The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	0	76236	3192742	transposase,tRNA	uncultured_Mediterranean_phage(15.38%)	58	NA	NA
WP_017376410.1|3752_4031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|4393_5032_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|5006_6431_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|6631_7309_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|7429_8704_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376415.1|9577_10495_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|10629_10800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|10919_11699_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|11751_12039_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|12098_12449_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046603.1|12642_12795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999981.1|12722_13196_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.0	2.9e-32
WP_048875973.1|13208_13844_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773947.1|14355_15231_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376433.1|16837_18196_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.0	3.9e-37
WP_026063530.1|18419_18608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376430.1|18621_19755_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_048875975.1|19955_23828_+	tandem-95 repeat protein	NA	NA	NA	NA	NA
WP_017376428.1|23862_24588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|24977_25706_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|26108_26837_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|26900_27728_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_075316649.1|27821_28277_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|28273_29092_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|29192_30008_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|30291_32352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|32348_32774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|32959_34453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|34585_35401_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|35496_35913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|36295_36835_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|37751_37913_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|38624_39686_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|41176_41530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|41738_43451_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|43897_45751_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|45853_46186_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|46216_46813_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|46809_47934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|48045_48693_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|48744_50658_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|50862_51900_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|51958_55285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|55991_56960_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|57089_57578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|58019_58253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|58562_58751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|59239_59725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|59995_60265_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|60299_61625_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|61680_62328_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|62521_64480_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|64623_67554_+	peptidase M16	NA	NA	NA	NA	NA
WP_048875980.1|68359_69763_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|71203_71989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|72079_73729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|73873_74719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|74832_76236_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	79575	83395	3192742	transposase	Acinetobacter_phage(50.0%)	5	NA	NA
WP_144420658.1|79575_80337_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_155046602.1|80369_81149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875973.1|81425_82061_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|82057_82222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|82420_83395_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 3
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	94264	94978	3192742		Cyanophage(100.0%)	1	NA	NA
WP_017378273.1|94264_94978_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	40.0	7.4e-40
>prophage 4
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	138409	139708	3192742		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_017378233.1|138409_139708_-	PAS domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	52.3	7.5e-14
>prophage 5
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	143155	190668	3192742	transposase,tRNA	Tupanvirus(15.38%)	42	NA	NA
WP_017378229.1|143155_145048_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	34.8	9.7e-87
WP_017378228.1|145054_145975_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|150137_150281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|150890_151709_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|151816_152278_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|152294_153218_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|153241_154291_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|154428_155022_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|155044_155515_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|155624_156875_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|157563_158028_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|158466_159939_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|160055_160508_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|160632_160788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|160932_161136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|161326_161725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|161910_162516_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|162524_162821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|162825_163362_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|163506_164076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|164155_165130_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|165126_165624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|166031_166448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|166515_167919_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|167915_168536_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|168807_169782_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|169946_170570_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|170566_172507_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|172662_173316_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|173484_174660_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|175013_176339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376447.1|177320_178193_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|178379_179642_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|179715_180246_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|180267_181773_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|181785_182451_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|182544_184305_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|184582_185458_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376455.1|185794_186256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376456.1|186289_188860_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	23.0	3.5e-31
WP_017376457.1|188967_189453_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	56.9	8.0e-38
WP_017376458.1|189627_190668_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	66.3	5.8e-118
>prophage 6
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	194024	296548	3192742	protease,transposase,tRNA	Burkholderia_phage(13.64%)	94	NA	NA
WP_017376461.1|194024_194288_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|194660_195536_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046597.1|195650_195827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376465.1|196371_197934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772167.1|198475_199423_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376467.1|199642_201118_-	APC family permease	NA	NA	NA	NA	NA
WP_017376469.1|201637_202660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376470.1|203016_204384_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|204659_204914_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_048876132.1|204962_206216_+	GTPase HflX	NA	NA	NA	NA	NA
WP_027242811.1|206235_207450_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|207449_208343_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|208540_209839_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|209928_211206_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_036772166.1|211219_213619_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_017376476.1|213615_214374_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|214550_214940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|217062_217350_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_081078114.1|217715_218507_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017375672.1|219165_219657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|219645_220374_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377465.1|220392_221250_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_027242813.1|221255_222509_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_027242814.1|222542_224411_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_052106215.1|224397_225636_-	MFS transporter	NA	NA	NA	NA	NA
