The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	8277	60915	3054745	transposase,tRNA,protease	Catovirus(11.11%)	50	NA	NA
WP_054300173.1|8277_9339_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052104774.1|9386_10019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047009.1|10163_10337_-	phosphatase	NA	NA	NA	NA	NA
WP_016211450.1|11112_12135_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211446.1|13430_15158_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036776407.1|15341_16478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|16726_17788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210569.1|18112_18727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210561.1|18841_20176_-	dihydroorotase	NA	NA	NA	NA	NA
WP_016210568.1|20303_20945_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_016210566.1|21250_21673_+	universal stress protein	NA	NA	NA	NA	NA
WP_016210559.1|22028_22991_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_081007068.1|23029_24205_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_155046983.1|24293_25994_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_054300273.1|25993_27532_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.2	5.1e-70
WP_016210562.1|27560_29213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|29286_30042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556478.1|30322_31209_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211932.1|31619_32909_-	GDA1/CD39 family protein	NA	NA	NA	NA	NA
WP_148037496.1|33104_33605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285912.1|33772_34291_-	MFS transporter	NA	NA	NA	NA	NA
WP_016211476.1|34608_34818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211473.1|34801_35401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211474.1|35475_36825_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	5.7e-33
WP_032126518.1|36907_39109_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_016211478.1|39125_39941_+	nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_032126519.1|39920_40640_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.8	1.9e-19
WP_075273327.1|40807_41383_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|41328_41694_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211265.1|41868_42531_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|42561_42930_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_032126514.1|42940_44257_-	MFS transporter	NA	NA	NA	NA	NA
WP_051307354.1|44539_45115_+	DedA family protein	NA	NA	NA	NA	NA
WP_032126515.1|45190_45370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|45542_45836_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_075273504.1|46025_46379_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	6.7e-10
WP_016211262.1|46433_48707_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.8	1.0e-167
WP_016211259.1|48766_49012_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_054300275.1|49136_50012_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211550.1|50089_50851_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_016211548.1|50834_51791_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_016211549.1|52053_54558_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	43.1	4.9e-86
WP_016211553.1|54561_55302_+	outer membrane lipocarrier LolA family protein	NA	NA	NA	NA	NA
WP_054300209.1|55641_56007_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|56063_56228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|56217_56517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126933.1|56520_57822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|57989_58964_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_016209411.1|59169_59964_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_016209421.1|60126_60915_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	100271	225185	3054745	transposase,integrase,tRNA	Staphylococcus_phage(27.27%)	96	211697:211756	217040:218144
WP_016209432.1|100271_101981_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016209448.1|102238_103570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300279.1|104011_105484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300152.1|106199_106565_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273508.1|106805_107672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273512.1|108184_108529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036776562.1|108681_108873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007014.1|109116_109512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|109472_110358_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046982.1|111583_111748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|111804_112170_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300283.1|112410_113052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|113520_114495_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300284.1|114852_116241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036780476.1|116476_118414_-	histidine kinase	NA	NA	NA	NA	NA
WP_016210517.1|119427_120147_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_032126504.1|120260_123800_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_016210525.1|123866_124685_+	ZipA protein	NA	NA	NA	NA	NA
WP_016210524.1|127787_128318_+	exsB family protein	NA	NA	NA	NA	NA
WP_016210010.1|129955_130132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780418.1|130308_130692_+	histidine phosphotransferase	NA	NA	NA	NA	NA
WP_075273518.1|130766_131060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210016.1|131226_132186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210020.1|132916_133072_+	putative membrane protein	NA	NA	NA	NA	NA
WP_016210025.1|133336_134707_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_052104723.1|134699_135653_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036779556.1|135633_138438_-	response regulator	NA	A0A1V0SGX0	Hokovirus	32.0	3.1e-57
WP_016210027.1|138517_139114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210008.1|139503_140259_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210004.1|140458_141100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210021.1|141360_142686_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_016210007.1|144716_145289_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032126616.1|145344_145704_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_016210019.1|145768_146803_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_122941592.1|147060_147912_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|148006_148990_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_016210013.1|149146_150814_+	long-chain-fatty-acid--CoA ligase	NA	A0A1V0SBX8	Catovirus	25.1	6.2e-21
WP_075274733.1|151752_152070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|152088_152664_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|152609_152975_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300287.1|152996_153326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300288.1|153734_154424_+	hypothetical protein	NA	A0A0N7AE80	Bacillus_phage	28.2	3.2e-08
WP_105962623.1|154432_155586_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_081007015.1|156078_156504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|156714_156972_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|156971_157979_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300292.1|158233_159235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300294.1|160835_161897_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211279.1|162640_165109_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_016211277.1|165122_166091_+	homoserine kinase	NA	NA	NA	NA	NA
WP_016211278.1|166077_167337_+	threonine synthase	NA	NA	NA	NA	NA
WP_129556646.1|167388_168774_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_075274649.1|170089_170947_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211172.1|172729_173926_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_080664856.1|174114_175179_+	DegT/DnrJ/EryC1/StrS aminotransferase family protein	NA	NA	NA	NA	NA
WP_051307350.1|175162_175909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778066.1|175898_176627_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075285914.1|176623_176875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377765.1|176850_177282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211169.1|177265_178213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307351.1|178212_178728_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075285916.1|178770_179319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764054.1|179300_180203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764055.1|180296_182462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210398.1|182986_184579_+	B-type flagellin	NA	NA	NA	NA	NA
WP_032126669.1|184803_186381_+	B-type flagellin	NA	NA	NA	NA	NA
WP_122940572.1|186492_186918_+	flaG family protein	NA	NA	NA	NA	NA
WP_016210394.1|187028_188414_+	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_032126670.1|188439_188877_+	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_016210390.1|188881_189223_+	flagellar protein FliT	NA	NA	NA	NA	NA
WP_016210399.1|189237_191229_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210397.1|191924_194099_-	glycosyl transferase 41 family protein	NA	NA	NA	NA	NA
WP_016210772.1|195307_196861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126667.1|196944_197754_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_033923762.1|197881_198115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210769.1|198415_199918_-	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_016210773.1|200221_202915_+	DNA repair family protein	NA	NA	NA	NA	NA
WP_016210771.1|202911_206313_+	AAA family ATPase	NA	S5M596	Bacillus_phage	23.1	2.2e-09
WP_054300162.1|206404_207487_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300297.1|207549_208617_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212246.1|209552_210209_+	AT hook motif family protein	NA	NA	NA	NA	NA
WP_054300162.1|210312_211395_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
211697:211756	attL	TTCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCT	NA	NA	NA	NA
WP_054300271.1|211734_212709_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212247.1|213336_214092_-	ZIP zinc transporter family protein	NA	NA	NA	NA	NA
WP_081377766.1|214458_215193_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_155764056.1|215291_215465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|215464_215722_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|216086_217061_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273524.1|217101_218067_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212058.1|218222_219773_+	dolichyl-phosphate-mannose-mannosyltransferase	NA	NA	NA	NA	NA
217040:218144	attR	AGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCGAAGTATCAGCCATGATAAAGTCACACGCTTTTTAAATAAAAACCACTTTGGATCAAAAGAGCTCTGGAGCTATGTTAAAAAGCATGTTCGTCAGTATGAAGAAGAAGTTGGAGGCGTTTTAAGTCTGGATGATACCGTGGAAGAAAAGCCTTATACAGATGAGAATGATGTGGTTTGTTGGCATTATTCACACAGCAAAAGCGCTCATGTAAAGGGAATTAATATTTTGACAAGTATGGTGACTTACAAGAAAACGTCCGTACCTATTGGTTATGAAACTGTATTAAAAGACATCAAGTTTACTGATTTAAAGGACCGAAAAGAAAAGAGAAAATCTAATATATCGAAGAATGAGTACTTTCGTAACCTTATAAATCGTGCAATTAATAACCAGGTTAAATTTGATTATGCTGTTGCAGATAACTGGTTCAGTTCAAAAGAAAACATGAATTATATTCATGCCAAGTTAAATAAGTTGTTTATTTTAGGAATAAAATCTAATCGAACAGTTGCTTGCAGTTTAGATGATAAAGTCAATAGAAATTACCAGCCAGTCAAATCTCTTGATTTAAAAGATGGTGAGGCCATAGATGTATATCTTCAGGGAATTAATTTCCCAGTGCGATTAATGAAAAAGATCTTCACAAACGAAGATGGGTCAACAGGTCACCTCTATTTAATAACAAATGATTTAGAGACGGATGGTGATGGGCTTTACAAAATCTATCAAAAACGATGGAAAATTGAAGAATATCATAAGTCGATTAAACAAAATGCAAGTTTAGCAAAATCACCAACTAAAACTGTTCGGTCACAATGCAATCATATTTTTGCATCAATCGTGGCATTTTGTAAACTAGAAACATTGAGTGTAAAAGCACAACTTAACCACTTTGCACTCAAATATAAATTACTTGTGCGGTCAAATCAAATAGCTTTTGAAGAGCTTAGGCGATTAAAATGTTTATGACCTGTGCGTAAGGTGAGTCAATAAGTTAGCTGCTAAGCTTTTGTGCTTTATTTTTTATGCTGTTAATGAGCTTGTAT	NA	NA	NA	NA
WP_054300299.1|221974_223057_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046981.1|223146_223323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046980.1|223312_223612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|223601_223766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300189.1|223822_224188_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|224321_225185_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	269588	439382	3054745	transposase,tRNA	Escherichia_phage(13.33%)	143	NA	NA
WP_033923708.1|269588_270464_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556540.1|271715_272111_-	ArsC family reductase	NA	NA	NA	NA	NA
WP_016211946.1|272329_273085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212551.1|274440_274935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556643.1|275392_276757_-	histidine kinase	NA	NA	NA	NA	NA
WP_016211983.1|276852_277512_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_054300306.1|277759_277984_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300307.1|278086_278815_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	1.9e-43
WP_054300308.1|278844_279075_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036779232.1|279369_280929_-	APC family permease	NA	NA	NA	NA	NA
WP_016211215.1|281289_283260_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.2	1.5e-77
WP_016211211.1|283451_284531_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_052104715.1|284579_284786_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_016211210.1|284792_286274_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016211214.1|286376_286940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211942.1|288701_289961_+	DUF4804 domain-containing protein	NA	NA	NA	NA	NA
WP_129556538.1|290526_291501_-	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_016211341.1|291645_291816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300312.1|292014_293037_+	YHYH protein	NA	NA	NA	NA	NA
WP_075274652.1|293044_294727_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.5	2.7e-32
WP_016211344.1|294887_295706_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016211347.1|295919_296903_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.7	2.1e-53
WP_016211340.1|296895_297117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211346.1|297144_297786_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	28.8	7.4e-07
WP_075274653.1|298317_299193_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|301654_302540_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007020.1|302544_302832_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_036774554.1|302884_303163_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126998.1|303261_303609_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_032126997.1|303930_304170_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_075273532.1|304387_304975_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300314.1|304935_305271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211315.1|305458_306103_-	porin family protein	NA	NA	NA	NA	NA
WP_016211316.1|306437_307088_-	porin family protein	NA	NA	NA	NA	NA
WP_016211319.1|307620_308673_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_075274654.1|308690_311771_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_054300384.1|312069_312885_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300202.1|313233_313962_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016209615.1|315228_315735_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_016209623.1|315752_317252_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_016209624.1|317273_317885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274867.1|317881_319054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777073.1|319085_321623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209626.1|321654_323547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278617.1|323551_323785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273639.1|323913_324630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209631.1|324632_327506_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_016209636.1|327506_327911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285919.1|327925_329110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764059.1|329088_329646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209633.1|329645_332594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209625.1|332596_333994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209630.1|334007_334748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209632.1|334728_335163_+	lipoprotein	NA	NA	NA	NA	NA
WP_016209618.1|335207_335837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209616.1|335907_336822_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_033923701.1|336852_340155_-	DUF490 domain-containing protein	NA	NA	NA	NA	NA
WP_016209627.1|340151_341975_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_016209617.1|342014_342413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209621.1|342533_343538_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_016209619.1|343970_345419_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_036777066.1|345505_348562_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_081007073.1|348544_348715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046976.1|348780_348918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274655.1|349214_349748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126753.1|350744_351209_-	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_016211466.1|351278_352799_-	RsmB/NOP family class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_032126752.1|352886_353489_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_016211464.1|353485_353833_-	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_016211465.1|353983_354967_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	2.9e-34
WP_054300318.1|355594_356572_+	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_052104629.1|356719_357745_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_052047087.1|358195_358414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274656.1|358585_359266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274657.1|359470_359899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300320.1|361044_361644_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300321.1|361861_362233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155049135.1|362656_362803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212346.1|363027_363174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126540.1|363407_364271_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016211749.1|364479_365673_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_016211748.1|365752_367357_+	cytochrome d ubiquinol oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211752.1|367372_368518_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_129556531.1|368722_368920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|368882_369221_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|369180_369636_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016212445.1|369881_370148_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_016212446.1|370510_371272_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.1	1.2e-48
WP_081007023.1|371306_371963_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016212534.1|372039_372306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211725.1|373876_374791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300323.1|377150_377744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|377987_379013_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075273534.1|379375_380257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300325.1|380450_380723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300326.1|380824_381289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046975.1|381702_382152_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_016212459.1|382271_382652_+	glycine-zipper containing OmpA-like membrane domain protein	NA	NA	NA	NA	NA
WP_054300328.1|382789_383566_-	class I SAM-dependent methyltransferase	NA	R4ZD91	Adoxophyes_honmai_entomopoxvirus	25.5	8.1e-16
WP_155047167.1|383676_385194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274659.1|385243_386305_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211456.1|386926_387505_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	36.3	2.2e-13
WP_122942091.1|387532_387928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211455.1|388033_389491_-	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_016211452.1|389552_391040_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_016211454.1|391790_392261_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_129556641.1|396214_397477_+	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_016210751.1|397564_399370_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_016210752.1|399853_400651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210749.1|400820_401282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210748.1|401580_403536_-	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_016212182.1|404216_404402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212185.1|404735_405725_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016211834.1|409098_409413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307365.1|409670_409931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300334.1|409950_410439_+	protein kinase	NA	A0A285PXS3	Cedratvirus	32.2	5.3e-05
