180316.1|3336695_3336923_-	transcriptional regulator	NA	G9L677	Escherichia_phage	89.3	2.1e-33
WP_000250476.1|3337000_3337711_+	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	87.7	4.0e-118
WP_000759585.1|3337946_3338966_+	ParA family protein	NA	H2BD62	Pseudomonas_phage	36.0	3.5e-51
WP_000834179.1|3339112_3339322_-	fumarate hydratase FumD	NA	I6R0R9	Salmonella_phage	91.3	7.2e-28
WP_023233618.1|3339689_3340052_+	hypothetical protein	NA	C6ZR44	Salmonella_phage	88.3	1.1e-52
WP_000843522.1|3340068_3340512_+	hypothetical protein	NA	E5AGE5	Erwinia_phage	62.6	3.0e-47
WP_023233617.1|3340600_3341233_+	hypothetical protein	NA	A0A2H4FRY7	Salmonella_phage	81.1	4.2e-79
WP_001539176.1|3341426_3341600_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q76H38	Enterobacteria_phage	100.0	2.6e-23
WP_000156731.1|3341580_3341769_+	hypothetical protein	NA	I6S647	Salmonella_phage	100.0	3.7e-31
WP_023993438.1|3341898_3342606_+	hypothetical protein	NA	I6R0N0	Salmonella_phage	94.9	9.1e-131
WP_023993439.1|3342605_3342890_+	hypothetical protein	NA	E7C9P9	Salmonella_phage	96.8	2.0e-44
WP_023993440.1|3342936_3343230_+	DUF2856 family protein	NA	A0A0N7CAQ6	Salmonella_phage	94.8	6.8e-48
WP_023993441.1|3343240_3343411_+	DUF2737 family protein	NA	A0A0N7CAQ8	Salmonella_phage	98.2	1.8e-24
WP_023993442.1|3343398_3344091_+	HNH endonuclease	NA	C6ZR31	Salmonella_phage	90.7	1.2e-114
WP_023993443.1|3344087_3344489_+	ParB/RepB/Spo0J family partition protein	NA	S4TTI6	Salmonella_phage	97.0	1.3e-70
WP_023993444.1|3344485_3344803_+	hypothetical protein	NA	I6RSM9	Salmonella_phage	87.9	8.1e-23
WP_000582224.1|3344802_3345558_+	hypothetical protein	NA	H6WRY1	Salmonella_phage	99.6	4.2e-150
WP_024133264.1|3346569_3346755_+	hypothetical protein	NA	A0A1V0E5M0	Salmonella_phage	100.0	2.6e-29
WP_000509169.1|3346885_3347152_+	hypothetical protein	NA	A0A1V0E5L9	Salmonella_phage	97.7	3.7e-45
WP_001556007.1|3347474_3347693_+	excisionase	NA	A0A1V0E5M4	Salmonella_phage	100.0	5.7e-36
WP_000533679.1|3347670_3348741_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E5M7	Salmonella_phage	100.0	1.0e-154
3349373:3349386	attR	GAATCCCGGCGGGA	NA	NA	NA	NA
>prophage 9
NZ_CP016412	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454, complete genome	4727085	4546318	4596062	4727085	transposase,tRNA,tail,plate	Burkholderia_phage(34.78%)	51	NA	NA
WP_023994022.1|4546318_4547305_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001147297.1|4547380_4548460_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.1	1.2e-28
WP_000918353.1|4548491_4549907_-	replicative DNA helicase DnaB	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_000235550.1|4549971_4550955_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891414.1|4551129_4551372_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_001182224.1|4551539_4552538_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039342.1|4552625_4553936_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4554182_4554698_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4554796_4555006_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4555027_4555141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128112.1|4555137_4556463_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4556641_4557250_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4557358_4557727_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4557897_4560318_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4560416_4561289_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019219.1|4561302_4561800_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000782497.1|4561980_4562898_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973678.1|4563061_4564420_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4564508_4565618_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4565979_4567170_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382573.1|4567301_4568846_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252085.1|4568860_4569751_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4569916_4570327_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750804.1|4570469_4572566_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_023993545.1|4572565_4573300_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_122821798.1|4573296_4573965_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_023994532.1|4573998_4574241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000790024.1|4574684_4576334_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136400.1|4576678_4578028_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4578158_4578506_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4579082_4579370_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_023993546.1|4579372_4579978_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.4	5.5e-60
WP_000777266.1|4579990_4580305_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.1	6.4e-20
WP_023993547.1|4580464_4580920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023993548.1|4580916_4581114_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	50.0	1.3e-07
WP_023993549.1|4581103_4582531_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	3.1e-194