WP_080963599.1|225620_227468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377461.1|227452_228658_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_017377460.1|228669_230859_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377459.1|231426_232056_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275307.1|232078_232498_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_027242816.1|232490_232895_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275308.1|232894_233737_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242817.1|233792_234773_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377453.1|234753_236751_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242818.1|236768_237944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|238225_239629_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|239777_240140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|240311_240530_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|241075_243103_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|243184_244435_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|244734_245070_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|245381_245630_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|245665_246175_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|246174_246954_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|246971_247319_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|247427_247703_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|247864_248221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|248619_248955_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|249159_249936_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|249892_250765_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|251049_251337_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|251420_252140_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|252270_252879_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|253684_254659_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|254738_255116_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027242786.1|255214_256306_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|257978_258476_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|258620_259019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|259104_260010_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|260228_260549_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_036773204.1|260630_261404_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|261980_262814_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|262843_263698_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_144420667.1|264074_265085_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|265229_265487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|265600_266857_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|267112_267292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|267785_268028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|268053_269412_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|269693_270053_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|270484_272119_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|272125_272962_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|272983_274261_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377577.1|274347_274665_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377576.1|274687_275779_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377575.1|275969_277559_+	APC family permease	NA	NA	NA	NA	NA
WP_017377574.1|277619_278393_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|278563_279613_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_036816899.1|280341_280533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|281362_282139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420668.1|282339_282651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|282743_283709_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275315.1|284920_285175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420669.1|285581_285824_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875996.1|285836_286712_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036816928.1|287038_287479_-	universal stress protein	NA	NA	NA	NA	NA
WP_081000007.1|289062_289467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999986.1|289628_289826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|290029_291004_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017377185.1|291352_292291_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|292354_294349_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_026063604.1|294351_294948_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_017377182.1|294944_295283_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_036774017.1|295672_296548_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	323279	330138	3192742		Hokovirus(33.33%)	5	NA	NA
WP_027242826.1|323279_323831_+	hypoxanthine-guanine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	26.3	3.7e-07
WP_027242827.1|324130_325315_+	MFS transporter	NA	NA	NA	NA	NA
WP_026063602.1|325469_327068_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.5	7.4e-56
WP_017377147.1|327525_328149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377146.1|328194_330138_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	34.0	1.7e-14
>prophage 8
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	340659	341382	3192742		Bacillus_phage(100.0%)	1	NA	NA
WP_017377133.1|340659_341382_+	RNA polymerase sigma factor FliA	NA	A0A1B1P7V3	Bacillus_phage	24.1	2.7e-05
>prophage 9
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	349357	370451	3192742	transposase	unidentified_phage(18.18%)	21	NA	NA
WP_017377125.1|349357_350113_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	25.0	2.0e-11
WP_080963632.1|350093_351494_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_027242831.1|351517_352735_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	42.5	4.0e-94
WP_016209778.1|352765_353140_+	iron-sulfur cluster assembly accessory protein	NA	A0A218MM00	uncultured_virus	38.5	1.7e-11
WP_017377121.1|353158_353710_+	putative Fe-S cluster assembly protein SufT	NA	NA	NA	NA	NA
WP_027242832.1|354057_354495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876002.1|354880_355864_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|356663_357817_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|357938_358631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|358639_359827_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|359976_360603_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|360648_361878_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|362072_362519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|362710_364069_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|364734_364908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|365037_365955_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|366296_366956_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|367036_367540_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|367512_367800_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|368092_369214_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|369476_370451_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 10
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	385437	438703	3192742	integrase,protease,transposase	Staphylococcus_phage(33.33%)	54	386505:386564	445071:445611
WP_036771330.1|385437_386412_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|386487_386805_-	hypothetical protein	NA	NA	NA	NA	NA
386505:386564	attL	ACTTAATGAGCTGCATGGTCGCTAGGGCTTTGTGGTGCTTCATGATTACTGACAAGCGTT	NA	NA	NA	NA
WP_075275321.1|386808_387177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|387910_388879_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|389088_390501_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|390688_391402_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|391422_391836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|391936_393010_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|393146_394046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|394301_394553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|394601_395237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|395361_396219_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_053856766.1|396406_397810_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|397985_398489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|398565_399867_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|400035_401136_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|401486_401729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|401722_402040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|403262_403490_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|404100_404571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|404793_405093_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|405089_405335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420676.1|405627_406584_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.8e-49
WP_017375591.1|406868_407072_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|407202_408231_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|408594_408840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|409202_410177_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|411648_413355_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|413400_414252_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|414454_416911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|417430_417832_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|418418_419393_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|419433_420762_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|421025_421595_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|421610_421922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|421931_422900_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|423012_423366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|423369_424434_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|424434_426174_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|426180_426603_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|426586_427216_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|427451_427550_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|427582_429454_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|429601_430576_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|430655_430799_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|430972_432316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420678.1|432814_433093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|433360_434317_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|434643_435027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420680.1|435042_435963_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|436278_437154_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|437155_437320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|437499_437685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|437728_438703_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