WP_155046972.1|411962_412553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|412812_413070_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779544.1|413069_414077_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_054300338.1|414101_415667_-	APC family permease	NA	NA	NA	NA	NA
WP_016210800.1|415872_416700_-	DsbA family protein	NA	NA	NA	NA	NA
WP_075273540.1|417066_417678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556527.1|417862_418123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210799.1|418296_419250_+	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_052104738.1|420246_421053_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210795.1|421158_422130_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016210801.1|422111_423083_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_081007027.1|423405_423591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007028.1|424375_424831_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|424790_425129_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211352.1|425302_425743_-	universal stress protein	NA	NA	NA	NA	NA
WP_016211350.1|426421_427360_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_032127067.1|429413_430016_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211351.1|430012_430351_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_129556640.1|430426_431653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300339.1|432209_433181_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.2e-25
WP_016211856.1|433396_433582_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_016211855.1|433708_434176_+	bacterioferritin	NA	NA	NA	NA	NA
WP_016211857.1|434172_435051_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_032126602.1|435301_436609_+	MFS transporter	NA	NA	NA	NA	NA
WP_081007004.1|436761_437217_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|437176_437515_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|438476_439382_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	454129	504919	3054745	transposase	Staphylococcus_phage(25.0%)	50	NA	NA
WP_054300271.1|454129_455104_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155047162.1|455123_455561_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300249.1|455575_455941_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210855.1|456094_457072_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016210847.1|458665_459670_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_016210851.1|459692_460364_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016210850.1|460348_461602_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126446.1|461850_462405_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.7	3.2e-06
WP_016210848.1|462988_464173_+	MFS transporter	NA	NA	NA	NA	NA
WP_051307341.1|464339_465938_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.9	1.5e-56
WP_081007030.1|466631_467603_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300343.1|467638_467866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|467869_468756_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_081007031.1|468843_469116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007032.1|469249_469519_+	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	63.2	9.3e-12
WP_016209794.1|469746_470370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300344.1|470415_472359_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1U9WQS3	Geobacillus_phage	23.9	1.1e-05
WP_016209788.1|472480_473233_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155764060.1|473236_473659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556639.1|474037_474448_+	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209775.1|474464_474920_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_016209797.1|474916_475408_+	flagellar biosynthetic protein FliO	NA	NA	NA	NA	NA
WP_080664822.1|475404_476154_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_016209776.1|476183_476453_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_016209787.1|476468_477254_+	flagellar biosynthetic protein FliR	NA	NA	NA	NA	NA
WP_016209786.1|477267_478401_+	flagellar biosynthesis protein FlhB	NA	NA	NA	NA	NA
WP_016209770.1|478435_480529_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_016209767.1|480559_482020_+	flagellar biosynthesis protein FlhF	NA	NA	NA	NA	NA
WP_129556524.1|482000_482888_+	MinD/ParA family protein	NA	NA	NA	NA	NA
WP_016209784.1|482884_483607_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
WP_017377132.1|483693_484077_+	response regulator	NA	NA	NA	NA	NA
WP_016209769.1|484118_484862_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_036776682.1|484874_486899_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_051307317.1|486960_487254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209791.1|487390_488113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209771.1|488277_489000_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_032126436.1|489706_490162_+	SUF system Fe-S cluster assembly regulator	NA	NA	NA	NA	NA
WP_016209793.1|490177_491626_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_016209795.1|491666_492422_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	24.6	1.3e-10
WP_080664823.1|492402_493803_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_016209796.1|493826_495044_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.0	2.9e-92
WP_016209778.1|495074_495449_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_016209772.1|495467_496019_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_054300271.1|497299_498274_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300148.1|498371_499433_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|499987_500962_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|501652_502228_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|502173_502539_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300345.1|502675_503755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300162.1|503836_504919_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
>prophage 5
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	515990	636764	3054745	transposase,integrase,tRNA,protease	Staphylococcus_phage(16.0%)	103	530745:530804	634391:634680
WP_016211669.1|515990_516341_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|517164_518139_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556522.1|519449_520682_+	MFS transporter	NA	S4TR35	Salmonella_phage	23.2	9.0e-17
WP_016211405.1|520888_522661_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	41.9	4.9e-08
WP_016211403.1|522796_523840_+	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_016211399.1|523853_524597_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_032126682.1|524704_525031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144019306.1|525092_525272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211732.1|525347_526046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211733.1|527913_528738_-	DNA/RNA non-specific endonuclease	NA	X2KR27	Campylobacter_phage	28.3	2.4e-05
WP_054300161.1|529352_530414_-|transposase	transposase	transposase	NA	NA	NA	NA
530745:530804	attL	CCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_016212266.1|531039_531687_-	LysE family translocator	NA	NA	NA	NA	NA
530745:530804	attL	CCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTT	NA	NA	NA	NA
WP_016212267.1|531967_532327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|532493_532949_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|532908_533247_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211482.1|533382_535656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126823.1|535644_536367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104609.1|536477_537110_+	MarC family protein	NA	NA	NA	NA	NA
WP_098082850.1|537145_537322_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_016211481.1|537396_538539_-	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_032126825.1|538771_540085_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	3.5e-51
WP_054300349.1|540636_542361_+	protein kinase	NA	M1I1A9	Paramecium_bursaria_Chlorella_virus	25.6	1.7e-05
WP_155046942.1|543512_544398_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556521.1|544932_545121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|545071_546225_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_155046729.1|546442_547489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211631.1|547747_548554_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_054300351.1|548809_549631_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211632.1|549666_550521_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_016211627.1|550746_550911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155066176.1|551264_551534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|551542_552696_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032126362.1|553204_553570_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|553515_554091_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210103.1|554443_555802_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.2	7.7e-70
WP_016210117.1|556083_556443_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_016210111.1|556863_558498_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.9	9.7e-144
WP_017377579.1|558504_559341_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_016210099.1|559362_560640_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	2.5e-139
WP_016210105.1|560723_561044_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_016210106.1|561063_562155_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_016210110.1|563986_564742_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.0	5.4e-65
WP_016210113.1|564929_565979_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	31.5	7.9e-30
WP_016210101.1|567609_569106_+	flagellin domain protein	NA	NA	NA	NA	NA
WP_016210107.1|569395_569668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764061.1|569739_570639_-	phosphoesterase	NA	NA	NA	NA	NA
WP_155764062.1|570719_570998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210108.1|571090_572356_-	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	9.1e-49
WP_122943012.1|572541_572997_+	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_016210112.1|573113_574541_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	35.0	2.5e-55
WP_054300565.1|575234_575735_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_054300353.1|581761_581989_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046967.1|582039_582654_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	S5WIU1	Leptospira_phage	40.1	1.5e-33
WP_054300271.1|582792_583767_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_155046966.1|583839_584220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046731.1|584180_585065_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300355.1|585055_585241_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211563.1|585451_585613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211564.1|585645_586521_-	ParA family protein	NA	NA	NA	NA	NA
WP_052104693.1|586686_590553_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.2	1.9e-49
WP_080728343.1|590634_590775_-	hypothetical protein	NA	A0A0U2RK18	Escherichia_phage	69.0	1.6e-07
WP_081007034.1|590756_591041_-|transposase	IS1 family transposase	transposase	NA	NA	NA	NA
WP_129556518.1|591326_592724_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
591078:591366	attR	CCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_016211991.1|593632_594538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
591078:591366	attR	CCGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTTAGCAGAGCGGAGTTGCGAAAGACCGTTAGGTCTGTAGCAAGCGTAACGAGTGTCTAAAAATCTATACGAACCGTAGAGTCATGTGAGAGCACAGTGGTGGAGTGTGCCGATTCAAGGCACGCAACGCTGTGTGACGCGGACAGCCGAGGGTTTATAGTCGTCGCGTTTTGCTCGGCGATTTTGCATCATTGGATGTGCAAAATACCTACCGAGGTAGCGACGCTTACG	NA	NA	NA	NA
WP_032126537.1|594778_594964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211994.1|595000_595537_-	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_016212012.1|598032_598710_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_016212013.1|598725_599109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212011.1|599330_600452_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_075274660.1|600685_601555_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300148.1|601512_602574_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211974.1|602998_604120_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_075273551.1|604219_604522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556638.1|604521_605202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046942.1|605780_606666_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155764063.1|606663_607509_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	34.2	8.0e-25
WP_081377865.1|607505_607790_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080664876.1|608148_610011_-	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_054300359.1|610235_610808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274736.1|611166_612204_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377353.1|613029_613695_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300271.1|613734_614709_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211144.1|615265_615895_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_036779218.1|615878_616301_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016211145.1|616307_618047_+	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	30.8	8.4e-53
WP_016211153.1|618047_619112_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_016211147.1|619115_619469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211146.1|619581_620538_+	ferrochelatase	NA	NA	NA	NA	NA
WP_016211151.1|620547_620859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211143.1|620874_621444_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_016211148.1|621707_623036_+	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_054300271.1|623207_624182_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210841.1|624395_624767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210839.1|624825_625599_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155046965.1|625750_628207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126340.1|628486_629248_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556513.1|629328_631074_-	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016210843.1|632462_632693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556637.1|633307_634087_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_016212589.1|634561_634999_-	MFS transporter	NA	NA	NA	NA	NA
WP_155047262.1|635387_635504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300363.1|635895_636243_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046964.1|636188_636764_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	668699	844380	3054745	transposase,tRNA,protease	Vibrio_phage(16.0%)	153	NA	NA
WP_075274663.1|668699_669575_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_032126803.1|669697_670930_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	26.6	7.5e-32
WP_016211764.1|671130_671952_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016211289.1|674925_675198_-	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	53.4	3.2e-12
WP_016211286.1|675308_675656_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_016211285.1|675673_676453_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_016211280.1|676452_676962_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_016211283.1|676997_677246_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_016211281.1|677557_677893_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211282.1|678187_679438_+	MFS transporter	NA	NA	NA	NA	NA
WP_032126762.1|679519_681547_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_016210148.1|682382_682601_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_016210147.1|683461_684634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036777648.1|684646_686644_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_016210142.1|686624_687605_-	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075273562.1|687664_688534_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_016210153.1|688533_688938_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_016210157.1|689371_690001_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_016210144.1|690543_692733_+	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_016210150.1|692744_693950_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_081377354.1|693934_695785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080664835.1|695772_696999_+	MFS transporter	NA	NA	NA	NA	NA
WP_016210156.1|696991_698860_+	ferric iron reductase FhuF-like transporter family protein	NA	NA	NA	NA	NA
WP_016210149.1|698893_700138_+	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_016210155.1|700143_700953_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.9	3.8e-16
WP_016210154.1|700991_701684_-	haloacid dehalogenase	NA	NA	NA	NA	NA
WP_016210146.1|701805_702297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046720.1|702646_702820_+	phosphatase	NA	NA	NA	NA	NA
WP_075273565.1|702957_703848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046721.1|704028_704196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|704367_705342_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300373.1|705338_706196_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209842.1|706923_707313_-	flagellar basal body-associated FliL family protein	NA	NA	NA	NA	NA
WP_016209834.1|707489_708248_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_016209829.1|708244_710644_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.5	2.7e-70
WP_016209839.1|712023_713322_-	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	33.5	1.2e-64
WP_016209838.1|713519_714413_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_016209836.1|714412_715627_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_032126639.1|715646_716933_-	GTPase HflX	NA	NA	NA	NA	NA
WP_016209846.1|716948_717203_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_016209830.1|717438_718806_-	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_016209826.1|719136_720159_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_016209845.1|720681_722157_+	APC family permease	NA	NA	NA	NA	NA
WP_129556633.1|722373_723270_+	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016209827.1|723588_725148_+	SH3 domain of the SH3b1 type family protein	NA	NA	NA	NA	NA
WP_016209831.1|725636_726335_+	DUF3865 domain-containing protein	NA	NA	NA	NA	NA
WP_016209832.1|726613_726877_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_016209835.1|729773_730256_-	regulatory protein RecX	NA	NA	NA	NA	NA
WP_016209844.1|730233_731274_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	1.3e-117
WP_016209840.1|731446_731932_-	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.2	1.2e-36
WP_032126641.1|732039_734610_+	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	22.9	3.9e-30
WP_075278621.1|734645_734987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126643.1|735175_735382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211648.1|736584_737124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211650.1|737783_739268_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_016211651.1|739392_740928_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_032126362.1|741161_741527_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556556.1|741472_742048_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126540.1|742080_742944_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_080728346.1|742961_743294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046723.1|744201_744357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210928.1|744515_744821_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_016210929.1|744855_745212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046724.1|745208_745376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210921.1|745600_746185_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_016210925.1|746276_746963_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.5	9.7e-29
WP_032126561.1|747086_748271_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016210917.1|748484_749927_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.5	5.4e-21
