The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	8795	49912	3042741	transposase	Bacillus_phage(33.33%)	37	NA	NA
WP_054300408.1|8795_9452_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_155046731.1|9502_10387_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|11609_12053_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|12477_12966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|13072_14041_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_016209820.1|14742_18042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209803.1|18100_19138_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209810.1|19342_21256_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_016209822.1|21312_21960_-	methyltransferase domain protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_036777933.1|22095_23220_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|23216_23813_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|23843_24176_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|24265_26089_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_054300409.1|26535_28248_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|28565_29105_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|29491_29908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|30003_30819_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|30951_32445_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|32623_33046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|33045_35100_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|35384_36200_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_016209824.1|36300_37119_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|37115_37484_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209806.1|37826_37976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212343.1|38788_39595_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|39833_40987_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211588.1|41154_41856_-	cyclase family protein	NA	NA	NA	NA	NA
WP_032126329.1|41931_42561_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_129556496.1|42746_43985_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_016211592.1|44259_44922_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_016211589.1|44911_46144_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.8	7.4e-96
WP_032126328.1|46272_46524_+	VOC family protein	NA	NA	NA	NA	NA
WP_144019383.1|46878_47097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126637.1|47504_47798_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|48028_48892_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|49025_49391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|49336_49912_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	72589	170497	3042741	tRNA,transposase,protease	Staphylococcus_phage(20.0%)	99	NA	NA
WP_016210280.1|72589_73684_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|73920_74235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|74379_74790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300414.1|75060_75546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|76209_76911_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|77044_77761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|77897_79145_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_032126499.1|79523_80135_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_016211122.1|80231_81098_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|81101_81863_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|82026_82932_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|83154_83985_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|84154_84544_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300416.1|84676_85627_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|85921_86242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300417.1|86353_87328_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046958.1|87712_88273_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|88218_88584_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|88544_89543_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300421.1|89520_90366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300422.1|90416_90854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|91124_91505_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300423.1|91579_92641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212611.1|92688_93009_-	histidine kinase	NA	NA	NA	NA	NA
WP_052047048.1|93105_93606_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046957.1|93661_94513_-	reverse transcriptase	NA	NA	NA	NA	NA
WP_032126778.1|94727_94922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300425.1|95100_96063_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016211087.1|96270_97266_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_016211081.1|97293_98229_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_016211086.1|98269_98731_+	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_080664852.1|98709_99753_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_054300426.1|99765_101400_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_081007043.1|101359_103102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211710.1|103825_105862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046717.1|108118_108268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300428.1|108412_108976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300429.1|109276_109537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|109590_110883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046956.1|114343_114508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|115029_115209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|115450_116152_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|116412_116619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|116848_117154_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|117332_119330_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|119313_120360_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|121080_121932_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|121932_122853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|123263_123548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|123539_123995_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|123954_124293_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|124505_125435_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|125591_126020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|126100_126637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|126606_127512_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|127680_128289_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|128329_128905_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|128850_129018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|129123_130276_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|130482_131094_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|131114_132311_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|132407_132548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|132560_132965_-	SufE family protein	NA	NA	NA	NA	NA
WP_155046954.1|133119_133293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|133399_133717_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|133676_133979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|134123_134309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211961.1|134878_135460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|135487_136621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|136884_137412_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081007045.1|137733_138363_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300433.1|138662_138893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556650.1|139222_140197_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|140625_141339_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016209894.1|141507_141999_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_016209887.1|142142_142634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209877.1|142836_143727_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_080664826.1|143893_144493_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_016209878.1|144573_145512_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	29.6	1.9e-14
WP_036777110.1|145563_146658_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_052104599.1|146782_148099_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	40.1	3.2e-65
WP_016209893.1|148153_153043_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_016209881.1|153135_153438_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_016209876.1|153548_155471_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_016209888.1|155492_156788_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_016209898.1|156784_158395_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052104600.1|158501_159395_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_016209884.1|159504_160128_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|160204_160405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|160546_161245_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|161391_161961_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|162275_162899_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|163107_163710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|164890_165777_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|165856_166033_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|166156_166690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|168021_168606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300357.1|169156_170032_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063519.1|170080_170497_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	205893	289383	3042741	tRNA,transposase	Staphylococcus_phage(29.41%)	85	NA	NA
WP_129556499.1|205893_207047_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300440.1|207343_208555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300441.1|208699_209062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300442.1|209343_211440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|212134_213058_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|213296_213575_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|213627_213876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|213833_214895_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212179.1|215315_215468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212177.1|215890_216064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046952.1|216236_216398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212205.1|218083_218263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212204.1|218402_219848_+	MFS transporter	NA	NA	NA	NA	NA
WP_036781320.1|220694_220922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212320.1|220908_221235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212318.1|221236_221668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|222196_223258_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300445.1|223352_223904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|224173_225193_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|225179_225602_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|225603_226077_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|226192_226816_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|226845_227520_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|227525_228674_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|228670_229132_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|229207_230458_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|230584_232264_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|232373_233240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300446.1|234670_235405_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_036781250.1|235500_236286_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155046951.1|237092_237356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211002.1|237437_237836_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|237999_238305_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|238382_238637_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|238790_240452_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|240511_241195_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|241194_242283_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_054300447.1|242331_244968_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|245380_246442_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|246631_249001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|249044_250019_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300449.1|250038_250818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|250947_251286_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|251245_251701_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300450.1|252026_253346_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|253349_254066_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|254062_254704_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|254696_254795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007049.1|254772_255069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|255079_255535_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|255589_255934_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211502.1|255963_257007_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_129556569.1|257421_257631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|257620_258507_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210192.1|258819_259338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|259709_259871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|259927_260275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|260309_260972_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_036778872.1|261015_261621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|261850_262906_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210187.1|262909_266095_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210205.1|266175_267132_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|267180_267717_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|267713_268475_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_036778866.1|268580_271169_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_032126472.1|271631_272282_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|272501_273377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|273567_273969_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|273985_274537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|274848_275535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764027.1|275535_276129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273325.1|276356_277745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|278098_278452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300452.1|278409_279471_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046950.1|279520_279775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|279764_280340_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|280285_280651_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300454.1|280752_281103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556449.1|281092_281599_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300455.1|281613_281979_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273329.1|281939_283241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|283288_284350_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300457.1|284537_285827_-	MFS transporter	NA	NA	NA	NA	NA
WP_054300173.1|285987_287049_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211428.1|287319_289383_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.8	3.8e-36
>prophage 4
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	346356	401038	3042741	tRNA,transposase	Pseudomonas_phage(14.29%)	50	NA	NA
WP_075273298.1|346356_346932_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|346989_347382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|347511_347877_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300461.1|347933_348242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|348333_348909_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|348854_349220_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|349372_349645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|350541_350877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|351036_352569_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|352601_353441_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|353437_353935_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|353938_354931_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|355045_356392_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|356615_357677_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|357755_358901_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|364712_365570_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|365556_366480_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|366676_368068_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|368114_369158_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|369200_369644_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|369776_370967_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|371021_371168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|371718_372636_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|372903_373197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|373273_373468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|374486_375404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|375869_376712_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|376779_377430_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|377444_378485_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|378607_379693_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|379719_380829_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|380845_381163_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|381159_381519_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_054300463.1|381621_384351_-	kinase	NA	NA	NA	NA	NA