WP_000907494.1|4582530_4583055_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001600578.1|4583106_4583424_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001728452.1|4583383_4583512_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_023993550.1|4583608_4585963_+|tail	tail protein	tail	A4JWL0	Burkholderia_virus	30.4	4.4e-65
WP_000271425.1|4585962_4586916_+	chemotaxis protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_023993551.1|4586915_4587125_+	phage Tail protein X	NA	A4JWL2	Burkholderia_virus	60.3	2.2e-16
WP_000818147.1|4587112_4588156_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	1.9e-76
WP_000679393.1|4588165_4588888_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593182.1|4589215_4589578_+	GtrA family protein	NA	I1TED9	Salmonella_phage	70.8	1.2e-43
WP_000703634.1|4589574_4590504_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	83.8	6.7e-150
WP_058649929.1|4590503_4592051_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	29.9	2.5e-48
WP_001093501.1|4592214_4592574_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_023993552.1|4592564_4593680_+	hypothetical protein	NA	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_023993553.1|4593672_4594305_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	8.6e-24
WP_023994534.1|4594307_4596062_+|tail	tail protein	tail	A0A0M3ULF6	Salmonella_phage	52.2	4.2e-52
>prophage 1
NZ_CP016413	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence	316160	10017	174111	316160	transposase,integrase	Escherichia_phage(16.67%)	116	NA	NA
WP_031619582.1|10017_11055_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_023994179.1|14530_14788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994178.1|14788_15121_+	mRNA interferase PemK	NA	NA	NA	NA	NA
WP_110613430.1|15353_15548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994175.1|16624_18847_-	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_023994174.1|18843_20160_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_023994173.1|20163_22473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023994171.1|23155_24181_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_023994170.1|24430_24598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023994169.1|24584_24914_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_031619580.1|25859_26147_+	damage-inducible protein J	NA	NA	NA	NA	NA
WP_023994167.1|26143_26449_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_023994164.1|27487_27823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994163.1|28044_28323_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_001195098.1|28610_28895_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_023994162.1|28885_29368_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_023994160.1|30425_30635_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_023994156.1|32262_32505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994155.1|32575_33532_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.0	1.0e-68
WP_072205048.1|33575_33803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994153.1|33844_34096_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023994152.1|34451_35660_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	90.5	2.0e-202
WP_031619575.1|38203_38524_+	AFA-III adhesin operon regulatory protein	NA	NA	NA	NA	NA
WP_023994146.1|38568_39108_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000988791.1|41578_42373_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_023994144.1|42408_42900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994143.1|43124_43949_+	fimbrial protein FaeG	NA	NA	NA	NA	NA
WP_023994142.1|44109_44901_+	F4 (K88) fimbria minor subunit FaeH	NA	NA	NA	NA	NA
WP_023994141.1|44928_45693_+	minor fimbrial protein	NA	NA	NA	NA	NA
WP_023994140.1|45895_46486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994139.1|46551_46764_+	PefI	NA	NA	NA	NA	NA
WP_023994138.1|47211_48060_+	YjiK family protein	NA	NA	NA	NA	NA
WP_071790428.1|48134_48422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023994137.1|48629_49046_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_023994136.1|49042_49273_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023994135.1|49896_50115_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_023994134.1|50116_50422_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_023994133.1|50423_50714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994130.1|53159_53696_+	fimbrial protein	NA	NA	NA	NA	NA
WP_077914829.1|53817_54480_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_023994128.1|54520_57073_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_023994127.1|57229_58279_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_139142174.1|58980_59310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071790432.1|63634_63706_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023994122.1|65397_65823_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_038993359.1|65819_66539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994119.1|66973_67534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077914828.1|67617_68907_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_031619570.1|68909_71012_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	23.4	7.6e-16
WP_020833636.1|74521_74884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000744305.1|75012_75450_+	CaiF/GrlA family transcriptional regulator	NA	NA	NA	NA	NA