WP_016210927.1|750051_751002_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210930.1|751062_751836_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_016210918.1|751839_752589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210926.1|752673_754143_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_155046963.1|754402_754969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273571.1|755074_755752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211012.1|755901_756474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778113.1|756582_758085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274665.1|758177_760607_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036778111.1|760885_762082_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_075273574.1|762129_764496_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_032126565.1|764813_765086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|765296_765662_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|765607_766183_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_052104776.1|766186_766654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211833.1|767284_767785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|768200_768554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211831.1|768854_770582_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_081007040.1|770719_771376_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_016210510.1|771406_772135_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	7.6e-32
WP_016210506.1|772127_773366_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016210512.1|773501_774539_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_016210515.1|774592_775495_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	2.7e-55
WP_016210514.1|775603_776857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210509.1|776914_780412_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_075273576.1|780471_781200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210507.1|781327_781876_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_075285928.1|782484_782871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285929.1|782945_784181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|784189_785343_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_032127044.1|786244_786445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046961.1|786564_786969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|787136_787502_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_081377355.1|788862_789231_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211467.1|789305_789872_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	1.6e-74
WP_032126344.1|789874_790963_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_032126343.1|791083_791896_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_054300379.1|792026_794012_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_016211470.1|794071_794725_-	tyrosine phosphatase	NA	NA	NA	NA	NA
WP_105962623.1|795326_796480_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_054300380.1|796790_797447_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300381.1|797910_798558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|799952_801014_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211841.1|801873_802326_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211839.1|802443_803916_-	catalase	NA	A0A2K9L572	Tupanvirus	46.5	5.0e-99
WP_016211840.1|804074_804539_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_016211838.1|805009_805183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|805892_806258_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|806203_806779_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|806768_807428_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_032126143.1|807527_808799_-	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	25.5	9.6e-14
WP_016211422.1|808887_809358_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_051307357.1|809380_809974_-	oligoribonuclease	NA	M4M9I5	Vibrio_phage	34.1	7.1e-20
WP_016211417.1|810110_811160_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_016211415.1|811183_812107_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_016211418.1|812123_812585_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_016211414.1|812692_813511_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075273327.1|813724_814300_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|814245_814611_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300380.1|814814_815471_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300382.1|815741_816164_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300383.1|816434_818915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126139.1|819010_819940_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_016210804.1|819946_821866_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.0	4.5e-84
WP_032126141.1|821930_823205_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_016210805.1|823623_824295_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_036776426.1|824303_825155_-	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_016210803.1|825332_826631_+	PAS domain S-box protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
WP_016212040.1|827991_829341_-	DNA recombination protein RmuC	NA	NA	NA	NA	NA
WP_016212039.1|829517_830075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052133287.1|830263_830662_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_105962624.1|830717_832085_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.3	9.6e-12
WP_054300384.1|832493_833309_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_075285930.1|833470_833878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764064.1|833838_834006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126846.1|834167_834773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764065.1|834961_835213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126789.1|835744_835927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211219.1|836276_837554_-	FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	NA	NA	NA	NA	NA
WP_081377356.1|837550_837688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274667.1|838199_839801_+	cytochrome d terminal oxidase subunit 1	NA	NA	NA	NA	NA
WP_016211221.1|839817_840960_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_054300386.1|841212_841950_-	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_016211224.1|841974_843246_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_032126790.1|843474_844380_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	880947	944226	3054745	transposase,tRNA	uncultured_Mediterranean_phage(36.36%)	58	NA	NA
WP_054300392.1|880947_882009_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300393.1|882551_883133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300394.1|883095_883458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212000.1|883588_884317_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_016212002.1|884436_884715_+	DNA-J related family protein	NA	NA	NA	NA	NA
WP_075273298.1|884718_885294_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046705.1|885239_885407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300397.1|885647_885893_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047008.1|885950_886265_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_016210889.1|886282_889129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210887.1|889638_890589_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_016210886.1|890671_891451_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_016210883.1|891519_892227_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016210888.1|892187_892439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126206.1|892461_892758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210891.1|893291_894065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210892.1|894097_894694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300398.1|894751_895633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300399.1|897080_897347_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075285932.1|897491_897725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764066.1|897908_898316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|899388_899742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300401.1|900073_900355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211823.1|900734_900923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285933.1|900957_904806_-	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_075285934.1|904793_905102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211770.1|905301_906435_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_016211771.1|906448_906637_-	Trm112 family protein	NA	NA	NA	NA	NA
WP_054300403.1|906929_907904_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	2.0e-27
WP_075273594.1|907943_909314_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	27.4	4.2e-39
WP_054300404.1|909386_910280_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209948.1|910388_911306_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_016209943.1|911357_912113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209939.1|912180_913455_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.2	1.7e-90
WP_016209927.1|913589_914267_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209944.1|914466_915894_+	aminodeoxychorismate synthase component I	NA	S4VNU7	Pandoravirus	29.8	4.2e-42
WP_016209938.1|915868_916507_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_016209925.1|916716_916995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209935.1|917228_918173_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	3.2e-38
WP_036777561.1|918194_920063_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_016209930.1|920083_920437_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	45.7	3.1e-07
WP_036777579.1|920475_921591_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	48.9	4.8e-94
WP_016209932.1|921773_922814_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_016209945.1|922816_923851_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_016209926.1|923847_924909_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_016209931.1|925020_926493_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.4	7.9e-44
WP_052104625.1|926645_927089_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_016209940.1|927163_929935_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.3	1.8e-150
WP_036777555.1|930091_931321_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|931347_932010_-	carbonic anhydrase	NA	NA	NA	NA	NA
WP_054300405.1|932531_933032_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_081377365.1|933087_934239_-	group II intron reverse transcriptase/maturase	NA	A0A0N7AE80	Bacillus_phage	24.8	7.6e-10
WP_075274669.1|934443_934746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007042.1|935154_935970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300406.1|938268_941004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274670.1|941304_942366_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126856.1|942426_942768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|943072_944226_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 8
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	947276	1014376	3054745	transposase,tRNA	Staphylococcus_phage(20.0%)	54	NA	NA
WP_016210592.1|947276_947933_-|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_016210586.1|947945_949451_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	41.0	1.7e-86
WP_016210593.1|949472_950003_-	colicin V production protein	NA	NA	NA	NA	NA
WP_016210590.1|950082_951345_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_032126176.1|952480_953263_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_016210588.1|953353_954679_-	fimV domain protein	NA	NA	NA	NA	NA
WP_016210595.1|955045_956224_-	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_016210594.1|956400_957054_-	glutaredoxin 2	NA	NA	NA	NA	NA
WP_129556498.1|959125_959734_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300271.1|959913_960888_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080728317.1|961078_964444_+	MFS transporter	NA	NA	NA	NA	NA
WP_016211391.1|964510_965086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764067.1|965097_966465_-	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_075285937.1|966672_967353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059372269.1|967709_968081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274671.1|968447_969011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212252.1|969325_969484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212254.1|969521_970964_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_155046731.1|970953_971839_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274672.1|971876_972470_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155046942.1|972762_973649_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211114.1|973794_976725_-	peptidase M16 inactive domain protein	NA	NA	NA	NA	NA
WP_016211115.1|976857_978810_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.0	2.7e-44
WP_016211112.1|979002_979650_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211113.1|979705_981031_+	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.7e-37
WP_032126179.1|981060_981312_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_080664854.1|981269_981851_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300408.1|982187_982844_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	9.6e-10
WP_032126362.1|982894_983260_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|983205_983781_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016209823.1|985001_985445_-	response regulator	NA	NA	NA	NA	NA
WP_016209809.1|985869_986358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209817.1|986464_987433_+	plasmid replication region DNA-binding domain protein	NA	NA	NA	NA	NA
WP_075285938.1|988134_989025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285939.1|988988_991433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209803.1|991491_992529_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209810.1|992732_994646_-	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.3	6.9e-117
WP_036777933.1|995484_996609_-	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_016209800.1|996605_997202_-	recombination protein RecR	NA	NA	NA	NA	NA
WP_016209821.1|997232_997565_-	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_016209812.1|997654_999478_-	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	9.7e-44
WP_054300409.1|999924_1001637_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	4.3e-25
WP_016209815.1|1001954_1002494_+	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_016209799.1|1002880_1003297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209818.1|1003392_1004208_+	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_016209805.1|1004340_1005834_+	neurotransmitter symporter family protein	NA	NA	NA	NA	NA
WP_032126324.1|1006012_1006435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209801.1|1006434_1008489_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_016209813.1|1008773_1009589_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_036778458.1|1009689_1010508_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_016209808.1|1010504_1010873_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_016209806.1|1011215_1011365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212343.1|1012177_1012984_+	SDR family NAD(P)-dependent oxidoreductase	NA	W8CYX9	Bacillus_phage	42.9	7.7e-09
WP_129556499.1|1013222_1014376_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
>prophage 9
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1020893	1066038	3054745	transposase,tRNA	Bacillus_phage(20.0%)	47	NA	NA
WP_032126637.1|1020893_1021187_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_032126540.1|1021417_1022281_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300410.1|1022414_1022780_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273298.1|1022725_1023301_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126332.1|1023947_1025147_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_016211366.1|1025399_1025687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779263.1|1025742_1027752_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_032126330.1|1027806_1028766_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_016211367.1|1028913_1029696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273303.1|1029851_1030568_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_016210281.1|1030581_1031973_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_016210270.1|1032014_1035002_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_016210277.1|1035071_1035905_-	mannosyl-glycoendo-beta-N-acetylglucosaminidase	NA	NA	NA	NA	NA
WP_016210279.1|1035958_1037125_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_016210272.1|1037112_1037823_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_016210283.1|1037862_1038648_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_129556492.1|1038675_1039419_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1039516_1041712_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_016210271.1|1041787_1042471_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_032126334.1|1042481_1042913_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_016210274.1|1042952_1043351_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_016210273.1|1043723_1044431_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_016210275.1|1044495_1044798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210276.1|1044853_1045330_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_016210284.1|1045384_1045906_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	1.7e-25
WP_016210280.1|1045987_1047082_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_054300412.1|1047318_1047633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273307.1|1047777_1048188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300414.1|1048458_1048944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300415.1|1049607_1050309_+	dual specificity protein phosphatase family protein	NA	A0A068QKX9	Armadillidium_vulgare_iridescent_virus	33.0	1.6e-07
WP_032126500.1|1050442_1051159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211118.1|1051295_1052543_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.1e-14
WP_016211122.1|1053628_1054495_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|1054498_1055260_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_036779309.1|1055423_1056329_+	polyprenyl synthetase	NA	NA	NA	NA	NA
WP_016211125.1|1056551_1057382_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_016211126.1|1057551_1057941_+	lipoprotein	NA	NA	NA	NA	NA
WP_054300416.1|1058073_1059024_+	methyl-accepting chemotaxis protein	NA	NA	NA	NA	NA
WP_016212585.1|1059318_1059639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1059750_1060725_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273327.1|1061094_1061670_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1061615_1061981_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274673.1|1061941_1062940_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274674.1|1062917_1063763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300422.1|1063813_1064251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212519.1|1064521_1064902_-	taurine catabolism dioxygenase TauD, TfdA family protein	NA	NA	NA	NA	NA
WP_054300423.1|1064976_1066038_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1083607	1127040	3054745	transposase	Staphylococcus_phage(40.0%)	46	NA	NA
WP_105962625.1|1083607_1084493_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212290.1|1084497_1085823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|1085939_1087001_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126869.1|1086978_1087218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|1087738_1088314_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1088259_1088625_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126540.1|1089663_1090527_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_105962625.1|1090545_1091432_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155047109.1|1091493_1091907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1092053_1093028_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_129556488.1|1093086_1093937_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075274679.1|1094085_1095147_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212218.1|1096595_1096946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285943.1|1097090_1097927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778728.1|1097980_1099273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300430.1|1099508_1102265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046955.1|1103420_1103600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211521.1|1103841_1104543_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126841.1|1104803_1105010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941967.1|1105239_1105545_-	DUF4325 domain-containing protein	NA	NA	NA	NA	NA