WP_080664847.1|384851_385805_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|385877_386939_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|387702_388260_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|388453_389137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|389855_390098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300464.1|390124_391186_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377041.1|392266_392596_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_032126658.1|392830_393535_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_016211063.1|393515_395744_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.0	1.0e-82
WP_016211066.1|395906_396920_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_016211065.1|397017_397239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126660.1|397243_398881_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.2	5.8e-88
WP_016211058.1|399019_399553_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_016211061.1|399673_400027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|400088_400454_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007050.1|400510_401038_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	479434	696326	3042741	tRNA,transposase,integrase,protease	Escherichia_phage(34.48%)	206	559543:559602	576083:576190
WP_054300202.1|479434_480163_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210945.1|481850_482441_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|482567_483953_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210947.1|484047_484245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126573.1|484338_485157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|485663_486041_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016210948.1|486053_486290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|486289_486496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779389.1|486678_487398_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210954.1|487486_489271_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779399.1|489369_489624_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_144019244.1|489980_490592_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|491079_491808_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211812.1|492013_493627_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|493668_494022_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126570.1|494034_494334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|494550_495279_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|495455_496553_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|496586_497837_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|497976_498705_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|498827_499166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|499233_499620_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|499616_499862_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|500270_500999_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|501482_502352_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|502348_503698_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|503810_505451_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300477.1|506173_506902_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_054300478.1|507181_508918_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_144019359.1|509079_509277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|509421_510150_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|510308_510809_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|510783_511293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|511892_512621_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|512771_513812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|514009_515035_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|515142_516348_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|516607_517021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|517149_517719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|517722_518055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|518047_518887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|518974_520609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|520970_521474_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|521436_522144_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|522212_523073_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|523053_523827_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|523857_525111_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|525110_526073_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|526116_526869_+	ComF family protein	NA	NA	NA	NA	NA
WP_032126362.1|528404_528770_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|528715_529291_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210615.1|530197_530668_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|530713_530953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|530971_531421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|531641_533066_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|533130_534180_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|534446_535226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|535242_535818_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|535763_536129_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556587.1|536228_537131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|537189_537936_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|538184_540995_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|541229_542090_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_054300481.1|542191_542920_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|543009_543216_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|543378_544611_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300482.1|545126_546416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300201.1|546445_547174_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_036780093.1|547277_548099_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|548108_551411_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_081007055.1|551656_552664_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_016211323.1|552837_553935_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|553924_555445_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|555507_556098_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_054300483.1|556633_557188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300484.1|557684_558632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|558856_559006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|559150_559396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|559533_559701_-	phosphatase	NA	NA	NA	NA	NA
559543:559602	attL	GTAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATT	NA	NA	NA	NA
WP_016212294.1|560130_560475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|560488_560941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|560937_561156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|561462_561672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|561973_562183_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|563507_563924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|563981_565134_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_155764029.1|565375_566641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|568171_568360_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|569761_570037_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|570039_570642_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
WP_016212522.1|570738_570993_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046945.1|571543_572617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211874.1|572935_574654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|574697_575603_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046944.1|576073_576211_+	hypothetical protein	NA	NA	NA	NA	NA
576083:576190	attR	AATCGCCGAGCAAAACGCGACGACTATAAACCCTCGGCTGTCCGCGTCACACAGCGTTACACAGCGTTACGTGCCTTGAAGCGGCACACTCCACTACTGTGCTCTCAC	NA	NA	NA	NA
WP_016210068.1|577397_577973_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_036778086.1|578048_578924_-	6-pyruvoyltetrahydropterin synthase	NA	A0A140B3P3	Vibrio_phage	24.0	8.0e-12
WP_016210054.1|578988_579510_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778088.1|579494_580577_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.5	2.0e-20
WP_036777829.1|580817_581222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210073.1|581646_582378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210076.1|582634_583936_+	inosine/guanosine kinase	NA	NA	NA	NA	NA
WP_016210066.1|584077_584746_+|protease	modulator of FtsH protease YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	3.6e-28
WP_032126425.1|585189_585786_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_016210052.1|585806_587003_-|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.4	8.2e-07
WP_016210064.1|587127_588492_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_016210075.1|588488_589580_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_016210065.1|589833_590493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210057.1|590633_591143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126424.1|591151_591976_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_016210061.1|591988_592633_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.8e-19
WP_036778098.1|592622_593462_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	23.3	1.4e-08
WP_016210074.1|593467_594094_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_016210053.1|594255_594798_+	septation protein A	NA	NA	NA	NA	NA
WP_016210060.1|594881_595184_+	YciI family protein	NA	NA	NA	NA	NA
WP_032126423.1|595180_595444_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016210070.1|595537_595810_+	DUF1315 family protein	NA	NA	NA	NA	NA
WP_016210055.1|595848_596487_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_075273345.1|596754_597789_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_054300491.1|598048_599809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210679.1|600484_602809_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.9	2.0e-17
WP_016210675.1|602976_603693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210677.1|603772_604387_-	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_016210672.1|604379_605762_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_036778297.1|605770_606244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210671.1|606376_607636_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_016210676.1|608091_610173_+	kinase domain protein	NA	NA	NA	NA	NA
WP_054300492.1|610476_611487_+	protein kinase	NA	NA	NA	NA	NA
WP_054300493.1|611645_611858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|611919_612285_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|612230_612806_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211905.1|613136_613547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275117.1|613790_614213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046943.1|614245_614386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556490.1|616155_617042_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556590.1|617725_618121_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|618117_618912_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|619090_619816_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|620061_621249_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375910.1|621580_622309_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212269.1|622790_623474_+	Fic family protein	NA	NA	NA	NA	NA
WP_016212268.1|623477_624062_+	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_017375910.1|624218_624947_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_155046942.1|625332_626218_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|627151_627880_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016211714.1|628496_631841_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|631915_632644_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|633542_634271_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_054300500.1|634799_635528_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_016212070.1|635937_636537_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_016212069.1|636511_636679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212066.1|636890_637667_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_054300501.1|638027_638756_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_032126794.1|638767_639160_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212477.1|639156_639402_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300502.1|639574_640252_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_054300500.1|640281_641010_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_155046941.1|641681_641945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|642346_644086_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_129556452.1|644088_644436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126799.1|645556_646369_+	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_054300481.1|646449_647178_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_054300506.1|647249_647657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|648135_649059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|649326_649623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210487.1|649651_649897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126625.1|650849_651422_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210486.1|651629_652388_+	oxidoreductase NAD-binding domain protein	NA	NA	NA	NA	NA
WP_016210484.1|652936_654694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210482.1|654903_656481_+	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210485.1|656613_657555_+	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210472.1|657556_658330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|658371_659064_-	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_054300507.1|659300_660590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273615.1|661074_661173_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|662073_663048_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300509.1|663171_663369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133265.1|663513_663990_+	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_016211707.1|664261_664549_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_036777440.1|664554_666936_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211706.1|666948_667944_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_016210495.1|668363_668723_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016210493.1|668765_668960_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_075273353.1|668994_669525_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210489.1|669529_671461_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_016210496.1|672339_673734_+	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210494.1|673800_674850_-	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210500.1|674870_676361_-	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210502.1|676495_677191_-	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210490.1|677187_678342_-	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210501.1|678344_679331_-	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_032126128.1|679348_680755_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_032126362.1|681671_682037_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300510.1|682093_682276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|682546_682846_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016210644.1|683103_683259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210649.1|683467_685456_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210650.1|685533_686718_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_054300512.1|686823_687933_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_129556624.1|688264_689251_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016210645.1|689316_690894_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_122940481.1|690905_691877_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210643.1|692012_692582_-	elongation factor P	NA	NA	NA	NA	NA
WP_051307335.1|692630_693665_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_129556623.1|693686_695246_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_054300513.1|695462_696326_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	810761	931616	3042741	tRNA,transposase,protease,tail	Acinetobacter_phage(29.41%)	109	NA	NA
WP_075273298.1|810761_811337_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|811282_811450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|811690_811936_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126495.1|812341_813226_-	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_016212128.1|813316_814063_-	solute symporter family protein	NA	NA	NA	NA	NA
WP_016210870.1|814976_815768_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016210862.1|815919_816165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210861.1|816316_816547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210859.1|816572_817352_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210868.1|817383_817683_-	pilZ domain protein	NA	NA	NA	NA	NA
WP_032126490.1|817679_818645_-	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_129556441.1|818993_820220_+	MFS transporter	NA	NA	NA	NA	NA
WP_105962623.1|823270_824424_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212102.1|825934_827575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211029.1|827748_828111_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016211023.1|828324_828759_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211034.1|828769_828949_-	rubredoxin	NA	NA	NA	NA	NA
WP_032126377.1|829065_830067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|830232_831525_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_016211032.1|831636_832434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211031.1|832743_833223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300525.1|833387_835475_-	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_075273367.1|835483_836260_-	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|836552_836957_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_105962174.1|837055_837220_+	phosphatase	NA	NA	NA	NA	NA