WP_058649916.1|75948_76362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145925739.1|76506_81840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833643.1|81956_82715_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_088348988.1|83028_84127_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
WP_020833646.1|84985_86101_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_077914833.1|87655_87982_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	39.4	5.8e-16
WP_077914830.1|87947_88409_-|transposase	transposase	transposase	U5N3V8	Enterobacteria_phage	30.5	4.1e-07
WP_020833650.1|90380_91208_-	streptomycin 3''-kinase	NA	NA	NA	NA	NA
WP_024143067.1|92254_92470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_110613438.1|92529_92829_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020833652.1|92765_93980_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_020833653.1|94008_95307_-	transporter	NA	NA	NA	NA	NA
WP_020833654.1|95420_96617_-	methionine gamma-lyase	NA	A0A0B5JD48	Pandoravirus	28.4	9.3e-27
WP_024143068.1|97501_97759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833656.1|98257_99046_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.2	2.8e-08
WP_020833657.1|99381_101403_-	siderophore yersiniabactin receptor FyuA	NA	NA	NA	NA	NA
WP_020833658.1|101533_103111_-	yersiniabactin biosynthesis salycil-AMP ligase YbtE	NA	A0A2K9KZV5	Tupanvirus	22.8	2.0e-08
WP_023994194.1|103114_103918_-	yersiniabactin biosynthesis thioesterase YbtT	NA	NA	NA	NA	NA
WP_023994193.1|103914_105015_-	yersiniabactin biosynthesis oxidoreductase YbtU	NA	NA	NA	NA	NA
WP_020833661.1|105011_114509_-	yersiniabactin polyketide synthase HMWP1	NA	D0R7J2	Paenibacillus_phage	36.8	1.6e-49
WP_020833662.1|114596_120704_-	yersiniabactin non-ribosomal peptide synthetase HMWP2	NA	A0A2K9KZV5	Tupanvirus	28.2	3.4e-40
WP_020833663.1|120894_121854_-	yersiniabactin transcriptional regulator YbtA	NA	NA	NA	NA	NA
WP_023994192.1|122221_124024_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtP	NA	W8CYL7	Bacillus_phage	28.0	1.7e-32
WP_023994191.1|124010_125813_+	yersiniabactin ABC transporter ATP-binding/permease protein YbtQ	NA	W8CYL7	Bacillus_phage	26.1	2.7e-22
WP_020833666.1|125805_127086_+	yersiniabactin-associated zinc MFS transporter YbtX	NA	NA	NA	NA	NA
WP_020833667.1|127113_128445_+	yersiniabactin biosynthesis salicylate synthase YbtS	NA	NA	NA	NA	NA
WP_020833668.1|129102_129402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833669.1|129636_131124_+	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_020833670.1|131208_132069_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	21.8	5.9e-07
WP_077914832.1|133150_133441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023994189.1|133443_134457_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJ76	Virus_Rctr85	36.7	4.4e-46
WP_139142178.1|134882_135011_-	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_139142176.1|134974_135142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077914831.1|136553_136733_-	Par-like protein	NA	NA	NA	NA	NA
WP_049885068.1|139361_140750_-	MFS transporter	NA	NA	NA	NA	NA
WP_023994181.1|141077_141446_-	NirD/YgiW/YdeI family stress tolerance protein	NA	NA	NA	NA	NA
WP_031619582.1|141932_142970_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_023994221.1|144377_145355_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	59.9	3.7e-74
WP_023994222.1|145804_147142_-	arginine/agmatine antiporter	NA	NA	NA	NA	NA
WP_023994223.1|147380_148454_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_058649965.1|148772_151040_-	arginine decarboxylase	NA	NA	NA	NA	NA
WP_023994225.1|152726_153035_-	helix-turn-helix transcriptional regulator	NA	A0A088CD40	Shigella_phage	68.6	9.6e-29
WP_078024491.1|155166_156018_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	37.3	4.3e-26
WP_001067855.1|158259_158964_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000845048.1|159084_160098_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001206316.1|160246_161038_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000679427.1|161201_161549_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|161542_162382_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_001993321.1|162311_162491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|162509_163010_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001163403.1|163185_163968_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	35.0	2.5e-33
WP_001324342.1|163957_165481_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000344784.1|165582_166443_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000935451.1|166445_168161_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_000204520.1|168199_168907_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|168903_169140_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|169136_169499_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|169516_171211_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|171262_171685_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|171720_171996_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|172009_172360_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|172431_172866_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000028208.1|172902_173235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333190.1|173191_173380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844627.1|173868_174111_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016413	Salmonella enterica subsp. enterica serovar Infantis strain CVM44454 plasmid pCVM44454, complete sequence	316160	236046	284082	316160	transposase,integrase	Escherichia_phage(33.33%)	60	229457:229471	272991:273005