WP_032126840.1|1105723_1107721_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|1107704_1108751_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016212098.1|1109471_1110323_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_016212100.1|1110323_1111244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212654.1|1111654_1111939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1111930_1112386_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1112345_1112684_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212093.1|1112896_1113826_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.1	3.7e-31
WP_129556559.1|1113982_1114411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556560.1|1114491_1115028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|1114997_1115903_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_080728345.1|1116071_1116680_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075285944.1|1116720_1117287_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_155764071.1|1117249_1117408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1117513_1118666_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_016211971.1|1119160_1119772_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_032126649.1|1119792_1120989_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.5	1.2e-42
WP_017377024.1|1121085_1121226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211968.1|1121238_1121643_-	SufE family protein	NA	NA	NA	NA	NA
WP_155046954.1|1121797_1121971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007044.1|1122077_1122395_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300431.1|1122354_1122657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046743.1|1122801_1122987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300573.1|1124164_1125298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211960.1|1125561_1126089_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_081377359.1|1126410_1127040_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1148195	1203585	3054745	transposase,tRNA,protease	Vibriophage(16.67%)	49	NA	NA
WP_016209884.1|1148195_1148819_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036777115.1|1148895_1149096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209891.1|1149237_1149936_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_016209896.1|1150082_1150652_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_122940402.1|1150966_1151590_-	porin family protein	NA	NA	NA	NA	NA
WP_032126745.1|1151798_1152401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1153581_1154468_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_075273603.1|1154547_1154724_+	phosphatase	NA	NA	NA	NA	NA
WP_016212526.1|1154847_1155381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126686.1|1156712_1157297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063519.1|1158770_1159187_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210465.1|1159473_1160316_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	5.2e-32
WP_016210463.1|1160366_1160714_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_016210471.1|1160904_1161792_+	ROK family protein	NA	NA	NA	NA	NA
WP_016210467.1|1161906_1162509_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_016210468.1|1162505_1163225_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_054300435.1|1163293_1165006_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_036777098.1|1165153_1167091_+	AsmA family protein	NA	NA	NA	NA	NA
WP_016210461.1|1168250_1168526_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_016210458.1|1168606_1169155_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_054300436.1|1169471_1172063_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_016210459.1|1172227_1172746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285947.1|1172950_1174069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211720.1|1174316_1175240_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211716.1|1175253_1176177_+	PAS and helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126595.1|1176124_1176781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211719.1|1177083_1177911_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_052133280.1|1178351_1178723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126590.1|1178915_1180448_+	nuclease	NA	NA	NA	NA	NA
WP_032126591.1|1180510_1181848_-	N-succinylarginine dihydrolase	NA	NA	NA	NA	NA
WP_016210313.1|1181990_1183457_-	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_016210314.1|1183453_1184503_-	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_054300438.1|1184626_1186741_-	ATP-dependent DNA helicase RecG	NA	NA	NA	NA	NA
WP_016210305.1|1186905_1187310_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_016210308.1|1187370_1188096_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_016210307.1|1188181_1189072_+	YicC family protein	NA	NA	NA	NA	NA
WP_032126592.1|1189112_1189733_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	36.3	2.5e-20
WP_016210310.1|1189793_1190000_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_016210316.1|1190021_1192175_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.1e-12
WP_054300439.1|1192181_1194164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046953.1|1194435_1194576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556499.1|1194584_1195738_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	1.5e-58
WP_054300440.1|1196034_1197246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274682.1|1197390_1197822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300442.1|1198033_1200130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211538.1|1200824_1201748_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	42.1	1.1e-24
WP_054300443.1|1201986_1202265_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007046.1|1202317_1202566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300444.1|1202523_1203585_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1210886	1268172	3054745	transposase	Staphylococcus_phage(35.71%)	57	NA	NA
WP_054300148.1|1210886_1211948_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075274683.1|1212042_1212606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210829.1|1212875_1213895_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_016210832.1|1213881_1214304_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_016210828.1|1214305_1214779_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.8	6.9e-26
WP_052133275.1|1214894_1215518_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.7	1.1e-39
WP_016210836.1|1215547_1216222_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	3.0e-30
WP_016210835.1|1216227_1217376_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	1.0e-43
WP_032126465.1|1217372_1217834_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_016210830.1|1217909_1219160_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.7	6.3e-103
WP_016210824.1|1219286_1220966_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.7	4.3e-38
WP_016210826.1|1221075_1221942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300446.1|1223372_1224107_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.9	1.1e-09
WP_036781250.1|1224202_1224988_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_155046951.1|1225794_1226058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211002.1|1226139_1226538_-	VOC family protein	NA	NA	NA	NA	NA
WP_016211001.1|1226701_1227007_-	competence protein ComEA	NA	NA	NA	NA	NA
WP_016210998.1|1227084_1227339_-	LapA family protein	NA	NA	NA	NA	NA
WP_032126469.1|1227492_1229154_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_016210997.1|1229213_1229897_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_080664849.1|1229896_1230985_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	4.9e-75
WP_054300447.1|1231033_1233670_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	2.0e-98
WP_054300173.1|1234082_1235144_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300448.1|1235333_1237703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300276.1|1237746_1238721_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	4.0e-28
WP_054300449.1|1238740_1239520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1239649_1239988_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1239947_1240403_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_054300450.1|1240728_1242048_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_016211505.1|1242051_1242768_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_016211506.1|1242764_1243406_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_081007048.1|1243398_1243497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007049.1|1243474_1243771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211503.1|1243781_1244237_-	cadmium-induced protein CadI	NA	NA	NA	NA	NA
WP_016211508.1|1244291_1244636_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_129556569.1|1246122_1246332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|1246321_1247208_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210192.1|1247520_1248039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210193.1|1248410_1248572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210194.1|1248628_1248976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036778869.1|1249010_1249673_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_036778872.1|1249716_1250322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210201.1|1250551_1251607_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.9	3.4e-49
WP_016210187.1|1251610_1254796_+	carbamoyl-phosphate synthase (glutamine-hydrolyzing) large subunit	NA	NA	NA	NA	NA
WP_016210205.1|1254876_1255833_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	39.6	5.3e-49
WP_016210206.1|1255881_1256418_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	38.4	8.4e-20
WP_016210199.1|1256414_1257176_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_036778866.1|1257281_1259870_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	36.9	3.3e-122
WP_032126472.1|1260332_1260983_-	DUF1669 domain-containing protein	NA	NA	NA	NA	NA
WP_016210190.1|1261202_1262078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210195.1|1262268_1262670_+	cytidine deaminase	NA	NA	NA	NA	NA
WP_016210198.1|1262686_1263238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210188.1|1263549_1264236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285948.1|1264236_1265280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285949.1|1265480_1266446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210196.1|1266799_1267153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274684.1|1267110_1268172_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1335676	1383103	3054745	transposase,tRNA	Acinetobacter_phage(16.67%)	43	NA	NA
WP_087910645.1|1335676_1336829_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_051307322.1|1336899_1337079_+	DDE endonuclease	NA	NA	NA	NA	NA
WP_016212612.1|1337926_1338160_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_054300455.1|1338253_1338619_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|1338633_1339140_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212572.1|1339197_1339590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300209.1|1339719_1340085_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075274691.1|1340141_1340450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|1340541_1341117_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|1341062_1341428_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728364.1|1341580_1341853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126774.1|1342461_1342797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307356.1|1342956_1344489_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_016211407.1|1344521_1345361_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211411.1|1345357_1345855_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_016211412.1|1345858_1346851_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_016211408.1|1346965_1348312_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_054300173.1|1348534_1349596_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212287.1|1349674_1350820_+|tRNA	multifunctional tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/2'phosphatase	tRNA	A0A0F6YPT7	Sinorhizobium_phage	41.7	2.7e-60
WP_016211372.1|1356631_1357489_-	PIG-L family deacetylase	NA	NA	NA	NA	NA
WP_016211371.1|1357475_1358399_-	badF/BadG/BcrA/BcrD ATPase	NA	NA	NA	NA	NA
WP_016211368.1|1358595_1359987_+	sugar porter family MFS transporter	NA	NA	NA	NA	NA
WP_016211369.1|1360033_1361077_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	28.4	5.2e-18
WP_016211370.1|1361119_1361563_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211374.1|1361695_1362886_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_016211373.1|1362940_1363087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212140.1|1363637_1364555_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_036794860.1|1364822_1365116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664878.1|1365192_1365387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300462.1|1366405_1367323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210876.1|1367788_1368631_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_016210873.1|1368698_1369349_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	36.6	4.1e-21
WP_016210874.1|1369363_1370404_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.0	1.5e-68
WP_016210882.1|1370526_1371612_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_016210872.1|1371638_1372748_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_016210871.1|1372764_1373082_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_016210879.1|1373078_1373438_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_080664847.1|1376769_1377723_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_054300173.1|1377795_1378857_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212048.1|1379620_1380178_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_032126664.1|1380371_1381055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126663.1|1381772_1382015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300464.1|1382041_1383103_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1471351	1559820	3054745	transposase,integrase,tRNA	Escherichia_phage(39.29%)	85	1496659:1496718	1559280:1559888
WP_054300202.1|1471351_1472080_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016210945.1|1472273_1472864_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_016210946.1|1472990_1474376_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_016210947.1|1474469_1474667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075285956.1|1474903_1475578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126574.1|1476084_1476462_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_016210948.1|1476474_1476711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210951.1|1476710_1476917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779389.1|1477099_1477819_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_016210954.1|1477907_1479692_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_036779399.1|1479790_1480045_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_144019244.1|1480401_1481013_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_054300202.1|1481500_1482229_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211812.1|1482310_1483924_-	DEAD/DEAH box helicase	NA	A0A2I7RG64	Vibrio_phage	32.6	9.2e-62
WP_016211816.1|1483965_1484319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126570.1|1484331_1484631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|1484847_1485576_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211951.1|1485752_1486850_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.3	3.9e-48
WP_016211949.1|1486883_1488134_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.3	1.6e-93
WP_054300202.1|1488273_1489002_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212193.1|1489124_1489463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212195.1|1489530_1489917_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_016212196.1|1489913_1490159_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300475.1|1490567_1491296_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
WP_016211625.1|1491779_1492649_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	1.2e-68
WP_036779883.1|1492645_1493995_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.2	2.1e-75
WP_016211623.1|1494107_1495748_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_054300477.1|1496470_1497199_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	5.6e-43
1496659:1496718	attL	CATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGA	NA	NA	NA	NA
WP_054300478.1|1497478_1499215_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	44.0	1.3e-24
WP_054300202.1|1499554_1500283_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016212214.1|1500441_1500942_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016212213.1|1500916_1501426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|1502025_1502754_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_054300479.1|1502904_1503945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211653.1|1504142_1505168_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	78.8	2.3e-18
WP_016211652.1|1505275_1506481_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	2.5e-35
WP_016211655.1|1506740_1507154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211654.1|1507282_1507852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211657.1|1507855_1508188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300480.1|1508180_1509020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211047.1|1509107_1510742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211051.1|1511103_1511607_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	43.5	1.1e-13
WP_016211050.1|1511569_1512277_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_016211044.1|1512345_1513206_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_036777969.1|1513186_1513960_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016211052.1|1513990_1515244_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_016211049.1|1515243_1516206_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_016211056.1|1516249_1517002_+	ComF family protein	NA	NA	NA	NA	NA
WP_032126362.1|1518537_1518903_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1518848_1519424_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210615.1|1520330_1520801_-	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	35.7	2.1e-19
WP_016210624.1|1520846_1521086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777984.1|1521104_1521554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210617.1|1521774_1523199_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.4e-16
WP_016210618.1|1523263_1524313_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_051307334.1|1524579_1525359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556587.1|1525402_1526305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210625.1|1526363_1527110_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.8	1.3e-18
WP_016210616.1|1527358_1530169_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_081007053.1|1530403_1531264_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_054300481.1|1531365_1532094_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_080664881.1|1532183_1532390_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081007054.1|1532552_1533785_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.6	1.1e-27
WP_054300201.1|1535618_1536347_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_036780093.1|1536450_1537272_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211722.1|1537281_1540584_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.1	1.7e-54
WP_016211323.1|1542011_1543109_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.3	1.0e-27
WP_016211325.1|1543098_1544619_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	38.9	7.3e-85
WP_016211322.1|1544681_1545272_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_054300483.1|1545807_1546362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300484.1|1546858_1547806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212568.1|1548030_1548180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212659.1|1548324_1548570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046947.1|1548707_1548875_-	phosphatase	NA	NA	NA	NA	NA
WP_016212294.1|1549304_1549649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036776735.1|1549662_1550115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|1550111_1550330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|1550636_1550846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007056.1|1551147_1551357_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007057.1|1552684_1553101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|1553158_1554311_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016212230.1|1554367_1555816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126389.1|1557349_1557538_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046946.1|1558939_1559215_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_054300489.1|1559217_1559820_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	46.2	6.5e-37