WP_054300526.1|837368_837665_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273369.1|837773_838589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211607.1|838771_838996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|839024_839555_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211605.1|839771_840005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300527.1|840118_842305_-	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	3.5e-141
WP_016211609.1|842337_842646_-	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_032126362.1|843516_843882_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|843827_844403_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210634.1|844653_845385_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_016210629.1|845381_845918_-	tim44-like domain protein	NA	NA	NA	NA	NA
WP_032126367.1|845971_846736_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210636.1|846739_848317_-	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_016210637.1|848323_848800_-	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_129556439.1|848775_849231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210633.1|849236_849992_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_016210632.1|850166_850454_+	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_016210640.1|850839_851064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036779423.1|851528_852692_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126366.1|852730_853708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664846.1|853701_854388_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_016210630.1|854326_855442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300529.1|855722_856124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046937.1|856295_857181_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046703.1|857185_857323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126861.1|857516_857831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273373.1|858054_859779_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_105962623.1|859849_861003_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300533.1|861295_861721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|861759_862913_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300162.1|864415_865498_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155046934.1|865871_866042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|866405_867467_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211359.1|867519_867924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211354.1|868453_870415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211355.1|870512_871622_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211357.1|871684_873166_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211358.1|873589_874051_+	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_054300534.1|874098_874299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300535.1|874443_875163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|875166_875742_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|875687_876053_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211800.1|876749_877535_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_036778206.1|877531_878515_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211802.1|878571_879843_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_032126863.1|885275_885827_-	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016210097.1|887860_889141_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_054300536.1|889158_889815_+	DedA family protein	NA	NA	NA	NA	NA
WP_016210082.1|889865_890915_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_016210083.1|891069_891924_+	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_122940784.1|892228_893035_+	trfA family protein	NA	NA	NA	NA	NA
WP_016210080.1|893141_893435_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_016210084.1|893594_894431_-	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_032126605.1|894420_895098_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210086.1|895066_896122_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_016210077.1|896454_897885_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210094.1|897871_898498_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210081.1|898503_898776_-	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210093.1|898861_900655_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_080664831.1|900970_902533_+	APC family permease	NA	NA	NA	NA	NA
WP_016210095.1|902635_903331_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016210079.1|903501_903999_+	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_032126362.1|907004_907370_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|907315_907891_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209867.1|907887_908067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209864.1|908090_909485_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_032126611.1|909527_910814_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_016209858.1|910860_912405_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_016209851.1|912526_912769_-	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209854.1|912761_913748_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209870.1|913809_914715_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209862.1|914714_916061_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209852.1|916153_916618_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_036776911.1|916682_917138_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209850.1|917363_917654_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_016209875.1|917726_919388_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209859.1|919551_919773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300537.1|920051_920459_-	glyoxalase	NA	NA	NA	NA	NA
WP_016209866.1|920490_921465_-	phospholipase A	NA	NA	NA	NA	NA
WP_016209860.1|921610_923032_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209857.1|923201_925121_-	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209874.1|925144_927814_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209869.1|928080_929424_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209871.1|929633_931616_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
>prophage 7
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1009981	1073281	3042741	transposase,protease	Hokovirus(13.33%)	58	NA	NA
WP_129556618.1|1009981_1011079_-|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.1	5.3e-21
WP_032126222.1|1011444_1012323_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.5	1.2e-39
WP_016209597.1|1012330_1012561_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_122940232.1|1012614_1013595_-	OmpA family protein	NA	NA	NA	NA	NA
WP_122940262.1|1013825_1014641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126221.1|1014734_1016135_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_016209584.1|1016409_1017807_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.2	1.8e-50
WP_016209607.1|1017904_1018831_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.6	3.9e-57
WP_016209602.1|1018831_1020088_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016209596.1|1020087_1021179_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_016209578.1|1021178_1022537_-	oligosaccharide repeat unit polymerase	NA	NA	NA	NA	NA
WP_016209593.1|1022536_1023391_-	glycosyltransferase family 2 protein	NA	A0A167RG86	Powai_lake_megavirus	30.8	5.4e-05
WP_016209582.1|1023422_1024595_-	poly(glycerophosphate) glycerophosphotransferase	NA	NA	NA	NA	NA
WP_016209613.1|1024591_1025980_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_036776538.1|1026007_1026415_-	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	51.1	2.6e-29
WP_016209609.1|1026434_1027439_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	48.9	3.3e-78
WP_016209587.1|1027435_1028308_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.0	1.3e-91
WP_122940264.1|1028314_1029184_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.0e-67
WP_122940254.1|1029164_1031420_-	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_016209606.1|1031436_1032582_-	lipoprotein	NA	NA	NA	NA	NA
WP_016209608.1|1032629_1033112_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_032126220.1|1033151_1033775_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_016212244.1|1039452_1040205_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016212241.1|1040290_1040647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300546.1|1040780_1041377_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_155046699.1|1041371_1041944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|1042148_1042721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|1042876_1043089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155066175.1|1043407_1044010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211247.1|1044135_1044924_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_016211245.1|1044923_1045655_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_054300547.1|1045694_1047416_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_017376242.1|1047429_1048491_-	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_016211248.1|1048791_1050006_+	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_032126486.1|1050135_1050366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1050415_1051477_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211108.1|1051471_1051840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126370.1|1052169_1052994_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211103.1|1053004_1053703_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_016211109.1|1053745_1054492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211105.1|1054484_1054907_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_032126371.1|1055033_1055585_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211100.1|1055640_1056591_-	TonB family protein	NA	NA	NA	NA	NA
WP_032126369.1|1056591_1056819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777711.1|1057008_1057818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|1057797_1058640_-	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_016211099.1|1058636_1059881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210706.1|1060019_1061108_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016210697.1|1061125_1061626_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_032126484.1|1061813_1062413_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210700.1|1062418_1063582_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_016210703.1|1063613_1064567_+	glutathione synthase	NA	NA	NA	NA	NA
WP_016210701.1|1064922_1065987_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210702.1|1065983_1069046_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210704.1|1069700_1071647_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_155468148.1|1071929_1072358_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377700.1|1072541_1072835_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_081007062.1|1072951_1073281_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.0	7.7e-08
>prophage 8
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1134294	1222454	3042741	tRNA,transposase	Staphylococcus_phage(31.25%)	94	NA	NA
WP_016209326.1|1134294_1135674_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_016209346.1|1135788_1137681_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_036776463.1|1137728_1138355_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_016209314.1|1138374_1139259_+	ParA family protein	NA	Q8JL10	Natrialba_phage	27.7	1.7e-17
WP_016209349.1|1139291_1140185_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_016209313.1|1140299_1140698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209354.1|1140702_1141518_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|1141569_1141974_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|1142028_1142499_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_016209332.1|1142510_1143038_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_016209323.1|1143054_1144596_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209322.1|1144621_1145482_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|1145512_1146904_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_016209335.1|1146928_1147357_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_016209325.1|1147450_1148815_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.5	6.6e-37
WP_036776458.1|1148870_1150706_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	44.0	3.3e-124
WP_155047007.1|1150864_1151470_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075273393.1|1151534_1152242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273395.1|1152386_1152569_-	phosphatase	NA	NA	NA	NA	NA
WP_075273397.1|1152888_1153284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211851.1|1153972_1154629_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273625.1|1154825_1155578_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211852.1|1155636_1156350_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_129556614.1|1156935_1157088_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_122942409.1|1157225_1157657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211924.1|1158016_1158175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|1158330_1159326_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080664873.1|1159220_1159535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126480.1|1160080_1160764_+	methyltransferase	NA	NA	NA	NA	NA
WP_080743040.1|1160810_1161467_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1161525_1162500_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047006.1|1162753_1162894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104719.1|1163300_1164725_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211299.1|1164952_1165894_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_032126720.1|1165913_1167908_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211298.1|1167904_1168510_+	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_016211294.1|1168511_1168853_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211297.1|1168853_1169690_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_081007064.1|1169686_1169962_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_054300271.1|1170001_1170976_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047005.1|1171174_1172024_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1172083_1173058_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211791.1|1173130_1173394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211793.1|1173419_1174847_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016211790.1|1174843_1175539_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_054300144.1|1176843_1177209_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047004.1|1177223_1177730_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007065.1|1177942_1178782_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_016212335.1|1178798_1179137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1180231_1181206_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212051.1|1182533_1183307_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_155046758.1|1183934_1184066_-	phosphatase	NA	NA	NA	NA	NA
WP_032126637.1|1184914_1185208_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_081006998.1|1185324_1185780_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_081006999.1|1185984_1186356_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_016210347.1|1186364_1186622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556610.1|1186922_1187501_-	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210344.1|1187573_1188473_-	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_080664839.1|1188477_1189104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126693.1|1189048_1191370_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_016210342.1|1191516_1191996_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_016210346.1|1191992_1193144_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210340.1|1193278_1193782_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_032126694.1|1193874_1194834_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_051307328.1|1194805_1196137_+	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_016210336.1|1196177_1197557_+	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_129556609.1|1197566_1199015_+	potassium transporter	NA	NA	NA	NA	NA
WP_016210352.1|1199040_1199409_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_016210345.1|1199427_1200495_-	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210335.1|1200527_1201424_-	EamA family transporter	NA	NA	NA	NA	NA
WP_016210351.1|1201420_1202257_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_016211230.1|1202392_1202845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211229.1|1202984_1203731_-	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_016211234.1|1203711_1204275_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_016211228.1|1204283_1204799_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016211227.1|1204946_1207025_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211231.1|1207024_1207975_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211232.1|1208842_1209241_+	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_129556608.1|1209467_1210178_-	VUT family protein	NA	NA	NA	NA	NA
WP_129556607.1|1210460_1210910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|1211230_1211539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211866.1|1211988_1212291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126699.1|1212942_1213479_-	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_036776841.1|1213563_1214103_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_054300148.1|1214542_1215604_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212371.1|1215581_1216214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212372.1|1216329_1216551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047003.1|1216736_1217623_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|1219111_1219444_-	DMT family transporter	NA	NA	NA	NA	NA
WP_075273401.1|1219481_1219934_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046757.1|1220078_1220234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|1220290_1220656_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016209699.1|1220682_1221279_-	DMT family transporter	NA	NA	NA	NA	NA
WP_054300271.1|1221479_1222454_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 9
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1251854	1285733	3042741	tRNA,transposase	Powai_lake_megavirus(25.0%)	31	NA	NA