445071:445611	attR	AACGCTTGTCAGTAATCATGAAGCACCACAAAGCCCTAGCGACCATGCAGCTCATTAAGTTCTAACAGGAGCAGTCCGTCTATAATCAGGTTTTAAGCCTATTTTTAGCTGCTTTATCGATTATTGGCACCTGCACTTCGAATACTGGGAGTAATTTTTAGTCGAATTATCACAATTTCACAATATGGCTGATTTTCAGAATATTGTATTACCTAAGCGCAGATTTAGTTATTTAACTATTAAAATGAAAATCGGGATAACGCACTGTAGCCCGCTTTCTTTATTTAGACCGACACAGTTGAGGCCTTCGACGTTTTCGGCCTGGCTGCTGCTGACTATTACGATGATCTTCCCTGCGTTTTCCTTGCATGCTGCCTCCCAAGCGCTGCCCTCCCTGATGTTCGATTTCTGGTTTTTTAGGCGCTTTTGATCTGCGATCTAAACTAGAAACAGGTACATCATGCACTGGCTCAAATCCATCAACGAGTTTACGGGCTAATAACTGTCCGATTAAATGTTCAATATCAGATAATTGTTTGAT	NA	NA	NA	NA
>prophage 11
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	445350	446664	3192742		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_027243099.1|445350_446664_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
>prophage 12
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	454808	455633	3192742		Campylobacter_phage(100.0%)	1	NA	NA
WP_017376801.1|454808_455633_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
>prophage 13
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	461063	586992	3192742	transposase,tRNA	Tupanvirus(11.11%)	102	NA	NA
WP_017376809.1|461063_462833_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|463057_464191_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|465040_467860_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|468234_468960_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|471554_472115_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|472319_472652_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|472711_472999_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|473651_474677_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|474804_475779_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|475973_476927_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_017376824.1|477096_477255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|477527_478052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|478506_479334_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|479402_479588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|479788_480247_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|480387_480615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|480779_482165_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|482460_482775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|482883_484509_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|484921_485911_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|486232_486418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|486807_488763_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|488834_488957_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|488999_489974_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378302.1|490196_490658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|491042_491840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772310.1|492305_494111_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_027243044.1|494198_495545_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_075275422.1|498182_498614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772316.1|498765_499509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377201.1|501156_501627_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_017377202.1|502188_502791_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_027243048.1|503560_505048_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377206.1|505109_506567_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_065653751.1|506603_507068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|507095_507674_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_017377209.1|507944_509762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|509738_510788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|510987_511365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|512554_512842_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|512901_513198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|513342_513999_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|514238_514619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|515270_516674_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|516670_516952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|517346_517811_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|517991_518585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|518770_519745_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|520148_520973_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|521047_522196_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|522211_523840_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|524183_525377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|531491_531992_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|532405_532546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|532668_534129_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|534206_534689_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|534847_536113_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|536197_537457_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|537528_537801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|538138_538474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|538834_539083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|539353_539764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|539908_540445_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|540455_540641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|541076_542048_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|542029_543001_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|543114_543888_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|544158_544488_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|544743_545262_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|545314_545542_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|546523_547399_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|547590_547968_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|548527_549577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|549890_551276_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|551282_552821_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|552863_553589_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|553759_554992_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|555191_556013_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_048876018.1|557026_560893_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|561058_561934_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|561998_562277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|562421_562997_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|563045_563204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|563952_564669_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|565797_566214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|567128_568058_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|568029_568188_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|568336_568651_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|569560_570544_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|570694_571042_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|571041_571641_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|572015_572354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420692.1|572172_572562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|572565_573510_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420693.1|573497_573641_+	phosphatase	NA	NA	NA	NA	NA
WP_036771585.1|574002_574335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275332.1|577227_578229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376676.1|578301_578766_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_081329473.1|579138_579558_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376672.1|580948_584005_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027242910.1|584086_585541_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_027242911.1|585975_586992_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 14
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	592765	737606	3192742	transposase	Burkholderia_virus(16.67%)	120	NA	NA
WP_036772026.1|592765_593641_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|593678_594593_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|594657_595287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|595331_595766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|595746_596487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|596500_597898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316655.1|597900_600615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316656.1|600626_600848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|600847_602569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|602583_602988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|602988_605868_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|605870_606593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242919.1|606954_608847_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|608878_611419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|611450_612614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|612619_613243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|613257_614757_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|614773_615280_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|616535_616607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|616789_616972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|618173_618446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|618461_619895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|620039_621305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|621590_623342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|623354_624518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420697.1|624521_624818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|624857_625085_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|626953_627928_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|627986_628250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|628259_629573_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|629777_629951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764739.1|630018_630153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243218.1|630179_630377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|630394_630901_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|631823_632699_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378158.1|633178_636259_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017378159.1|636276_637329_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378160.1|637852_638503_+	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|638836_639481_+	porin family protein	NA	NA	NA	NA	NA