1559280:1559888	attR	CATTTTCAATGCAGTTGTTTAAATACTTCACTCGCCTGAGTTTACACTGACTAGAAAAGACACCTTCATCTTTGGCTTTTTGGTGAGCGGGTGGAAATGAAGCGTGCTTGTCGACATTCACAACACGCGGTGATTTCACATAAGGTTGGGCGATTGCCTTTTTGAAAAAGCGCATCGCCGCTTTGGCATTTTGCTGTCGGCTGAGCATCCAGTCCAAAGTATGGCCATATTTATCAATGGCTCGATAAAGGTAATACCAACGACCTTTGATTTTCACCAACGTTTCATCTAACCGCCAAGAGGCACACGTTTGACGAAAGTGGGGCCTCAGCCGTTTGGCGATCTGCGAGCCATACTCGTGCACCCAGCGACAAATGGTTGAACGCTCAATCTCAAGACCTCTTTCAGCTGCTATTTCTTTGAGATCACGGTAAGATAAGGCATAGCGGCCATACCAACGCACCAGCCAAAGAATGATCTCACCGGAATAATGCTTCCATTTAAAGGGTTGATTCTTCTTAAATCGTTTACGTCTACCCACAGCAATTCACTCTTAACTTCCGTTGATTGCTACACCCTACTCAAATCTAAATTTTTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 15
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1605104	1656542	3054745	transposase,tRNA	Microbacterium_phage(12.5%)	53	NA	NA
WP_105962625.1|1605104_1605991_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556590.1|1606673_1607069_+	nucleic acid-binding protein	NA	NA	NA	NA	NA
WP_032126312.1|1607065_1607860_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211756.1|1608038_1608764_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_016211759.1|1609009_1610197_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_016210935.1|1610773_1611316_-	acireductone dioxygenase	NA	NA	NA	NA	NA
WP_016210943.1|1611312_1611999_-	acireductone synthase	NA	NA	NA	NA	NA
WP_036778484.1|1612002_1612614_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_016210944.1|1612660_1613680_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_016210936.1|1613781_1614576_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	5.3e-103
WP_016210931.1|1614597_1615404_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_016210941.1|1615482_1616532_-	pyridine nucleotide-disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_032126310.1|1616729_1617989_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	5.9e-24
WP_032126309.1|1618035_1618713_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_016210937.1|1618798_1619080_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_155046994.1|1619171_1620326_-	Bcr/CflA family efflux MFS transporter	NA	S4TR35	Salmonella_phage	25.6	2.1e-20
WP_016210820.1|1620595_1621537_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016210818.1|1622040_1622265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210811.1|1622556_1623261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300196.1|1623682_1624321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377821.1|1624655_1625186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779158.1|1625182_1626715_+	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_016210815.1|1626711_1627662_+	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_016210817.1|1628082_1628715_+	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210814.1|1628957_1629155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|1629504_1629933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300194.1|1630010_1630709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|1630686_1631748_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126306.1|1631972_1632269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556591.1|1632373_1633030_-	porin family protein	NA	NA	NA	NA	NA
WP_017377817.1|1633253_1633751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007004.1|1634960_1635416_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|1635375_1635714_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036778253.1|1635771_1637310_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_098082804.1|1637421_1638520_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_016210987.1|1638757_1639957_+	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_016210981.1|1639986_1640625_+	ribonuclease T	NA	NA	NA	NA	NA
WP_075285960.1|1640640_1641402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285961.1|1641479_1642823_-	protein kinase family protein	NA	A0A1S5XZ05	Kurlavirus	34.9	7.0e-07
WP_032126304.1|1643060_1643405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300193.1|1644450_1644657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212032.1|1646155_1647283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212033.1|1647406_1648069_-	O-methyltransferase	NA	NA	NA	NA	NA
WP_016212030.1|1648160_1648406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211963.1|1649479_1650139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211965.1|1650240_1650891_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_016211964.1|1651003_1651324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1651382_1652357_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_032126299.1|1652606_1652828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300192.1|1652850_1653072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300191.1|1653116_1654073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300190.1|1654567_1655530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046995.1|1655656_1656542_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1717231	1750615	3054745	transposase,tRNA,protease	Stx2-converting_phage(20.0%)	34	NA	NA
WP_054300173.1|1717231_1718293_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212415.1|1718383_1719130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300186.1|1719398_1720118_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300185.1|1720361_1720724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273422.1|1720910_1721438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556595.1|1721582_1721999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212038.1|1724081_1724993_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_016212036.1|1725044_1725893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126284.1|1726337_1727048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556596.1|1727139_1728108_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_032126283.1|1728095_1728743_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036779767.1|1728771_1729623_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_016210380.1|1729637_1730915_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_016210373.1|1730955_1731471_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_054300183.1|1731549_1732611_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_032126285.1|1732632_1733721_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_016210381.1|1735641_1736112_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|1736148_1736484_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080664840.1|1736496_1737213_-	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_129556597.1|1737149_1738166_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_016210384.1|1738162_1738642_-	LPS-assembly family protein	NA	NA	NA	NA	NA
WP_016210376.1|1738725_1741206_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	44.3	4.1e-194
WP_129556663.1|1741268_1741634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|1741972_1742311_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|1742270_1742726_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016210577.1|1742740_1743031_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777784.1|1743096_1744695_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.3	1.5e-08
WP_016210576.1|1744825_1745161_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_036777781.1|1745188_1746853_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.5	5.4e-33
WP_016210581.1|1746849_1747494_-	SCP-2 sterol transfer family protein	NA	NA	NA	NA	NA
WP_016210582.1|1747493_1748237_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_032126279.1|1748295_1748535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126276.1|1748685_1750053_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	30.1	9.5e-44
WP_032126275.1|1750063_1750615_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 17
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1903769	1969629	3054745	transposase	Erwinia_phage(18.18%)	55	NA	NA
WP_054300168.1|1903769_1904633_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075274701.1|1904929_1905982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046999.1|1906270_1906678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923654.1|1906891_1907383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211702.1|1907438_1908689_-	malic enzyme, NAD-binding domain protein	NA	NA	NA	NA	NA
WP_032127042.1|1908791_1909010_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_036777591.1|1909467_1910322_+	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_016210728.1|1910376_1910847_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_016210732.1|1911153_1912533_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	5.1e-53
WP_016210726.1|1912560_1913019_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	69.6	4.2e-52
WP_032126740.1|1912996_1914214_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.2	3.7e-39
WP_017375944.1|1914405_1914642_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|1914655_1914811_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_075274702.1|1914891_1915854_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210735.1|1916013_1917330_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_016210727.1|1917339_1918008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210734.1|1918370_1920185_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_016211543.1|1921670_1923422_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_016211544.1|1923432_1924233_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.6	5.8e-33
WP_016211545.1|1924335_1924824_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.7	2.4e-29
WP_032126435.1|1924996_1925311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375799.1|1926331_1926676_+	DMT family protein	NA	NA	NA	NA	NA
WP_016210038.1|1932368_1933331_-	D-2-hydroxyacid dehydrogenase	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	27.0	8.8e-20
WP_016210039.1|1933517_1934777_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|1935000_1935327_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_052104566.1|1935521_1936472_+	Ppx/GppA family phosphatase	NA	NA	NA	NA	NA
WP_032126434.1|1936529_1938596_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_016210049.1|1938601_1939597_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_016210042.1|1940182_1941763_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|1941919_1943329_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_016210047.1|1943388_1944522_-	cation transporter	NA	NA	NA	NA	NA
WP_016210033.1|1944661_1945486_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_016210034.1|1945713_1946343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|1946679_1947051_-	isochorismatase	NA	NA	NA	NA	NA
WP_016210046.1|1947354_1947642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126431.1|1947793_1948642_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_016210037.1|1948769_1949810_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_129556667.1|1949882_1951460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300165.1|1952103_1952763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|1952917_1953892_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300164.1|1953967_1954987_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556602.1|1955385_1955595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|1956469_1957552_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_054300161.1|1957599_1958661_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211201.1|1958741_1959050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211206.1|1959164_1960481_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007001.1|1960942_1962229_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_016211205.1|1962301_1963198_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211203.1|1963284_1964283_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_032126430.1|1964391_1964916_-	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_075285964.1|1965163_1966144_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.1	4.8e-13
WP_075285965.1|1966155_1966527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212222.1|1966948_1967422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556669.1|1967418_1967814_-	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_155046731.1|1968743_1969629_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	1979390	2033644	3054745	transposase,tRNA	Acinetobacter_phage(50.0%)	52	NA	NA
WP_081007000.1|1979390_1980479_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300157.1|1980702_1981983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|1982815_1983181_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|1983126_1983702_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|1983984_1984350_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155047002.1|1984364_1984970_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_036776867.1|1985340_1986738_-|tRNA	asparagine--tRNA ligase	tRNA	A0A167RLM0	Powai_lake_megavirus	34.4	1.8e-77
WP_051307313.1|1986857_1987805_-	P-type conjugative transfer ATPase TrbB	NA	NA	NA	NA	NA
WP_032126703.1|1987801_1988317_-	signal peptidase peptidase S26 family protein	NA	NA	NA	NA	NA
WP_016209698.1|1988303_1989503_-	trbL/VirB6 plasmid conjugal transfer family protein	NA	NA	NA	NA	NA
WP_016209707.1|1989499_1989823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209703.1|1989824_1991054_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_016209722.1|1991053_1992097_-	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_129556606.1|1992096_1992780_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209720.1|1992776_1995266_-	cagE, TrbE, VirB, component of type IV transporter system family protein	NA	NA	NA	NA	NA
WP_017377396.1|1995282_1995537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209715.1|1995537_1995894_-	trbC/VIRB2 family protein	NA	NA	NA	NA	NA
WP_081377360.1|1996673_1997837_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209727.1|1997856_2000964_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_016209723.1|2000965_2002471_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_016209714.1|2002498_2002780_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2002928_2003270_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_016209712.1|2003389_2005270_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_075274705.1|2005354_2006953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307314.1|2006970_2008086_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209706.1|2008213_2009212_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_016209700.1|2009215_2009974_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_016209702.1|2009975_2011175_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016209711.1|2011158_2011830_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016209717.1|2012630_2013629_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.7	5.2e-39
WP_016209697.1|2013630_2014209_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	45.0	2.8e-45
WP_016209713.1|2014205_2015675_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2015718_2016006_-	trp operon repressor	NA	NA	NA	NA	NA
WP_054300271.1|2016137_2017112_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016209699.1|2017312_2017909_+	DMT family transporter	NA	NA	NA	NA	NA
WP_054300152.1|2017935_2018301_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046757.1|2018357_2018513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273401.1|2018657_2019110_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300151.1|2019147_2019480_+	DMT family transporter	NA	NA	NA	NA	NA
WP_155047003.1|2020968_2021854_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212372.1|2022040_2022262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212371.1|2022377_2023010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2022987_2024049_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036776841.1|2024488_2025028_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_032126699.1|2025112_2025649_+	alkyl hydroperoxide reductase	NA	NA	NA	NA	NA
WP_075285967.1|2026293_2026602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126698.1|2027051_2027360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556607.1|2027680_2028130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556608.1|2028412_2029123_+	VUT family protein	NA	NA	NA	NA	NA
WP_016211232.1|2029349_2029748_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_016211231.1|2030615_2031566_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_016211227.1|2031565_2033644_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2043756	2085738	3054745	transposase,tRNA	Staphylococcus_phage(30.0%)	45	NA	NA
WP_032126694.1|2043756_2044716_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	2.2e-10
WP_016210340.1|2044808_2045312_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	1.4e-13
WP_016210346.1|2045446_2046598_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|2046594_2047074_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_032126693.1|2047220_2049542_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.7	2.3e-98
WP_080664839.1|2049486_2050113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210344.1|2050117_2051017_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_129556610.1|2051089_2051668_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_016210347.1|2051968_2052226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081006999.1|2052234_2052606_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.2	3.4e-20
WP_081006998.1|2052810_2053266_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.0	1.3e-21
WP_075274757.1|2053382_2053736_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.5	1.3e-05
WP_155046758.1|2054523_2054655_+	phosphatase	NA	NA	NA	NA	NA
WP_016212051.1|2055281_2056055_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054300271.1|2057382_2058357_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007065.1|2059517_2060357_-	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_081007013.1|2060569_2060869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046696.1|2060858_2061023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300550.1|2061079_2061445_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211790.1|2062748_2063444_+	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_075274707.1|2063440_2064868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211791.1|2064893_2065157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046776.1|2065249_2066203_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.7e-28
WP_155047005.1|2066261_2067112_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016211291.1|2067149_2067494_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016211297.1|2067490_2068327_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_016211294.1|2068327_2068669_-	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_016211298.1|2068670_2069276_-	cytochrome c oxidase subunit III family protein	NA	NA	NA	NA	NA
WP_032126720.1|2069272_2071267_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_016211299.1|2071286_2072228_-	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_052104719.1|2072455_2073880_+	MFS transporter	NA	NA	NA	NA	NA
WP_054300271.1|2074392_2075367_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_080743040.1|2075425_2076082_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_032126480.1|2076128_2076812_-	methyltransferase	NA	NA	NA	NA	NA
WP_080664873.1|2077357_2077672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556613.1|2077566_2078562_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211924.1|2078717_2078876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122942409.1|2079234_2079666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_129556614.1|2079803_2079956_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_016211852.1|2080541_2081255_+	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	1.7e-28
WP_075273625.1|2081313_2082066_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211851.1|2082262_2082919_+	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_075273397.1|2083607_2084003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377361.1|2084318_2085068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047007.1|2085132_2085738_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2145130	2194864	3054745	transposase	Moraxella_phage(20.0%)	47	NA	NA
WP_155047004.1|2145130_2145637_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_129556616.1|2148713_2149301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080664863.1|2149345_2150386_+	beta-eliminating lyase	NA	NA	NA	NA	NA
WP_016211572.1|2150507_2150732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2150973_2151549_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2151494_2151860_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211193.1|2152058_2152820_-	DUF3750 domain-containing protein	NA	NA	NA	NA	NA
WP_036779326.1|2153121_2154648_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_129556617.1|2155019_2155859_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_016211200.1|2155898_2157206_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.6	2.1e-24