WP_036776867.1|1251854_1253252_+|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_155047002.1|1253622_1254228_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1254242_1254608_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1254890_1255466_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1255411_1255777_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300157.1|1256609_1257890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007000.1|1258113_1259202_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1259265_1259631_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300159.1|1259687_1259969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307322.1|1259972_1260152_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016212386.1|1260342_1260648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300160.1|1260712_1264105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556603.1|1264288_1266304_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016211610.1|1266424_1268755_-	penicillin-binding protein 1A	NA	NA	NA	NA	NA
WP_032126362.1|1269019_1269385_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1269330_1269906_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556669.1|1270835_1271231_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_016212222.1|1271227_1271701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556668.1|1272248_1273487_+	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	6.0e-13
WP_032126430.1|1273734_1274259_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_016211203.1|1274367_1275366_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_016211205.1|1275452_1276349_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081007001.1|1276421_1277708_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211206.1|1278169_1279486_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211201.1|1279600_1279909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300161.1|1279989_1281051_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|1281098_1282181_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155047001.1|1283079_1283265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047000.1|1283469_1283616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300164.1|1283663_1284683_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|1284758_1285733_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
>prophage 10
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1467815	1490011	3042741	tRNA,transposase,protease	Staphylococcus_phage(50.0%)	19	NA	NA
WP_054300148.1|1467815_1468877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046997.1|1469451_1471974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046996.1|1472908_1475422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212310.1|1476452_1476908_+	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_052104637.1|1476937_1477474_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016212085.1|1477529_1478003_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_032126534.1|1478044_1478560_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_016212084.1|1478559_1479576_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_054300271.1|1479857_1480832_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007003.1|1481204_1481666_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1481625_1481964_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212327.1|1482217_1483003_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_075273416.1|1483063_1483678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210574.1|1483818_1484238_+	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_032126277.1|1484325_1484916_+	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210572.1|1485138_1486896_+|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_032126278.1|1487017_1488001_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_032126275.1|1488081_1488633_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_032126276.1|1488643_1490011_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
>prophage 11
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1551531	1603741	3042741	tRNA,transposase	Staphylococcus_phage(22.22%)	52	NA	NA
WP_016210756.1|1551531_1554345_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A167RAL2	Powai_lake_megavirus	26.5	1.3e-76
WP_032126291.1|1554337_1554847_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_016210766.1|1554850_1555294_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_075273424.1|1555382_1556006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273426.1|1556020_1556596_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1556541_1556907_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211782.1|1556968_1557151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126294.1|1557750_1559028_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211783.1|1559308_1559674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211784.1|1559665_1560388_-	aquaporin family protein	NA	M1HH19	Acanthocystis_turfacea_Chlorella_virus	35.8	1.6e-26
WP_054300148.1|1560941_1562003_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300188.1|1562248_1563808_+	methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	50.4	9.9e-37
WP_016210175.1|1564121_1564451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210177.1|1564836_1565202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126297.1|1565326_1566187_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_016210164.1|1566173_1566953_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|1567028_1567712_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556592.1|1567872_1568403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210179.1|1568693_1569197_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_016210161.1|1569397_1569652_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_016210178.1|1570153_1570621_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016210163.1|1570710_1571241_-	ferric uptake regulator family protein	NA	NA	NA	NA	NA
WP_016210172.1|1571240_1571765_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	59.6	6.9e-51
WP_036776947.1|1571927_1573043_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210174.1|1573279_1574440_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.5	8.2e-121
WP_016210183.1|1574890_1576894_+	transketolase	NA	NA	NA	NA	NA
WP_016210176.1|1576962_1577970_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210181.1|1578043_1579228_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_032126295.1|1579237_1580692_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_016210162.1|1580722_1581760_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_155046995.1|1582444_1583331_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300190.1|1583457_1584420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|1584914_1585871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|1585915_1586137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126299.1|1586159_1586381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1586631_1587606_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211964.1|1587664_1587985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|1588097_1588748_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211963.1|1588849_1589509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212030.1|1590582_1590828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|1590919_1591582_+	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212032.1|1591705_1592833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104666.1|1593420_1593879_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|1594043_1594250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126304.1|1595295_1595640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210983.1|1595877_1598061_+	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	1.1e-06
WP_016210981.1|1598076_1598715_-	ribonuclease T	NA	NA	NA	NA	NA
WP_016210987.1|1598744_1599944_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_098082804.1|1600181_1601279_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_036778253.1|1601391_1602930_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_075273313.1|1602987_1603326_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1603285_1603741_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1606953	1654505	3042741	transposase,integrase	Escherichia_phage(47.06%)	53	1631832:1631891	1644566:1644825
WP_054300148.1|1606953_1608015_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300194.1|1607992_1608691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|1608768_1609197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|1609546_1609744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|1609986_1610619_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|1611039_1611990_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_054300195.1|1611986_1613519_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|1613515_1614046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|1614380_1615019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|1615433_1616138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210818.1|1616429_1616654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210820.1|1617157_1618099_-	DMT family transporter	NA	NA	NA	NA	NA
WP_155046994.1|1618368_1619523_+	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210937.1|1619614_1619896_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_032126309.1|1619981_1620659_-	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_032126310.1|1620705_1621965_-	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_016210941.1|1622162_1623212_+	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_016210931.1|1623290_1624097_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210936.1|1624118_1624913_+	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210944.1|1625014_1626034_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_036778484.1|1626080_1626692_+	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210943.1|1626695_1627382_+	acireductone synthase	NA	NA	NA	NA	NA
WP_016210935.1|1627378_1627921_+	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_017375910.1|1628307_1629036_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_054300198.1|1629186_1629516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126737.1|1629927_1630656_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212022.1|1630885_1631104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|1631103_1631703_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|1631699_1631948_+	hypothetical protein	NA	NA	NA	NA	NA
1631832:1631891	attL	CGTAAGCGTCGCTACCTCGGTAGGTATTTTGCACATCCAATGATGCAAAATCGCCGAGCA	NA	NA	NA	NA
WP_155046993.1|1632092_1632455_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	37.6	1.3e-13
WP_054300200.1|1632447_1633026_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	51.5	3.9e-47
WP_054300201.1|1633327_1634056_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_016212023.1|1634451_1635444_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_075273432.1|1635440_1636175_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_054300202.1|1636485_1637214_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_075273436.1|1637920_1639132_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	6.9e-38
WP_016211918.1|1639199_1640168_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|1640539_1640779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|1640771_1641125_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_129556455.1|1641425_1642028_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|1642032_1642491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1642973_1643549_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1643494_1643860_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046992.1|1643820_1644360_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.5	8.7e-09
WP_054300206.1|1644826_1645063_-	hypothetical protein	NA	NA	NA	NA	NA
1644566:1644825	attR	TGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTTTTTAAGATTGCCTTTGATGGGTATTTTTGGAAAGTTATGATAGCTATAATAATATCATTTCCAATGTGGTATATGATAAAATGGCTAAAGAGATCTGAGAAAGTCGATGTTTATGATTACAATACAAACTATAATCCTTTTTCTATTAGAACAATGAAGACAAGTTGATTTGGTAGTTTGTCTTTTAAAAAGAATATG	NA	NA	NA	NA
WP_054300202.1|1645348_1646077_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|1646571_1647009_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|1647438_1648827_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|1649269_1650763_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|1650964_1651714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211242.1|1651757_1652726_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|1652679_1653375_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_054300202.1|1653776_1654505_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 13
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1659000	1701441	3042741	tRNA,transposase	Synechococcus_phage(50.0%)	47	NA	NA
WP_075273438.1|1659000_1659576_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1659521_1659887_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016212580.1|1659974_1660325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1661060_1662122_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|1663332_1664148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|1664238_1665222_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|1665392_1665914_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|1665947_1666199_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|1666204_1667482_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|1668174_1668702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|1668821_1671134_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|1671262_1672078_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|1672275_1672740_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|1672869_1673931_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|1674191_1674488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211493.1|1674770_1676234_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_016211489.1|1676236_1677289_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|1677278_1677734_+	arginine repressor	NA	NA	NA	NA	NA
WP_155046991.1|1677758_1678082_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|1678429_1678741_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|1678870_1679662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|1679639_1680701_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779278.1|1680820_1681774_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|1681887_1682085_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|1682297_1682531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|1682641_1682758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|1682844_1683066_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1683092_1683458_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|1683514_1683679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|1683668_1683839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300210.1|1683795_1683984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|1684121_1684286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|1684580_1686017_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|1686058_1687510_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|1687621_1687909_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|1688098_1689142_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|1689157_1690057_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|1690053_1690572_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_054300211.1|1690641_1691259_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|1691268_1692756_+	ribonuclease G	NA	NA	NA	NA	NA
WP_054300212.1|1692765_1696446_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_016210535.1|1696519_1697332_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|1697328_1698009_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|1698849_1699470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|1699519_1699810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|1700613_1701108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|1701102_1701441_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1722911	1825350	3042741	tRNA,plate,protease,transposase	Prochlorococcus_phage(16.67%)	108	NA	NA