229457:229471	attL	ATTTTGCTCTGATTT	NA	NA	NA	NA
WP_000038334.1|236046_236961_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.4	2.7e-66
WP_001247862.1|237025_237292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000218863.1|237384_237819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348083.1|237841_238087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348082.1|238108_238408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000117627.1|238547_239048_-	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	27.1	1.9e-05
WP_000978005.1|239510_240107_-	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	60.3	6.9e-15
WP_001276261.1|240103_240823_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845898.1|240819_241254_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_058649951.1|241308_243267_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.4	1.6e-20
WP_000006024.1|243325_243559_-	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	53.3	3.3e-05
WP_001276125.1|243616_244144_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_071529621.1|244140_244347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024139089.1|244495_244819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|244914_245106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271741.1|245102_245525_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001198941.1|245571_245997_-	antirestriction protein	NA	NA	NA	NA	NA
WP_072686770.1|245969_246542_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_130526232.1|246567_247029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274421.1|247229_247664_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|247677_247899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086137.1|247899_248583_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	1.3e-30
WP_013307862.1|248658_248964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001134388.1|248967_249894_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_012783918.1|249907_250177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000618110.1|250287_250536_+	protein ImpC	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000109071.1|250532_250970_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000457496.1|250969_252241_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	1.4e-142
WP_000340829.1|252245_252638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001103690.1|252642_253614_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	42.9	7.4e-67
WP_000633913.1|253842_254487_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	43.0	1.9e-39
WP_000239529.1|254480_254756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077249540.1|254893_255679_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	96.4	2.6e-54
WP_000535297.1|255723_256503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302628.1|256555_256870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000246635.1|257550_258546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991830.1|258549_259482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000952231.1|259779_260868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000253407.1|260869_261739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741348.1|261795_263361_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_077248527.1|263553_263691_+	toxin-antitoxin system, antitoxin component, AbrB family protein	NA	NA	NA	NA	NA
WP_001261287.1|263668_263899_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044768.1|263895_264312_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000350635.1|264473_266612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343085.1|266965_267223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194575.1|267222_267813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058649952.1|268075_269632_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000521603.1|269822_270440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044502555.1|270732_271770_-	permease	NA	NA	NA	NA	NA
WP_001175594.1|271874_272198_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_024159726.1|272298_273009_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	72.5	3.1e-94
272991:273005	attR	AAATCAGAGCAAAAT	NA	NA	NA	NA
WP_001286342.1|273017_273563_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_011117603.1|273638_274001_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_011117602.1|274021_275779_+	arsenical pump-driving ATPase	NA	NA	NA	NA	NA
WP_011117601.1|275852_276221_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|276865_277570_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_013188475.1|278523_279399_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_012579081.1|279478_280402_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
WP_001067855.1|282152_282857_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_021265675.1|282945_284082_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