WP_016211199.1|2157180_2158350_+	glycoside hydrolase family 3 protein	NA	NA	NA	NA	NA
WP_016211196.1|2158404_2159130_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_016211194.1|2159408_2159798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2159985_2160891_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_155046697.1|2160938_2161082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273385.1|2161129_2161933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910645.1|2161960_2163114_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_016210704.1|2164008_2165955_-	protein kinase family protein	NA	NA	NA	NA	NA
WP_016210702.1|2166609_2169672_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.9	1.2e-62
WP_016210701.1|2169668_2170733_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016210703.1|2171088_2172042_-	glutathione synthase	NA	NA	NA	NA	NA
WP_016210700.1|2172073_2173237_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_032126484.1|2173242_2173842_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_016210697.1|2174029_2174530_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	41.2	1.0e-19
WP_016210706.1|2174547_2175636_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_016211099.1|2175774_2177019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211097.1|2177015_2177858_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_036777711.1|2177837_2178647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126369.1|2178825_2179053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211100.1|2179053_2180004_+	TonB family protein	NA	NA	NA	NA	NA
WP_032126371.1|2180059_2180611_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_016211105.1|2180737_2181160_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_016211109.1|2181152_2181899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211103.1|2181941_2182640_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_032126370.1|2182650_2183475_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	5.4e-26
WP_016211108.1|2183804_2184173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2184167_2185229_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126486.1|2185278_2185509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211248.1|2185638_2186853_-	aromatic amino acid transport family protein	NA	NA	NA	NA	NA
WP_017376242.1|2187153_2188215_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_054300547.1|2188228_2189950_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_016211245.1|2189989_2190721_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_155066175.1|2191633_2192236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211250.1|2192555_2192768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273383.1|2192923_2193496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046699.1|2193700_2194273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300546.1|2194267_2194864_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2241660	2373633	3054745	transposase,tRNA,tail,protease	Acinetobacter_phage(20.0%)	120	NA	NA
WP_054300271.1|2241660_2242635_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016211637.1|2243136_2244549_-	amino acid permease	NA	NA	NA	NA	NA
WP_032126550.1|2245041_2246049_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_016211636.1|2246068_2247589_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.1	2.7e-31
WP_016211018.1|2248539_2249856_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_016211019.1|2250476_2253542_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.6	5.1e-53
WP_016211017.1|2253610_2254714_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016211016.1|2254737_2255292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273381.1|2255406_2255976_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_054300545.1|2257016_2258078_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_098082829.1|2258472_2258868_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_054300209.1|2258889_2259255_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046700.1|2259311_2259476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007013.1|2259465_2259765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300544.1|2259855_2260302_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_032126725.1|2260797_2261364_-	DUF1415 domain-containing protein	NA	NA	NA	NA	NA
WP_016210241.1|2261375_2262161_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_016210235.1|2262792_2263716_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_016210246.1|2263767_2264763_-	NAD(P)-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_016210237.1|2264794_2265289_-	protein-export chaperone SecB	NA	NA	NA	NA	NA
WP_032126724.1|2265380_2265638_-	glutaredoxin 3	NA	NA	NA	NA	NA
WP_016210233.1|2265727_2266150_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_016210236.1|2266468_2267185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210247.1|2267228_2267480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300543.1|2267484_2268921_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210231.1|2268948_2270391_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_016210242.1|2270478_2270817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210243.1|2270901_2271432_+	outer membrane family protein	NA	NA	NA	NA	NA
WP_016210228.1|2271492_2273685_+	DNA helicase II	NA	A7KV33	Bacillus_phage	36.0	1.3e-106
WP_016210238.1|2273727_2274213_-	proQ/FINO family protein	NA	NA	NA	NA	NA
WP_016210226.1|2274482_2274914_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_036778324.1|2274931_2275762_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_080664837.1|2275776_2275920_-	lipoprotein	NA	NA	NA	NA	NA
WP_016210239.1|2275950_2276835_-	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_016210244.1|2276806_2277028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210225.1|2277201_2277480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300542.1|2278160_2278397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126790.1|2278422_2279328_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_129556686.1|2279758_2280640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273371.1|2280873_2281449_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2281394_2281760_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_054300541.1|2282087_2282867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126848.1|2283400_2284201_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_016211858.1|2284419_2285178_+	ion transporter	NA	NA	NA	NA	NA
WP_016211859.1|2285254_2285542_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_075273327.1|2285545_2286121_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2286066_2286432_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_080728339.1|2286495_2286768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300540.1|2287035_2287260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300539.1|2288275_2289619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377589.1|2290472_2291126_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_016210784.1|2291303_2292275_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_016210782.1|2292297_2293194_-	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_016210786.1|2293352_2293799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036779493.1|2293795_2294437_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_016210789.1|2294546_2295125_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_016210776.1|2295600_2296038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047085.1|2296362_2297703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210785.1|2297966_2299361_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_054300538.1|2300809_2301877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016209863.1|2301929_2302352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209853.1|2302592_2303036_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209873.1|2303090_2303348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209868.1|2303325_2303952_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_016209871.1|2304029_2306012_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	40.9	3.9e-115
WP_016209869.1|2306220_2307564_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_016209874.1|2307830_2310500_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_016209857.1|2310523_2312443_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_016209860.1|2312612_2314034_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	3.1e-45
WP_016209866.1|2314179_2315154_+	phospholipase A	NA	NA	NA	NA	NA
WP_054300537.1|2315185_2315593_+	glyoxalase	NA	NA	NA	NA	NA
WP_016209859.1|2315871_2316093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209875.1|2316256_2317918_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.9	5.3e-182
WP_016209850.1|2317990_2318281_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_036776911.1|2318506_2318962_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_016209852.1|2319026_2319491_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_016209862.1|2319583_2320930_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_016209870.1|2320929_2321835_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_016209854.1|2321896_2322883_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2322875_2323118_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_016209858.1|2323239_2324784_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.8	6.5e-65
WP_016209864.1|2326158_2327553_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_016209867.1|2327576_2327756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2327752_2328328_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2328273_2328639_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016210079.1|2331644_2332142_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_016210095.1|2332312_2333008_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080664831.1|2333110_2334673_-	APC family permease	NA	NA	NA	NA	NA
WP_016210093.1|2334988_2336782_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.3	2.6e-118
WP_016210081.1|2336867_2337140_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_016210094.1|2337145_2337772_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_016210077.1|2337758_2339189_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_016210086.1|2339521_2340577_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.2	4.3e-28
WP_032126605.1|2340545_2341223_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_016210084.1|2341212_2342049_+	D-methionine-binding lipoprotein metQ	NA	NA	NA	NA	NA
WP_016210080.1|2342208_2342502_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_122940784.1|2342608_2343415_-	trfA family protein	NA	NA	NA	NA	NA
WP_016210083.1|2343719_2344574_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_016210082.1|2344728_2345778_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_054300536.1|2345828_2346485_-	DedA family protein	NA	NA	NA	NA	NA
WP_016210097.1|2346502_2347783_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_016210096.1|2348056_2349418_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_032126863.1|2349817_2350369_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_016211802.1|2355805_2357077_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_036778206.1|2357133_2358117_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_016211800.1|2358113_2358899_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_032126362.1|2359594_2359960_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|2359905_2360481_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300535.1|2360484_2361204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300534.1|2361348_2361549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211358.1|2361596_2362058_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_016211357.1|2362481_2363963_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.3	6.3e-49
WP_016211355.1|2364025_2365135_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	2.9e-35
WP_016211354.1|2365232_2367194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211359.1|2367723_2368128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300173.1|2368180_2369242_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046702.1|2369367_2369523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300162.1|2369896_2370979_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_155764075.1|2371048_2371216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2372480_2373633_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
>prophage 22
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2388994	2453363	3054745	transposase	Streptococcus_phage(16.67%)	60	NA	NA
WP_075273371.1|2388994_2389570_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2389515_2389881_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016211609.1|2390751_2391060_+	double zinc ribbon family protein	NA	NA	NA	NA	NA
WP_054300527.1|2391092_2393279_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	45.0	3.5e-141
WP_016211605.1|2393382_2393616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211606.1|2393832_2394363_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_016211607.1|2394391_2394616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273369.1|2394798_2395614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300526.1|2395722_2396019_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_105962174.1|2396167_2396332_-	phosphatase	NA	NA	NA	NA	NA
WP_016211026.1|2396430_2396835_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075273367.1|2397127_2397904_+	serine/threonine-protein phosphatase	NA	NA	NA	NA	NA
WP_054300525.1|2397912_2400000_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	4.0e-17
WP_016211031.1|2400164_2400644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211032.1|2400953_2401751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211033.1|2401862_2403155_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_032126377.1|2403320_2404322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211034.1|2404438_2404618_+	rubredoxin	NA	NA	NA	NA	NA
WP_016211023.1|2404628_2405063_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_016211029.1|2405276_2405639_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	7.6e-25
WP_016212102.1|2405812_2407453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|2408963_2410116_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_129556441.1|2413167_2414394_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126490.1|2414742_2415708_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_016210868.1|2415704_2416004_+	pilZ domain protein	NA	NA	NA	NA	NA
WP_016210859.1|2416035_2416815_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_016210861.1|2416840_2417071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|2417222_2417468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210870.1|2417619_2418411_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_016212128.1|2419324_2420071_+	solute symporter family protein	NA	NA	NA	NA	NA
WP_032126495.1|2420161_2421046_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_054300397.1|2421451_2421697_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046705.1|2421937_2422105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273298.1|2422050_2422626_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016210127.1|2422678_2423704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210132.1|2424426_2425245_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_129556442.1|2425317_2427690_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.3	2.8e-160
WP_036777812.1|2428403_2429831_+	amino acid permease	NA	NA	NA	NA	NA
WP_054300523.1|2429865_2430888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210140.1|2430904_2431282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210122.1|2432121_2432814_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126492.1|2433440_2434415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210121.1|2434404_2436177_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_016210136.1|2436177_2436525_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_032126493.1|2436774_2438001_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_016210141.1|2438090_2439389_-	MFS transporter	NA	NA	NA	NA	NA
WP_081007061.1|2439422_2440172_-	queuosine precursor transporter	NA	A0A1W7AG82	Streptococcus_virus	30.4	3.9e-15
WP_016210137.1|2440152_2440704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007060.1|2440930_2442229_-	MFS transporter	NA	NA	NA	NA	NA
WP_016210130.1|2442345_2442636_+	PAAR motif family protein	NA	NA	NA	NA	NA
WP_016212281.1|2442947_2444402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212359.1|2445264_2445483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212044.1|2446256_2446511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036794771.1|2447233_2448220_+	APC family permease	NA	NA	NA	NA	NA
WP_016211795.1|2448357_2448552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081007059.1|2449234_2450296_+	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_016211797.1|2450457_2451861_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075273359.1|2451911_2452487_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300520.1|2452432_2452747_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273371.1|2452787_2453363_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2537342	2639427	3054745	transposase,integrase,tRNA	Escherichia_phage(39.39%)	103	2585842:2585901	2619801:2620089
WP_054300513.1|2537342_2538206_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_129556623.1|2538422_2539982_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	3.0e-09
WP_051307335.1|2540003_2541038_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_016210643.1|2541086_2541656_+	elongation factor P	NA	NA	NA	NA	NA
WP_122940481.1|2541791_2542763_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.3	2.8e-21
WP_016210645.1|2542774_2544352_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_129556624.1|2544417_2545404_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_054300512.1|2545735_2546845_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_016210650.1|2546950_2548135_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_016210649.1|2548212_2550201_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_016210644.1|2550409_2550565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300511.1|2550822_2551122_-	DDE endonuclease	NA	NA	NA	NA	NA
WP_054300510.1|2551392_2551575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|2551631_2551997_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126128.1|2552913_2554320_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_016210501.1|2554337_2555324_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	4.9e-42
WP_016210490.1|2555326_2556481_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.6	1.3e-14
WP_016210502.1|2556477_2557173_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	35.5	1.5e-08
WP_016210500.1|2557307_2558798_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_016210494.1|2558818_2559868_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_016210496.1|2559934_2561329_-	capsule polysaccharide biosynthesis family protein	NA	NA	NA	NA	NA
WP_016210489.1|2562207_2564139_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.5	2.3e-120
WP_075273353.1|2564143_2564674_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_016210493.1|2564708_2564903_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|2564945_2565305_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_016211706.1|2565724_2566720_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.4	2.5e-33
WP_016211707.1|2569118_2569406_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_052133265.1|2569677_2570154_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_054300509.1|2570298_2570496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2570620_2571595_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_075273615.1|2572495_2572594_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300507.1|2573078_2574368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300575.1|2574604_2575297_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_016210472.1|2575338_2576112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210485.1|2576113_2577055_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	2.3e-20
WP_016210482.1|2577187_2578765_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_016210484.1|2578974_2580732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274711.1|2581280_2582039_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_032126625.1|2582246_2582819_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_016210475.1|2582922_2583471_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_016210487.1|2583772_2584018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210488.1|2584046_2584343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122941726.1|2584610_2585534_-	hypothetical protein	NA	NA	NA	NA	NA
2585842:2585901	attL	CGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGTTTTT	NA	NA	NA	NA