WP_016209523.1|1722911_1724261_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|1724311_1724749_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_016209501.1|1725010_1726522_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|1726527_1727754_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|1727747_1728776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|1728753_1729446_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|1729447_1730920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|1730912_1731401_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|1731406_1732879_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|1732878_1733277_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|1733273_1734962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|1734943_1735900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|1735942_1736458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|1736562_1737495_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|1737714_1738101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|1738117_1738762_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|1738942_1739782_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|1739857_1740460_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|1740460_1741315_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|1741671_1741983_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|1742007_1743399_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|1743554_1744286_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_054300558.1|1744282_1744810_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|1744841_1745399_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|1745404_1746385_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|1746524_1747325_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|1747328_1748096_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|1748092_1748557_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|1748579_1749233_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|1749236_1749584_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|1749617_1749869_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|1749944_1751213_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|1751215_1751974_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|1752035_1752926_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|1752976_1753660_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|1753745_1754003_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_054300217.1|1754275_1756429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|1756420_1757293_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|1757460_1759290_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|1759452_1760094_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|1760335_1760866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|1760883_1761057_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|1761115_1762165_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|1762171_1763122_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|1763175_1764120_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|1764147_1764885_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|1764973_1765216_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|1765290_1766514_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|1766545_1767394_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|1767390_1768443_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|1768563_1769184_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_054300218.1|1769199_1770231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1770274_1771249_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007004.1|1771402_1771858_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1771817_1772156_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|1772948_1773854_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|1773900_1774962_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|1775011_1775221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|1776455_1776902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1776905_1777481_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1777426_1777792_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|1777912_1778098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|1778201_1779236_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|1779232_1779943_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|1780417_1780936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|1781053_1781386_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_054300220.1|1781415_1784370_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_054300221.1|1784415_1784913_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|1784972_1785389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|1785480_1786341_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|1786423_1786990_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|1787022_1787877_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_054300222.1|1787918_1790825_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|1790885_1791083_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|1791089_1792100_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|1792096_1793155_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|1793148_1793949_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|1793951_1794770_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|1794781_1795729_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|1795736_1797038_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|1797216_1798320_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|1798316_1798709_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|1798720_1800097_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|1800090_1801560_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_054300223.1|1801751_1802723_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_129556478.1|1802959_1803846_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046715.1|1804145_1804391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|1805353_1805773_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|1805879_1806053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|1806279_1807014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|1807138_1808200_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|1808522_1809227_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|1809320_1810034_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|1810116_1811208_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_054300226.1|1811279_1811861_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|1811866_1812493_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|1812589_1813525_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|1813884_1814556_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|1814697_1815357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|1815525_1816785_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|1816781_1817867_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|1817859_1818741_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|1818729_1819980_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155046988.1|1821265_1821634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046990.1|1821649_1822327_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300228.1|1822304_1823558_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|1824463_1824829_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1824774_1825350_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1860719	1906174	3042741	tRNA,transposase	Staphylococcus_phage(42.86%)	35	NA	NA
WP_054300232.1|1860719_1862171_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|1862206_1863736_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300233.1|1864311_1865955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|1866496_1867438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|1867788_1868604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|1868895_1871586_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|1871834_1873055_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|1873222_1874929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|1875527_1876754_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300276.1|1877336_1878311_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_075273456.1|1878433_1878733_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1878692_1879148_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300559.1|1880028_1880577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1881292_1881658_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1881603_1882179_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|1882205_1883267_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273458.1|1883319_1883535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300238.1|1883807_1884086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|1884382_1884883_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|1885085_1886342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|1886698_1887112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273460.1|1887421_1888306_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|1888562_1888766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1889065_1890040_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|1890342_1891815_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|1891834_1892809_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|1892959_1893235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|1893400_1894021_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|1894339_1896316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|1896471_1897929_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|1897997_1899578_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|1899618_1900155_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|1900200_1904097_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_016210741.1|1904103_1904427_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_054300173.1|1905112_1906174_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	1922855	2049101	3042741	transposase,integrase,protease	Staphylococcus_phage(13.33%)	111	1969703:1969762	1986107:1986696
WP_054300245.1|1922855_1923731_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|1923986_1924631_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|1924661_1926467_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|1926490_1927066_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|1927610_1928621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|1928918_1929893_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_155046989.1|1930125_1931190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300248.1|1931282_1932257_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.2	3.1e-28
WP_155046989.1|1932489_1933554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|1934044_1934410_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1934424_1934931_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|1934920_1935580_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_075273476.1|1936213_1937017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|1937475_1938441_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|1938485_1939061_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|1939091_1940366_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|1941011_1941725_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|1941804_1942542_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|1942662_1944018_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|1944194_1944866_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|1944981_1945857_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|1946460_1947765_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|1947877_1948483_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|1948564_1949866_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|1949933_1952366_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|1952469_1952742_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|1952824_1954723_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|1954754_1955639_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|1955647_1956043_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|1956470_1958618_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|1958589_1959939_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|1959935_1962056_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|1962052_1963756_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|1963874_1965017_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|1965081_1966110_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_054300251.1|1966236_1967751_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|1967840_1968326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046988.1|1968658_1969027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046987.1|1969042_1969726_+|transposase	transposase	transposase	NA	NA	NA	NA
1969703:1969762	attL	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGA	NA	NA	NA	NA
WP_032126790.1|1970816_1971722_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_051307360.1|1971810_1972740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780074.1|1973831_1974638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|1974980_1976873_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|1977159_1977564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664862.1|1978427_1979126_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|1979106_1979412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|1981266_1982217_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_016211534.1|1982203_1982713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377327.1|1982718_1983660_-	Abi family protein	NA	A3QSC6	Clostridium_virus	31.6	7.3e-35
WP_016211531.1|1983967_1984648_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|1984711_1985302_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|1985504_1985783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|1985775_1986048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1986140_1987223_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
1986107:1986696	attR	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGATCAGACTGTCAGATTGCACATTTTTATTGATTATTTTTTCTTGTGCTAAATGTTTTGAGTCCTGAAATGTTTGCATTGGTGTTTTTCCATAACAGTATTTCCCAGAATGTGGCCGATGCTGATTGTACTTTATCAACCACTCATCAACATCAACTTGCAGCTCCTCAAGTGAATTATAGACTTTTTTACGAAAAGCAATGTCATAAAACTCTTGTTTCATCGTGCGATGAAAGCGTTCACAAATACCATTTGTTTGAGGTGAACGGGCTTTTGTTCTGGTGTGATCTACATCTTCGATCGCTAAATAAAGCTGATAAGCGTGATGTTCTATCTTGCCGCAATACTCTGTTCCCCGATCAGTTAAAATGCGTAGCAATGGAGTATCTCGCTCTTCAAACCAGGGGATTACACTTTCATTCAGCGCATGAGCTGCCGTCACTGCATTTTTTTCGGTATACAGGCAAGCAAATGCAACCCTGCTGTAGGTATCAACAAATGTCTGCTGATAAATTCTTCCAACACCTTTCATT	NA	NA	NA	NA
WP_036780532.1|1987325_1988366_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_081007067.1|1988877_1994352_-	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_016212302.1|1994572_1994872_-	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	44.4	3.9e-11
WP_155046986.1|1995056_1995942_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|1996131_1997193_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|1997212_1997602_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|1997872_1998955_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|1999165_1999651_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|1999718_2000627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300257.1|2000903_2001713_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_075273486.1|2001689_2002664_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|2002898_2003456_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155046985.1|2003514_2004297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2004394_2004748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2004814_2005009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|2005024_2005369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2005438_2006014_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2005959_2006325_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273488.1|2006409_2007045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|2007100_2007499_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046984.1|2008310_2009429_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|2009850_2009997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2010694_2011249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2011685_2011868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|2011932_2012160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|2012390_2013137_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|2013363_2013657_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|2013728_2014334_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|2014482_2015460_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_054300261.1|2015556_2016999_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|2017025_2017679_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|2017803_2018370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|2018724_2020503_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|2020574_2022281_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|2022272_2022563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307332.1|2022610_2022817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2023025_2023391_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2023336_2023912_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|2023915_2024290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2024665_2025640_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300263.1|2025711_2026152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|2026139_2026478_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|2026622_2026883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2026842_2027181_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|2027653_2029114_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|2029457_2030900_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|2031882_2033175_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300560.1|2033648_2036321_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.2	4.1e-75
WP_032126554.1|2036340_2037426_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|2037867_2038305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|2038301_2039186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|2039275_2039806_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|2039876_2041055_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_054300267.1|2041203_2045052_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|2045038_2046541_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|2047091_2047727_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_054300173.1|2048039_2049101_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2052975	2113449	3042741	tRNA,transposase	uncultured_Mediterranean_phage(11.11%)	54	NA	NA
WP_054300268.1|2052975_2054037_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007012.1|2054031_2054202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2054191_2054356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|2054412_2054778_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300269.1|2054799_2055168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210898.1|2056079_2056430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033923728.1|2056518_2056809_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016210894.1|2057283_2057586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300270.1|2057926_2058904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556487.1|2058982_2060320_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	34.8	9.4e-12
WP_016210903.1|2060438_2060810_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_016210904.1|2061030_2061681_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210896.1|2061723_2062806_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_016210899.1|2062859_2064743_+	APC family permease	NA	NA	NA	NA	NA
WP_032126790.1|2065242_2066148_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_016211091.1|2066222_2068703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273494.1|2069767_2070328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2070347_2071322_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211036.1|2071669_2073541_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.7	2.7e-33
WP_016211039.1|2073632_2075378_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	37.1	2.6e-46
WP_016211043.1|2075457_2075907_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.2	4.1e-20