WP_054300506.1|2586012_2586420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300481.1|2586491_2587220_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_129556452.1|2589232_2589580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|2589582_2591322_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_155046941.1|2591723_2591987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300500.1|2592658_2593387_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	2.7e-45
WP_054300502.1|2593416_2594094_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	30.8	2.9e-09
WP_016212477.1|2594266_2594512_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_054300501.1|2594723_2595452_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_016212066.1|2595811_2596588_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_016212069.1|2596799_2596967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212070.1|2596941_2597541_+	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|2598310_2599039_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075285972.1|2599113_2601480_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_155764078.1|2601431_2602394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|2603073_2603802_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|2604097_2604826_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_016212268.1|2604982_2605567_-	recombinase family protein	NA	W6CWV1	Ralstonia_phage	38.0	5.9e-27
WP_016212269.1|2605570_2606254_-	Fic family protein	NA	NA	NA	NA	NA
WP_054300201.1|2606735_2607464_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.4	9.6e-43
WP_155764079.1|2607493_2608168_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	45.9	6.8e-27
WP_054300202.1|2608370_2609099_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_052047116.1|2609401_2609581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047061.1|2609725_2609992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273432.1|2610252_2610987_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	5.7e-43
WP_016212023.1|2610983_2611976_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.7	1.1e-17
WP_016212022.1|2612462_2612681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780881.1|2612680_2613280_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_016212024.1|2613276_2613525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|2613608_2614337_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_051307368.1|2615043_2616324_+	AAA family ATPase	NA	Q7Y3Y6	Yersinia_phage	33.5	7.3e-38
WP_016211918.1|2616323_2617292_+	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_016211646.1|2617663_2617903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211642.1|2617895_2618249_+	toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_129556455.1|2618549_2619152_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_054300203.1|2619156_2619615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377362.1|2619922_2620525_+	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	30.8	1.5e-09
2619801:2620089	attR	AAAAACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTGTGATTTGGTATTTATATGGATTAAATAAGAATAAATAGAACTCTGTTAAGTGGTAAGATAATGAATATTATATCATCTTTATTTAGATTTTCAGATACTAGTGATAGTATTTTTTCTAAAAATAGAAAAGATACTTACAAATACTCTGGATTACTTCTCACTATTTATATTTCAACAGTGATCATTACTCAAGTCTTAGCTGTTAGAATTACTAGCCTGGCTGGAGT	NA	NA	NA	NA
WP_036781052.1|2620991_2621594_-	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_016211639.1|2621973_2622276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211644.1|2622390_2622657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104773.1|2622764_2623208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_105962625.1|2623269_2624155_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|2624255_2625317_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_052104771.1|2625670_2626009_+	hypothetical protein	NA	R9TNL4	Vibrio_phage	54.9	5.4e-25
WP_075274739.1|2626001_2626349_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274717.1|2626345_2626576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764080.1|2626579_2627029_+	single-stranded DNA-binding protein	NA	G8EYH4	Enterobacteria_phage	64.0	2.1e-32
WP_075274740.1|2627193_2627559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780395.1|2627703_2627958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377363.1|2627941_2628298_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_075274719.1|2628603_2629470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155047068.1|2629955_2630156_+	HNH endonuclease	NA	A0A2H4PHY5	Pseudomonas_phage	64.3	3.5e-16
WP_054300202.1|2630270_2630999_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
WP_016211235.1|2631493_2631931_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_129556626.1|2632360_2633749_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_016211238.1|2634191_2635685_+	amino acid permease	NA	NA	NA	NA	NA
WP_129556456.1|2635886_2636636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211242.1|2636679_2637648_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_016211244.1|2637601_2638297_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	2.7e-10
WP_054300202.1|2638698_2639427_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.5e-43
>prophage 24
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2645981	2686359	3054745	transposase,tRNA	Synechococcus_phage(50.0%)	44	NA	NA
WP_054300173.1|2645981_2647043_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016210908.1|2648254_2649070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126716.1|2649160_2650144_+	transaldolase	NA	V5UTB0	Synechococcus_phage	32.9	2.2e-13
WP_016210913.1|2650314_2650836_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_016210914.1|2650869_2651121_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	58.8	1.8e-20
WP_016210909.1|2651126_2652404_-	na+ dependent nucleoside transporter family protein	NA	NA	NA	NA	NA
WP_051307343.1|2653096_2653624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210906.1|2653743_2656056_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_032126715.1|2656184_2657000_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016210915.1|2657197_2657662_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_054300173.1|2657791_2658853_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211491.1|2659113_2659410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211489.1|2661157_2662210_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	5.3e-10
WP_036779281.1|2662199_2662655_+	arginine repressor	NA	NA	NA	NA	NA
WP_155046991.1|2662679_2663003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126199.1|2663350_2663662_-	DOPA 4,5-dioxygenase	NA	NA	NA	NA	NA
WP_054300208.1|2663791_2664583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764081.1|2664560_2665190_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075285974.1|2665156_2665621_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036779278.1|2665740_2666694_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016212075.1|2666807_2667005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052047032.1|2667217_2667451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_142396463.1|2667561_2667678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212074.1|2667764_2667986_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_054300209.1|2668012_2668378_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046696.1|2668434_2668599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007009.1|2668588_2668759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300210.1|2668715_2668904_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046713.1|2669041_2669206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126195.1|2669500_2670937_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_016210532.1|2670978_2672430_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_016210537.1|2672541_2672829_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|2673018_2674062_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_016210536.1|2674077_2674977_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_016210528.1|2674973_2675492_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_054300211.1|2675561_2676179_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_036776217.1|2676188_2677676_+	ribonuclease G	NA	NA	NA	NA	NA
WP_075285975.1|2677685_2680829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210535.1|2681437_2682250_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_016210530.1|2682246_2682927_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_081007010.1|2683767_2684388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556461.1|2684437_2684728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300215.1|2685531_2686026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081007066.1|2686020_2686359_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2707827	2809105	3054745	transposase,plate,tRNA,protease	Prochlorococcus_phage(16.67%)	109	NA	NA
WP_016209523.1|2707827_2709177_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_016209510.1|2709227_2709665_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_075274721.1|2709926_2711438_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_036778935.1|2711443_2712670_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016209528.1|2712663_2713692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209514.1|2713669_2714362_+	DUF3540 domain-containing protein	NA	NA	NA	NA	NA
WP_155049805.1|2714363_2715836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036778941.1|2715828_2716317_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_051307310.1|2716322_2717795_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_032126187.1|2717794_2718193_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_016209524.1|2718189_2719878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209506.1|2719859_2720816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209515.1|2720858_2721374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209526.1|2721478_2722411_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
WP_016209534.1|2722630_2723017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209530.1|2723033_2723678_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_016209504.1|2723858_2724698_+	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	28.8	2.0e-15
WP_016209502.1|2724773_2725376_+	signal peptidase I	NA	NA	NA	NA	NA
WP_016209512.1|2725376_2726231_-	RNase adapter RapZ	NA	NA	NA	NA	NA
WP_016209537.1|2726587_2726899_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_016209519.1|2726923_2728315_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_016209538.1|2728470_2729202_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
WP_054300558.1|2729198_2729726_-	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209499.1|2729757_2730315_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_016209498.1|2730320_2731301_-	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	6.0e-32
WP_016209539.1|2731440_2732241_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_036780687.1|2732244_2733012_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_016209535.1|2733008_2733473_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_016209507.1|2733495_2734149_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016209517.1|2734152_2734500_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_016209505.1|2734533_2734785_+	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_016209518.1|2734859_2736128_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_016209527.1|2736130_2736889_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_016209508.1|2736950_2737841_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209511.1|2737891_2738575_+	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
WP_075273445.1|2738660_2738918_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_075274722.1|2739190_2741344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210408.1|2741335_2742208_-	DNA replication terminus site-binding family protein	NA	NA	NA	NA	NA
WP_016210409.1|2742375_2744205_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_016210411.1|2744367_2745009_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_075273448.1|2745250_2745781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210404.1|2745798_2745972_+	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_016210402.1|2746030_2747080_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_016210405.1|2747086_2748037_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_016210406.1|2748090_2749035_+	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_016210415.1|2749062_2749800_+	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_016210413.1|2749888_2750131_+	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
WP_016210403.1|2750205_2751429_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_016210400.1|2751460_2752309_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_016210401.1|2752305_2753358_+	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_032126181.1|2753478_2754099_+	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	44.2	4.2e-39
WP_054300218.1|2754114_2755146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2755189_2756164_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_081007004.1|2756317_2756773_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075273313.1|2756732_2757071_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_032126790.1|2757863_2758769_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_054300173.1|2758815_2759877_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_016212599.1|2759926_2760136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212369.1|2761370_2761817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2761820_2762396_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2762341_2762707_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_032126651.1|2762827_2763013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209899.1|2763116_2764151_-	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_016209908.1|2764147_2764858_-	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_016209923.1|2765332_2765851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209901.1|2765968_2766301_-	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	8.0e-05
WP_155764082.1|2766330_2766951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377774.1|2767280_2768597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377775.1|2768647_2769283_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_054300221.1|2769328_2769826_-|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_016209922.1|2769885_2770302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209915.1|2770393_2771254_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_032126652.1|2771336_2771903_+	chorismate lyase	NA	NA	NA	NA	NA
WP_016209918.1|2771935_2772790_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_054300222.1|2772831_2775738_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_016209904.1|2775798_2775996_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_016209903.1|2776002_2777013_+	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209910.1|2777009_2778068_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_032126655.1|2778061_2778862_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_016209913.1|2778864_2779683_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_016209907.1|2779694_2780642_+	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.9	1.6e-37
WP_032126654.1|2780649_2781951_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_016209919.1|2782129_2783233_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_016209906.1|2783229_2783622_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_016209924.1|2783633_2785010_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_016209900.1|2785003_2786473_+	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.9	2.7e-84
WP_054300223.1|2786664_2787636_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.9	1.3e-34
WP_155046715.1|2787900_2788146_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300225.1|2789108_2789528_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_155046954.1|2789634_2789808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126800.1|2790034_2790769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300148.1|2790893_2791955_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_122940948.1|2792277_2792982_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_016210599.1|2793075_2793789_-	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_016210601.1|2793871_2794963_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_054300226.1|2795034_2795616_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_016210606.1|2795621_2796248_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_016210609.1|2796344_2797280_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.4	6.3e-39
WP_129556471.1|2797639_2798311_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_016210598.1|2798452_2799112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210607.1|2799280_2800540_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_016210611.1|2800536_2801622_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_016210605.1|2801614_2802496_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_016210612.1|2802484_2803735_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_155046988.1|2805020_2805389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764083.1|2805404_2806082_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300228.1|2806059_2807313_-	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_032126362.1|2808218_2808584_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|2808529_2809105_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2844467	2889905	3054745	transposase,tRNA	Staphylococcus_phage(33.33%)	33	NA	NA
WP_054300232.1|2844467_2845919_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_016209368.1|2845954_2847484_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.2	1.6e-84
WP_054300233.1|2848059_2849703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300234.1|2850244_2851186_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209384.1|2851536_2852352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209395.1|2852643_2855334_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_081007011.1|2855582_2856803_+	MFS transporter	NA	NA	NA	NA	NA
WP_016209362.1|2856970_2858677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209398.1|2859275_2860502_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273456.1|2862167_2862467_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|2862426_2862882_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075285978.1|2862883_2863252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300559.1|2863761_2864310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046731.1|2865025_2865910_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|2865937_2866999_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273458.1|2867051_2867267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300238.1|2867539_2867818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032126399.1|2868114_2868615_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_016211818.1|2868817_2870074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777316.1|2870430_2870844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274726.1|2871153_2872038_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_054300240.1|2872294_2872498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|2872797_2873772_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016212172.1|2874074_2875547_+	tyrosine kinase family protein	NA	NA	NA	NA	NA
WP_054300271.1|2875566_2876541_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_016210742.1|2876691_2876967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210745.1|2877132_2877753_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_054300241.1|2878071_2880048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210739.1|2880203_2881661_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.6	7.2e-98
WP_016210743.1|2881729_2883310_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	8.8e-17
WP_054300242.1|2883350_2883887_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_016210746.1|2883932_2887829_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	4.4e-118
WP_054300173.1|2888843_2889905_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2906586	2969911	3054745	transposase,integrase,protease	unidentified_phage(11.11%)	52	2953422:2953481	2981618:2982207
WP_054300245.1|2906586_2907462_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_016211687.1|2907717_2908362_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_016211685.1|2908392_2910198_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|2910221_2910797_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_129556476.1|2911341_2912352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273474.1|2912649_2913624_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.9	4.0e-28