WP_016211035.1|2075959_2076175_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_016211042.1|2076421_2077438_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	5.3e-100
WP_016211037.1|2077486_2078116_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_016211040.1|2078466_2079678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126170.1|2079905_2080178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2080341_2081403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052104774.1|2081450_2082083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|2082227_2082401_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|2083176_2084199_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211448.1|2084297_2085506_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211446.1|2085495_2087223_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|2087406_2088543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2088791_2089853_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210569.1|2090177_2090792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|2090906_2092241_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|2092368_2093010_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|2093315_2093738_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|2094093_2095056_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_081007068.1|2095094_2096270_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_155046983.1|2096358_2098059_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_054300273.1|2098058_2099597_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210562.1|2099625_2101278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|2101351_2102107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|2102387_2103274_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|2103684_2104974_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_036777061.1|2105169_2106357_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|2106674_2106884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|2106867_2107467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|2107541_2108891_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|2108973_2111175_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|2111191_2112007_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|2111986_2112706_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|2112873_2113449_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2172340	2296972	3042741	tRNA,transposase	Staphylococcus_phage(23.08%)	104	NA	NA
WP_016209432.1|2172340_2174050_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_054300278.1|2174307_2175639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300279.1|2176080_2177553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273506.1|2178038_2178308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|2178268_2178634_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|2178874_2179741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|2180253_2180598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|2180750_2180942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007014.1|2181185_2181581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046753.1|2181541_2182426_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046982.1|2183651_2183816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2183872_2184238_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|2184478_2185120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2185588_2186563_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300284.1|2186920_2188309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|2188544_2190482_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|2191495_2192215_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|2192328_2195868_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|2195934_2196753_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210518.1|2196739_2198779_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.8	3.0e-126
WP_016210524.1|2199856_2200387_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|2202024_2202201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|2202377_2202761_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|2202835_2203129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|2203294_2204254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|2204984_2205140_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|2205404_2206775_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|2206767_2207721_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|2207701_2210506_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|2210585_2211182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|2211571_2212327_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|2212526_2213168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|2213428_2214754_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210023.1|2214750_2216808_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210007.1|2216785_2217358_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|2217413_2217773_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|2217837_2218872_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|2219129_2219981_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|2220075_2221059_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|2221215_2222883_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_054300285.1|2223332_2223869_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273327.1|2223869_2224445_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2224390_2224756_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|2224777_2225107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300288.1|2225515_2226205_+	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_129556499.1|2226213_2227367_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_081007015.1|2227859_2228285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|2228496_2228754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|2228753_2229761_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|2230015_2231017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007069.1|2231472_2231625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007016.1|2231597_2231771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2231760_2231925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300293.1|2231981_2232347_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300294.1|2232618_2233680_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|2234423_2236892_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|2236905_2237874_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|2237860_2239120_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|2239171_2240557_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300295.1|2241367_2241592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781047.1|2241872_2242730_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_036778145.1|2243342_2244464_+	moeZ/MoeB domain protein	NA	A0A1V0SIK8	Klosneuvirus	28.1	8.7e-11
WP_016211172.1|2244513_2245710_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|2245898_2246963_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|2246946_2247693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|2247682_2248411_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016211168.1|2248407_2249067_+	wbqC-like family protein	NA	NA	NA	NA	NA
WP_016211169.1|2249050_2249998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|2249997_2250513_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036778065.1|2250555_2251989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210393.1|2252082_2254284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|2254772_2256365_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|2256589_2258167_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|2258278_2258704_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|2258814_2260200_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|2260225_2260663_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|2260667_2261009_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_075273520.1|2261023_2261395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273522.1|2261391_2263014_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210388.1|2263039_2263714_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210397.1|2263710_2265885_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|2267093_2268647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|2268730_2269540_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|2269667_2269901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|2270201_2271704_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|2272007_2274701_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|2274697_2278099_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|2278190_2279273_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|2279335_2280403_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|2281338_2281995_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|2282098_2283181_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300271.1|2283520_2284495_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|2285122_2285878_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_036779544.1|2286244_2287252_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_098082828.1|2287251_2287509_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2287873_2288848_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273524.1|2288888_2289854_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|2290009_2291560_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
WP_054300299.1|2293761_2294844_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|2294933_2295110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|2295099_2295399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2295388_2295553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|2295609_2295975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|2296108_2296972_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2341375	2440457	3042741	tRNA,transposase	Escherichia_phage(25.0%)	87	NA	NA
WP_033923708.1|2341375_2342251_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211947.1|2342365_2343511_-	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_129556540.1|2343503_2343899_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|2344117_2344873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|2346228_2346723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|2347180_2348545_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|2348640_2349300_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300306.1|2349547_2349772_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300307.1|2349874_2350603_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300308.1|2350632_2350863_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300309.1|2351157_2352717_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|2353077_2355048_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|2355239_2356319_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|2356367_2356574_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|2356580_2358062_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_054300310.1|2358164_2358689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|2360490_2361750_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_016211940.1|2361869_2362202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556538.1|2362315_2363290_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|2363434_2363605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|2363803_2364826_+	YHYH protein	NA	NA	NA	NA	NA
WP_054300313.1|2364833_2366516_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	1.6e-32
WP_016211344.1|2366676_2367495_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|2367708_2368692_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|2368684_2368906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|2368933_2369575_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_033923708.1|2370106_2370982_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|2373444_2374330_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|2374334_2374622_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|2374674_2374953_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|2375051_2375399_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|2375720_2375960_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|2376177_2376765_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|2376725_2377061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|2377248_2377893_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|2378227_2378878_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|2379410_2380463_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_032126786.1|2380480_2383561_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007021.1|2383859_2384426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2384418_2385147_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016209615.1|2386414_2386921_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|2386937_2388437_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|2388458_2389070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|2389066_2390239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|2390270_2392808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|2392839_2394732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|2395099_2395816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|2395818_2398692_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|2398692_2399097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209614.1|2399111_2400833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|2400832_2403781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|2403783_2405181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|2405194_2405935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|2405915_2406350_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|2406394_2407024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|2407094_2408009_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|2408039_2411342_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|2411338_2413162_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|2413201_2413600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|2413720_2414725_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|2415157_2416606_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|2416692_2419749_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|2419731_2419902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|2419967_2420105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300317.1|2420401_2420935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126753.1|2421891_2422356_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|2422425_2423946_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|2424033_2424636_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|2424632_2424980_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|2425130_2426114_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_054300318.1|2426741_2427719_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052104629.1|2427866_2428892_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052047087.1|2429342_2429561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|2429538_2430138_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|2430355_2430727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049135.1|2431150_2431297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|2431521_2431668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|2431901_2432765_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|2432973_2434167_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|2434246_2435851_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|2435866_2437012_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|2437216_2437414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|2437376_2437715_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2437674_2438130_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|2438375_2438642_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|2439004_2439766_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_081007023.1|2439800_2440457_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2446482	2507912	3042741	transposase	Adoxophyes_honmai_entomopoxvirus(14.29%)	55	NA	NA
WP_052104629.1|2446482_2447508_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273534.1|2447870_2448752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|2448945_2449218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|2449319_2449784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|2450197_2450647_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|2450766_2451147_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|2451284_2452061_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155046974.1|2452171_2452333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274658.1|2452484_2453690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300330.1|2453739_2454801_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|2455422_2456001_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|2456028_2456424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|2456529_2457987_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|2458048_2459536_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|2460286_2460757_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|2464711_2465974_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|2466061_2467867_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|2468350_2469148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|2469317_2469779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|2470077_2472033_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_155046973.1|2472199_2472358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212182.1|2472714_2472900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|2473233_2474223_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|2477596_2477911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|2478168_2478429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|2478448_2478937_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|2480460_2481051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|2481310_2481568_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|2481567_2482575_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300338.1|2482599_2484165_-	APC family permease	NA	NA	NA	NA	NA
WP_016210800.1|2484371_2485199_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075273540.1|2485565_2486177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|2486361_2486622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|2486795_2487749_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_016210791.1|2488171_2488372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104738.1|2488746_2489553_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|2489658_2490630_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|2490611_2491583_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081007027.1|2491905_2492091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007028.1|2492875_2493331_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2493290_2493629_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|2493802_2494243_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|2494921_2495860_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_016211349.1|2495923_2497918_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_032127067.1|2497914_2498517_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|2498513_2498852_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|2498927_2500154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|2500711_2501683_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|2501898_2502084_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|2502210_2502678_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|2502674_2503553_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|2503803_2505111_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|2505263_2505719_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2505678_2506017_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2507006_2507912_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2522637	2573427	3042741	transposase	Staphylococcus_phage(25.0%)	48	NA	NA
WP_054300271.1|2522637_2523612_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046969.1|2523631_2524449_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210855.1|2524602_2525580_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210849.1|2525697_2527146_+	dihydrolipoyl dehydrogenase	NA	NA	NA	NA	NA
WP_016210847.1|2527174_2528179_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|2528201_2528873_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|2528857_2530111_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|2530359_2530914_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|2531496_2532681_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|2532847_2534446_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|2535139_2536111_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|2536146_2536374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2536377_2537264_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|2537351_2537624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007032.1|2537757_2538027_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	63.2	9.3e-12
WP_016209794.1|2538254_2538878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300344.1|2538923_2540867_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|2540988_2541741_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144019182.1|2541744_2542251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556639.1|2542546_2542957_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209797.1|2543424_2543916_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|2543912_2544662_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|2544691_2544961_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_016209787.1|2544976_2545762_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|2545775_2546909_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|2546943_2549037_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|2549067_2550528_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|2550508_2551396_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|2551392_2552115_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|2552201_2552585_+	response regulator	NA	NA	NA	NA	NA
WP_016209769.1|2552626_2553370_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_036776682.1|2553382_2555407_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|2555468_2555762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|2555898_2556621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|2556785_2557508_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|2558214_2558670_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|2558685_2560134_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|2560174_2560930_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|2560910_2562311_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|2562334_2563552_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|2563582_2563957_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_054300271.1|2565807_2566782_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|2566879_2567941_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2568495_2569470_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|2570160_2570736_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2570681_2571047_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300345.1|2571183_2572263_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|2572344_2573427_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 22
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2584214	2632048	3042741	tRNA,transposase	Acinetobacter_phage(16.67%)	45	NA	NA
WP_016211669.1|2584214_2584565_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2585389_2586364_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|2587674_2588907_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|2589113_2590886_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|2591021_2592065_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|2592078_2592822_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_016211398.1|2592968_2593256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019306.1|2593317_2593497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|2593572_2594271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300347.1|2594692_2596084_+	protein kinase	NA	NA	NA	NA	NA
WP_016211733.1|2596139_2596964_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300161.1|2597578_2598640_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046730.1|2598858_2598999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212266.1|2599266_2599914_-	LysE family translocator	NA	NA	NA	NA	NA
WP_016212267.1|2600194_2600554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|2600720_2601176_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2601135_2601474_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211482.1|2601609_2603883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|2603871_2604594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|2604704_2605337_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|2605372_2605549_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|2605623_2606766_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_032126825.1|2606998_2608312_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|2608863_2610588_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|2611739_2612625_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_105962623.1|2613010_2614164_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046729.1|2614381_2615428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|2615686_2616493_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|2616748_2617570_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|2617605_2618460_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|2618685_2618850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2619013_2619589_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2619534_2619900_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155066176.1|2620162_2620432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046968.1|2620440_2621594_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.4	2.2e-57
WP_032126362.1|2622102_2622468_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2622413_2622989_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|2623341_2624700_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|2624981_2625341_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_054300275.1|2625576_2626452_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016210111.1|2626756_2628391_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|2628397_2629234_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|2629255_2630533_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|2630616_2630937_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|2630956_2632048_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 23
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2651656	2705066	3042741	transposase,integrase,protease	Staphylococcus_phage(40.0%)	53	2676506:2676565	2703166:2703455
WP_054300353.1|2651656_2651884_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046967.1|2651934_2652549_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300271.1|2652687_2653662_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046966.1|2653734_2654115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2654075_2654441_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2654386_2654962_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|2654951_2655137_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|2655347_2655509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|2655541_2656417_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|2656582_2660449_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|2660530_2660671_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|2660652_2660937_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_032126538.1|2661201_2662620_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_016211991.1|2663528_2664434_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126537.1|2664674_2664860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|2664896_2665433_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_054300276.1|2666911_2667886_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016212012.1|2667929_2668607_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|2668622_2669006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|2669227_2670349_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_054300357.1|2670582_2671458_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211974.1|2671740_2672862_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|2672961_2673264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|2673263_2673944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2674522_2674888_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377865.1|2676247_2676532_-|transposase	transposase	transposase	NA	NA	NA	NA
2676506:2676565	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_080664876.1|2676890_2678753_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_054300359.1|2678976_2679549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273651.1|2679907_2680945_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300361.1|2681496_2681793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007035.1|2681770_2682436_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|2682475_2683450_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|2684006_2684636_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|2684619_2685042_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|2685048_2686788_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|2686788_2687853_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|2687856_2688210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|2688322_2689279_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|2689288_2689600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|2689615_2690185_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|2690448_2691777_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|2691981_2692956_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|2693169_2693541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|2693599_2694373_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155046965.1|2694524_2696981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|2697260_2698022_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556513.1|2698102_2699848_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210844.1|2700023_2701151_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	23.2	5.7e-10
WP_016210843.1|2701237_2701468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|2702082_2702862_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|2703336_2703774_-	MFS transporter	NA	NA	NA	NA	NA
2703166:2703455	attR	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACGTA	NA	NA	NA	NA
WP_054300363.1|2704197_2704545_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046964.1|2704490_2705066_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2743981	2813139	3042741	tRNA,transposase,protease	Klosneuvirus(22.22%)	60	NA	NA
WP_016211285.1|2743981_2744761_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211280.1|2744760_2745270_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|2745305_2745554_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016211281.1|2745865_2746201_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211282.1|2746495_2747746_+	MFS transporter	NA	NA	NA	NA	NA
WP_032126762.1|2747827_2749855_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_016210148.1|2750690_2750909_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_016210147.1|2751769_2752942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777648.1|2752954_2754952_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_016210142.1|2754932_2755913_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273562.1|2755972_2756842_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_016210153.1|2756841_2757246_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075273564.1|2757238_2757658_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016210157.1|2757680_2758310_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016210144.1|2758852_2761042_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016210150.1|2761053_2762259_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_081007038.1|2762243_2764100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664835.1|2764087_2765314_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210156.1|2765306_2767175_+	ferric iron reductase FhuF-like transporter family protein	NA	NA	NA	NA	NA
WP_054300372.1|2767208_2768453_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210155.1|2768458_2769268_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.9	3.8e-16
WP_016210154.1|2769306_2769999_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_016210146.1|2770120_2770612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046720.1|2770961_2771135_+	phosphatase	NA	NA	NA	NA	NA
WP_075273565.1|2771272_2772163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046721.1|2772343_2772511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2772682_2773657_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|2773653_2774511_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|2775238_2775628_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|2775804_2776563_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_075273567.1|2776576_2778958_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	3.6e-70
WP_016209839.1|2780337_2781636_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|2781833_2782727_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|2782726_2783941_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|2783960_2785247_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|2785262_2785517_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|2785752_2787120_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|2787450_2788473_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|2788995_2790471_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|2790687_2791584_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|2791902_2793462_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209841.1|2793537_2793732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209831.1|2793951_2794650_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|2794928_2795192_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209848.1|2795498_2798093_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	8.3e-89
WP_016209835.1|2798089_2798572_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|2798549_2799590_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|2799762_2800248_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_054300374.1|2800355_2802926_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	5.1e-30
WP_032126642.1|2802961_2803423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|2803492_2803699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|2804902_2805442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|2806101_2807586_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|2807710_2809246_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|2809479_2809845_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|2809790_2810366_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|2810398_2811262_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|2811279_2811612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300375.1|2812418_2812619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|2812833_2813139_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2833924	2878931	3042741	tRNA,transposase	Acinetobacter_phage(20.0%)	40	NA	NA