WP_155046989.1|2913856_2914921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274727.1|2915013_2915976_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	2.6e-27
WP_155046989.1|2916208_2917273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300249.1|2917763_2918129_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_129556449.1|2918143_2918650_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300250.1|2918639_2919299_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.3e-09
WP_016209640.1|2919717_2920737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016209649.1|2921195_2922161_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.8	7.9e-45
WP_016209646.1|2922205_2922781_-	VOC family protein	NA	NA	NA	NA	NA
WP_016209651.1|2922811_2924086_-	MFS transporter	NA	NA	NA	NA	NA
WP_032126159.1|2924730_2925444_+	aldolase	NA	NA	NA	NA	NA
WP_016209641.1|2925523_2926261_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_016209658.1|2926381_2927737_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_075273478.1|2927913_2928585_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_016209661.1|2928700_2929576_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	1.5e-34
WP_016209645.1|2930179_2931484_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|2931596_2932202_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_016209663.1|2932283_2933585_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	1.5e-134
WP_032126161.1|2933652_2936085_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	9.5e-220
WP_016209655.1|2936188_2936461_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075273480.1|2936543_2938442_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_016209643.1|2938473_2939358_+	lipid A biosynthesis acyltransferase	NA	A0A1W6JP29	Morganella_phage	35.3	2.4e-40
WP_016209657.1|2939366_2939762_-	CrcB family protein	NA	NA	NA	NA	NA
WP_016209662.1|2940189_2942337_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.7	1.8e-25
WP_016209652.1|2942308_2943658_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016209642.1|2943654_2945775_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_016209656.1|2945771_2947475_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	24.8	2.8e-21
WP_016209654.1|2947593_2948736_-	galactokinase	NA	NA	NA	NA	NA
WP_016209659.1|2948800_2949829_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_075274728.1|2949955_2951470_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_059372266.1|2951559_2952045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075274729.1|2952377_2953445_+|transposase	transposase	transposase	NA	NA	NA	NA
2953422:2953481	attL	TGTAAAACTCCAGATATGATCTGACAAGCTTAAATCATCTGACAACATTTGTCTGATTGA	NA	NA	NA	NA
WP_051307360.1|2954500_2955430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211514.1|2957669_2959562_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.9	1.4e-80
WP_032126157.1|2959848_2960253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377777.1|2961139_2961814_+	P-loop NTPase	NA	NA	NA	NA	NA
WP_016211528.1|2961794_2962100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300253.1|2963954_2964905_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	34.7	6.9e-09
WP_155764084.1|2964891_2965032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274730.1|2965106_2965400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211530.1|2965405_2966302_-	Abi family protein	NA	A3QSC6	Clostridium_virus	32.0	5.3e-35
WP_016211531.1|2966655_2967336_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_032126152.1|2967399_2967990_-|integrase	site-specific integrase	integrase	A0A1B0V4T7	Roseobacter_phage	32.7	1.1e-15
WP_016212424.1|2968192_2968471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036781387.1|2968463_2968736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|2968828_2969911_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
2981618:2982207	attR	TCAATCAGACAAATGTTGTCAGATGATTTAAGCTTGTCAGATCATATCTGGAGTTTTACAGATTAATCGAAGCATCTTGTGAACAACTTAAAATATTAAGATTAGCTAAGTTTTGGGATTGTCATTTATAAACCTTTTACTTGTTTAAATTATATTCTGTTTGTAGTTCTTAAAATTATGATTAATCGTAATACCTGAAAAATTCATTAAACTCTTGCAGGTTGAGTTGTTGAATATCAAATGATTTGTGCTACGGCTCGTAAGCCATACTTCCTTAAAGCGCCGTTAGGAGCAATATATCTGGCTATTGTTGAATCTGTTGTTTTATGTTTTTTGGCTATATCTACTAACTTTATTCCTTGTCGAGCTTGGTGCTGCATTGATTCTACTTGCTCTTTTGTAAAGCCAAGCTTGCGGCTGCCTGTTTGGAGCTTGTCTGATTTCATTTTTCGTTCTAGCGGTATTTTTGCTGGCCTCCTATTTTTAGGTATAGGCGTTTCACCAATTAATTCACTAATCGTAATGTTAAAGAAAGTTGAAATTGGCGCTACAATGCTTAGATTTACGCTAGTCTTTCCATTTAATATATT	NA	NA	NA	NA
>prophage 28
NZ_CP013768	Piscirickettsia salmonis strain PM23019A, complete genome	3054745	2977744	3036721	3054745	transposase	Staphylococcus_phage(18.18%)	58	NA	NA
WP_105962625.1|2977744_2978630_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_054300237.1|2978819_2979881_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036781361.1|2979900_2980290_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_054300162.1|2980560_2981643_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.1	8.4e-144
WP_016211579.1|2981853_2982339_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016211583.1|2982406_2983315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300257.1|2983591_2984401_+	DUF4942 domain-containing protein	NA	A0A1J0GUW2	Halomonas_phage	30.6	1.8e-29
WP_075273486.1|2984377_2985352_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.2e-29
WP_016211585.1|2985586_2986144_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_155046985.1|2986202_2986985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211584.1|2987082_2987436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211586.1|2987502_2987697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211578.1|2987712_2988057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273327.1|2988126_2988702_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_032126362.1|2988647_2989013_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273488.1|2989097_2989733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052047108.1|2989788_2990187_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155764085.1|2991627_2992116_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046716.1|2992537_2992684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210555.1|2993381_2993936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210551.1|2994372_2994555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|2994619_2994847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556629.1|2995077_2995824_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	3.6e-29
WP_026063577.1|2996050_2996344_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_129556482.1|2996415_2997021_-	NUDIX domain-containing protein	NA	A0A1S6L1P8	Vibrio_phage	30.9	1.2e-17
WP_016210545.1|2997169_2998147_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_075285981.1|2998254_2999685_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_016210553.1|2999711_3000365_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_016210552.1|3000489_3001056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051307331.1|3001410_3003189_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.6	1.5e-33
WP_052104721.1|3003260_3004967_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.7	7.3e-25
WP_054300262.1|3004958_3005249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307332.1|3005296_3005503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126362.1|3005711_3006077_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|3006022_3006598_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_016212461.1|3006601_3006976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300271.1|3007351_3008326_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.3	1.8e-28
WP_054300263.1|3008397_3008838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300264.1|3008825_3009164_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_054300265.1|3009308_3009569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273313.1|3009528_3009867_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_129556484.1|3010339_3011800_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_016211426.1|3012143_3013586_+	MFS transporter	NA	NA	NA	NA	NA
WP_075273490.1|3014567_3015860_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_054300560.1|3016333_3019006_+	HAD-IC family P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	30.2	4.1e-75
WP_032126554.1|3019025_3020111_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_016210417.1|3020552_3020990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210423.1|3020986_3021871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210416.1|3021960_3022491_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_016210420.1|3022561_3023740_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	32.1	2.0e-50
WP_054300267.1|3023888_3027737_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_016210422.1|3027723_3029226_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_016210418.1|3029776_3030412_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_054300173.1|3030724_3031786_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_016211781.1|3032002_3033250_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_129556486.1|3034993_3035341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273492.1|3035431_3035551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054300268.1|3035659_3036721_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013769	Piscirickettsia salmonis strain PM23019A plasmid p1PS3, complete sequence	153216	9030	48668	153216	head,transposase,tail,capsid,integrase	Streptococcus_phage(21.43%)	42	1377:1436	42500:42810
1377:1436	attL	CTTTTTTGCCACATGCACTGCAAAAACGTGACTTACAGGTATAAGGTACAACTTTGGTAT	NA	NA	NA	NA
WP_075275131.1|9030_9348_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075285988.1|9439_9697_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081377781.1|9715_9874_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	65.8	2.1e-08
WP_075273749.1|10782_11508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|14365_15391_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_081377369.1|15508_16237_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.4	4.6e-37
WP_155047020.1|16393_17317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273755.1|17557_18214_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	40.2	2.9e-30
WP_016211955.1|18350_19331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211956.1|19787_20516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556703.1|20573_21062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377344.1|22175_23303_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075285991.1|23542_23992_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273760.1|24335_26738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210338.1|26840_26978_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273592.1|27076_28051_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_081377345.1|28047_28572_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.5	1.4e-27
WP_032126637.1|28688_28982_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	8.3e-06
WP_075275150.1|29100_29589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075285994.1|30352_31087_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.6	1.4e-38
WP_075285995.1|31410_32052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764089.1|32183_32483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275152.1|32479_33349_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075275153.1|33458_34256_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_054300202.1|34500_35229_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
WP_081377370.1|35207_35744_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_016211936.1|36233_37256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211938.1|37750_38311_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007042.1|38375_39191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105962623.1|39723_40877_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_075273762.1|40942_42214_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	28.3	1.1e-22
WP_052047108.1|42269_42668_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_129556716.1|42801_43092_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	42.7	2.7e-12
42500:42810	attR	CTTTTTTGCCACATGCACTGCAAAAACGTGACTTACAGGTATAAGGTACAACTTTGGTATGAGAGCATTCAGAGCTGCTACAACAGTATTTTGAGTGACCCATCACGGTTGTGCCGCATGCAAGTACTTTAATCACGTTTTCCACAACGACATCACGGTGCTTGTCCATGTTAGCTATGAAGTCACGCCACCAATTGTCGGCAGTTTGAAGAAGATGTTTGACTGTGTTGAGCAATTATTTTTCTCTTAAAATAATGTCCTATAGTAGTGATTACGTTGAATTTAGCAAGGCCTTCCTAAAGCTGCCGACG	NA	NA	NA	NA
WP_016210655.1|43105_43702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273766.1|44152_45214_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273768.1|45217_45487_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.3	2.2e-05
WP_016210667.1|45483_45807_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.0	1.0e-12
WP_016210658.1|45799_46195_+	hypothetical protein	NA	Q7Y404	Yersinia_phage	40.0	1.6e-07
WP_016210651.1|46191_46542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210664.1|46541_46964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210669.1|46965_47289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|47642_48668_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013769	Piscirickettsia salmonis strain PM23019A plasmid p1PS3, complete sequence	153216	56298	108378	153216	integrase,protease,transposase	Acinetobacter_phage(20.0%)	60	94457:94516	116194:117148
WP_052104629.1|56298_57324_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016212298.1|57990_58317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051307374.1|58557_59034_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	39.2	3.2e-15
WP_155047011.1|59148_60301_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	9.8e-58
WP_075273780.1|60310_61018_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.8e-38
WP_052104629.1|61156_62182_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_016211912.1|62561_63152_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	33.3	2.1e-19
WP_032126795.1|63424_63685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|63688_63961_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_016211913.1|64286_65408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273786.1|65840_66239_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_105962623.1|66247_67401_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.5e-58
WP_016212499.1|68399_68774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212410.1|68978_69152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212408.1|69399_69849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212412.1|69841_70006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059372613.1|70306_70933_+	hypothetical protein	NA	A0A222ZGQ4	Arthrobacter_phage	33.7	1.8e-21
WP_075273790.1|70922_71225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052104629.1|71769_72795_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_054300590.1|73411_73636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211873.1|73886_74144_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211871.1|74137_74473_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_032126138.1|75038_75302_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_075273796.1|75856_76660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273798.1|77414_77639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033923775.1|78039_78780_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	28.0	4.6e-08
WP_016212413.1|78827_79256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273802.1|79589_80318_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.5e-37
WP_075273804.1|80402_80741_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081007004.1|80700_81156_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.7	6.2e-16
WP_075273806.1|81261_81825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273808.1|82086_82611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080728342.1|82650_83154_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_081377348.1|83468_84218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075273810.1|84525_85233_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	34.2	1.4e-11
WP_129556718.1|85219_86405_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	7.7e-58
WP_054300276.1|87542_88517_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.8	2.4e-25
WP_075273812.1|88513_89071_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.6e-08
WP_032126362.1|89016_89382_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273814.1|90729_91191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129556717.1|92614_93841_+	hypothetical protein	NA	NA	NA	NA	NA
94457:94516	attL	AACCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTC	NA	NA	NA	NA
WP_054300271.1|94495_95470_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.7	1.1e-25
WP_016212260.1|95627_95900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212257.1|95919_96144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032126838.1|96480_96684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212255.1|96680_96851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075273820.1|97037_98120_-|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	71.8	1.2e-142
WP_075273822.1|98276_98777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075274741.1|98878_99136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155047012.1|99204_100212_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	43.8	6.5e-58
WP_032126362.1|100172_100538_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075273327.1|100483_101059_+|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	26.6	2.7e-08
WP_075273824.1|101062_101317_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075273826.1|101276_102404_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	30.3	1.9e-18
WP_155047013.1|102624_102771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377350.1|103100_103916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036780064.1|104161_104752_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	38.3	2.0e-22
WP_016211879.1|105706_106726_+	ParA family protein	NA	NA	NA	NA	NA
WP_075274742.1|106738_107620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300202.1|107649_108378_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	1.9e-38
116194:117148	attR	AACCGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCAATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAATTTCATTAAAATCTGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGCTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCCGCAAACTCTGTTCCATTGTCAGAGGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGATCGCGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGGTGTTCAATACCAACGCGATTAGGTATTTTTATTTGATCACCACGATTCACCTTTTTCTTATAAGGTTTTCCCGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCTGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTTTCACTCACCTGGATATCATGCTCTCGTATAAGTTCCTGACTGATAACATCGGGGGATGTATGGGTGCTTAACCGTTGATGGATCAACATTTTTGCCTCCTCTGAAATTTGTCGAAAAGCTTGACCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCACAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCC	NA	NA	NA	NA
>prophage 1
NZ_CP013770	Piscirickettsia salmonis strain PM23019A plasmid p2PS3, complete sequence	36218	18666	26339	36218	terminase,portal,tail,head,protease,capsid,transposase	Enterobacteria_phage(28.57%)	9	NA	NA
WP_075274763.1|18666_19062_-	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	39.1	6.0e-07
WP_075274764.1|19054_19378_-|head	phage head closure protein	head	K7PH08	Enterobacteria_phage	41.7	5.4e-14
WP_075274765.1|19374_19686_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	31.7	2.5e-08
WP_036778347.1|20005_20587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054300591.1|20622_21816_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	39.5	2.6e-69
WP_081007077.1|21870_22542_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	45.8	5.5e-45
WP_075286005.1|22489_23641_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	45.8	7.2e-85
WP_054300392.1|23801_24863_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081377785.1|24881_26339_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.6	2.4e-122
>prophage 1
NZ_CP013771	Piscirickettsia salmonis strain PM23019A plasmid p3PS3, complete sequence	36063	17781	23202	36063	transposase,tail,head	Staphylococcus_phage(33.33%)	7	NA	NA
WP_054300681.1|17781_18282_+	hypothetical protein	NA	A0A1W6JQ30	Staphylococcus_phage	42.7	8.1e-17
WP_155046942.1|18618_19505_-|transposase	IS630 family transposase	transposase	A0A1V0SDF3	Indivirus	22.8	2.6e-10
WP_054300680.1|19531_20212_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.0	1.0e-09
WP_016211133.1|20657_21992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211137.1|22182_22494_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4J711	uncultured_Caudovirales_phage	34.7	1.1e-08
WP_016211132.1|22490_22814_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	39.8	5.0e-12
WP_016211139.1|22806_23202_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	40.7	2.1e-07