WP_075273327.1|2833924_2834500_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052104776.1|2834503_2834971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|2835601_2836102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|2836517_2836871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|2837171_2838899_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|2839036_2839693_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|2839723_2840452_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|2840444_2841683_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|2841818_2842856_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|2842909_2843812_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|2843920_2845174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|2845231_2848729_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|2848788_2849517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|2849644_2850193_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_054300378.1|2852048_2853746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|2853754_2854908_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016212482.1|2855451_2855595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032127044.1|2855809_2856010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046961.1|2856129_2856534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2856701_2857067_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081007013.1|2858485_2858785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211467.1|2858859_2859426_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|2859428_2860517_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|2860637_2861450_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|2861580_2863566_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|2863625_2864279_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_105962623.1|2864880_2866034_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300380.1|2866362_2867019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300381.1|2867482_2868130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2868140_2869223_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300173.1|2869525_2870587_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|2871446_2871899_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|2872016_2873489_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|2873647_2874112_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|2874582_2874756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2875465_2875831_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2875776_2876352_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|2876341_2877001_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|2877100_2878372_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|2878460_2878931_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
>prophage 26
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2883299	2923773	3042741	tRNA,transposase	Wolbachia_phage(25.0%)	37	NA	NA
WP_129556449.1|2883299_2883806_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2883820_2884186_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|2884389_2885046_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|2885316_2885739_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|2886009_2888490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|2888585_2889515_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|2889521_2891441_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|2891505_2892780_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|2893189_2893861_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_036776426.1|2893869_2894721_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|2894898_2896197_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_054300162.1|2896271_2897354_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016212040.1|2897557_2898907_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|2899083_2899641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|2899829_2900228_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273581.1|2900283_2901651_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	1.6e-11
WP_054300384.1|2902059_2902875_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212251.1|2903036_2903573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046960.1|2903734_2904388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273583.1|2904514_2904796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|2905342_2905525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|2905874_2907152_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|2907148_2907286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|2907797_2909399_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|2909415_2910558_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_054300386.1|2910810_2911548_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|2911572_2912844_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|2913072_2913978_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075273583.1|2914309_2914591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|2915137_2915320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|2915669_2916947_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_080664858.1|2916943_2917081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211223.1|2917592_2919194_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|2919210_2920353_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_054300386.1|2920605_2921343_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|2921367_2922639_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|2922867_2923773_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013757	Piscirickettsia salmonis strain AY6492A, complete genome	3042741	2960350	3012442	3042741	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	52	NA	NA
WP_054300392.1|2960350_2961412_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300393.1|2961955_2962537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300394.1|2962499_2962862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|2962992_2963721_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|2963840_2964119_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_075273590.1|2964122_2964698_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|2964643_2964811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|2965051_2965297_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047008.1|2965354_2965669_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|2965686_2968533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|2969042_2969993_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|2970075_2970855_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|2970923_2971631_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|2971591_2971843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|2971865_2972162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|2972695_2973469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|2973501_2974098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|2974155_2975037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273592.1|2975412_2976387_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_054300399.1|2976485_2976752_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300400.1|2976896_2977139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007041.1|2977195_2977723_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_107517381.1|2978388_2978583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|2978796_2979150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300401.1|2979481_2979763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|2980142_2980331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300402.1|2980365_2984511_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_016211770.1|2984710_2985844_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|2985857_2986046_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300403.1|2986338_2987313_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_075273594.1|2987352_2988723_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|2988795_2989689_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|2989797_2990715_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|2990766_2991522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|2991589_2992864_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|2992998_2993676_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|2993876_2995304_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|2995278_2995917_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|2996126_2996405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|2996637_2997582_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|2997603_2999472_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|2999492_2999846_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|2999884_3001000_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|3001182_3002223_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|3002225_3003260_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|3003256_3004318_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|3004429_3005902_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|3006054_3006498_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|3006573_3009345_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|3009501_3010731_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|3010757_3011420_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|3011941_3012442_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013761	Piscirickettsia salmonis strain AY6492A plasmid p4PS1, complete sequence	158156	249	50017	158156	transposase,capsid,tail,head	Acinetobacter_phage(23.53%)	53	NA	NA
WP_032126153.1|249_570_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	40.6	1.7e-12
WP_016212579.1|1165_1363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764039.1|2026_2191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273727.1|2866_3052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273729.1|3825_4077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273731.1|4148_4373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273733.1|4369_5233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273735.1|7033_7399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764040.1|7602_7794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377341.1|8247_8547_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.7	1.8e-19
WP_155764041.1|8546_9050_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	2.1e-25
WP_075273741.1|10476_11211_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_155046767.1|11541_11703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377343.1|11737_12202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273747.1|12463_13054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273741.1|13183_13918_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_075273749.1|14139_14865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047019.1|15354_15507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273751.1|15519_17250_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_054300477.1|17409_18138_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	7.1e-38
WP_155047020.1|18294_19218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273755.1|19458_20115_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.2	2.9e-30
WP_016211955.1|20251_21232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|21688_22417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556703.1|22474_22963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377344.1|24075_25203_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273757.1|25442_25892_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273760.1|26235_28638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210338.1|28740_28878_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273592.1|28976_29951_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_081377345.1|29947_30472_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.4e-27
WP_032126637.1|30588_30882_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075273762.1|30947_32219_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	1.1e-22
WP_052047108.1|32274_32673_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273764.1|32728_33097_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_016210655.1|33110_33707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273766.1|34157_35219_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273768.1|35222_35492_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.3	2.2e-05
WP_016210667.1|35488_35812_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|35804_36200_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|36196_36547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|36546_36969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|36970_37294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|37647_38673_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273770.1|38792_39077_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_075273774.1|41278_42436_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|42598_43752_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_032126362.1|43824_44190_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273438.1|44135_44711_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.0	1.3e-07
WP_032126790.1|45181_46087_+|transposase	IS481 family transposase	transposase	A8RHK4	Spiroplasma_virus	26.0	6.8e-14
WP_129556697.1|46471_46864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211776.1|47346_48684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300594.1|48991_50017_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013761	Piscirickettsia salmonis strain AY6492A plasmid p4PS1, complete sequence	158156	57647	104414	158156	transposase,integrase,protease	Acinetobacter_phage(22.22%)	56	63807:63866	74708:76171
WP_052104629.1|57647_58673_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052104629.1|59494_60520_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212298.1|60799_61126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|61366_61843_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_155047011.1|61957_63110_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	9.8e-58
WP_075273780.1|63119_63827_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
63807:63866	attL	TTTAGCGCTTAGGTAATACAATACTCTGAAAATCAGCCATATTGTGAAATTGTGATAATT	NA	NA	NA	NA
WP_052104629.1|63965_64991_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273782.1|65370_65799_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	34.0	3.0e-12
WP_032126795.1|66521_66782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|66785_67058_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|67383_68505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|68937_69336_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|69344_70498_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212499.1|71496_71871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|72075_72249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|72496_72946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|72938_73103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|73403_74030_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_075273790.1|74019_74322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|74866_75892_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300590.1|76508_76733_-	hypothetical protein	NA	NA	NA	NA	NA
74708:76171	attR	TTTAGCGCTTAGGTAATACAATACTCTGAAAATCAGCCATATTGTGAAATTGTGATAATTCGACTAAAAATTACTCCCAGTATTCGAAGTGCAGGTGCCAATAATCGATAAAGCAGCTAAAAATAGGCTTAAAACCTGATTATAGACGGACTGCTCCTGTTAGAACTTAATGAGCTGCATGGTCGCTAGGGCTTTGTGGTGCTTCATGATTACTGACAAGCGTTGCTTTGGACGCCCACCGGTTAAAAGCATTTTGCTACCACAAAGGATGCACTCAAACGGGTCAGTGTTGATAAAGCCTTTGAGGAGTGATGCATAAGTGATTTTTTTAACCGGCTCTACCGTCTGGTCCAGTAACTTATAAATTGTTGGCAGCAGCTTTCCGCGGGTGCGAAAGCTCAAGAAGCCGTAATAGCGGATCATCTTAAATGATTTAGTGGGGATGTGACGGATTAGACGCTCAATAAACTCAAATGTTGTACTGGTGTGCTTTTCCTGCTTACCCGTTTTGCGATCAATATAGCGAAAGATCACTTCTTTGCCATCATAGTGCAGTAAGCGTGAATTTGAGAGTGGCGGTCGCTTTAAGTATCGACCTAAATAATCAACGTTTTGGTGGTGTGAAGGCTGAGCTTTTGCAAAATGGACATGCCAGAGTTTATTGTATTCTGGGTTGATGAATCGATTAAATGATGTGAGGTCAGTAATGTGGTTTTGATATTGATGAGGAATCACGAGTTTCCCTGTTTTGTAAGCGGTGCGTAATAAATTAACAATCGAAAACCGCCACATTGGCATCGTTTTTTTCTTTGTGAAATAAACTTTCTTCCAGGTTGTCTTGCACTTAGATAAGCCACCACGTGTCACTGATAAGTGGACGTGCGTATTCCAATTTAAACTCTGGCCGAAAGTATGCAGAGCTGTGAATATACCGATCTTAATTTTTTTCTTCTTTGCAGTTTTGAGCAGAACATTTGCGGCGAGTCGTGATAGATGATTCAGTAGCTCACGATTAGCAAGGAAAAACGGGCAAAGTGCTTTTGGCATGGTGAATGTTATGTGCTGGTATTCGCACTTTGGGAGTAACTTATTCTGTGCAGCAATCCATTGCTCAGTGGCTTTTTTCCACATGAGGAGCATAGCCGTGATTTGCAGGTATAGGTGACGACTTTGGTGTGTTTGCATCCTGAGTTAGAGCAACTGTATTCATCATGACCTGCAAACTTAGTTCTACAGCTGAGCATTTTCACGACGACTTCAACCACAGAGCGAGGAATATTATCGCGATTGGCCACATAGTAGCGCCACCAAGCTCTGCCAGTTTGGAAAAGATGTTTAAGCGTGAATTGAATCAAACTAACTATCTCATTGTGTTGATTAACAAGCGATTAATCATACAGACAACGATAAATTATACAACGGCCCTCCTAAAGTCGCGAGCTGTACTCAGCGAGCCTATCCTTG	NA	NA	NA	NA
WP_129556699.1|77040_77241_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|77234_77570_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|78135_78399_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_075273796.1|78953_79757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307367.1|79877_80402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|80510_80735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|81135_81876_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|81923_82352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273802.1|82685_83414_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_075273804.1|83498_83837_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|83796_84252_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273806.1|84357_84921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273808.1|85182_85707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|85746_86250_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081377348.1|86564_87314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273810.1|87621_88329_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_129556718.1|88315_89501_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_054300271.1|90638_91613_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_075273812.1|91609_92167_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.6e-08
WP_032126362.1|92112_92478_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273814.1|93825_94287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273816.1|94549_95386_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	5.9e-20
WP_129556717.1|95711_96938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|97592_98567_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_016212260.1|98724_98997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|99016_99241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|99577_99781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|99777_99948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|100134_101217_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|101373_101874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|101975_102233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047012.1|102301_103309_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	6.5e-58
WP_032126362.1|103269_103635_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|103580_104156_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075273824.1|104159_104414_-|transposase	transposase	transposase	NA	NA	NA	NA