WP_017378162.1|639819_640359_+	porin family protein	NA	NA	NA	NA	NA
WP_144420698.1|640873_641035_+	phosphatase	NA	NA	NA	NA	NA
WP_075275334.1|641183_641477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377970.1|642251_642443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377969.1|642491_642731_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_144420699.1|643066_643396_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_026063694.1|643485_644070_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_017377966.1|644205_644892_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_027242960.1|645015_646200_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377963.1|646415_647858_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242961.1|647997_648948_+	DMT family transporter	NA	NA	NA	NA	NA
WP_048876021.1|649046_649820_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_017377960.1|649823_650573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|650645_652115_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_027242964.1|652429_653002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773041.1|653110_654610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242965.1|654931_657364_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017377953.1|657932_659129_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_017377952.1|659176_661543_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_144420700.1|662167_662317_+	phosphatase	NA	NA	NA	NA	NA
WP_048876022.1|662454_663306_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|663718_664872_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|664962_666066_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|666405_666906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|667602_667956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|668256_669984_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|670087_670813_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|670805_672044_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|672181_673219_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|673273_674176_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_027242968.1|675595_679087_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|679203_679881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|680008_680557_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017375873.1|682427_682589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|683780_684347_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|684349_685474_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|685558_686377_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|686507_688487_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|688546_689200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|689884_691255_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|692970_693618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|693655_694048_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|694300_695047_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_081377958.1|695683_696550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|696665_697640_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|697785_698514_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|698633_699215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|699237_702078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|704120_705071_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|705153_705936_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|706034_706328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|706850_707495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|707528_708173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|708221_709076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|709213_709726_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|709793_709988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|710201_710555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376683.1|713484_714186_-	cyclase family protein	NA	NA	NA	NA	NA
WP_087910647.1|714260_714920_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|715057_716314_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|716588_717251_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|717240_718473_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|718604_719222_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|719299_719806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|719816_720044_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|721326_721593_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|721822_722941_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|723085_723421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|723431_723845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|725053_725218_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|725254_726130_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929862.1|726316_726829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375899.1|729260_730460_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_017375900.1|730713_730995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927375.1|731050_733042_-	TRAP transporter permease	NA	NA	NA	NA	NA
WP_026063491.1|733115_734093_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_027242984.1|734228_735011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774087.1|735167_735491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764143.1|735558_736383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927818.1|736379_736661_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|736730_737606_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	753245	795856	3192742	transposase,tRNA	Staphylococcus_phage(25.0%)	41	NA	NA
WP_027242998.1|753245_753767_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|753848_754943_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|755909_757313_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|757482_758046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|758181_759657_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|759663_759870_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|759927_760998_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|761195_763166_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|763526_765086_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|765682_766039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|766879_767539_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|767634_768996_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|769137_769365_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|770416_771757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|772407_772569_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075278705.1|772668_773496_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|773849_774725_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|774768_775743_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|775762_775951_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242753.1|776595_777138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242754.1|777418_777772_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242755.1|777764_778910_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242756.1|779320_780568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242757.1|780705_781089_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242759.1|781818_782562_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_144420798.1|782575_783475_-	GTPase Era	NA	NA	NA	NA	NA
WP_027242761.1|783480_784155_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_036771308.1|784317_784539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910649.1|784566_785508_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|785504_787307_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_027242764.1|787616_788186_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242765.1|788340_789915_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_027242766.1|789922_790381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242767.1|790361_790607_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080963649.1|790648_791686_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242769.1|791832_792159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|792315_792726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420703.1|792868_793192_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_062365727.1|793452_794145_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|794141_794285_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|795628_795856_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 16
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	802757	938056	3192742	transposase	Staphylococcus_phage(23.81%)	113	NA	NA
WP_048876036.1|802757_803396_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|804109_805297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|805462_806416_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|806438_808457_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|808545_808869_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|809117_809294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|809521_810241_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|810856_811240_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|811883_812357_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|812462_813833_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|813948_814680_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|814704_815802_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|815837_817256_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|817465_817918_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|817929_818157_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|818206_818533_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|818736_819426_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|819574_820063_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_027242781.1|820103_821207_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|821249_822332_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|822324_822885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|822875_824180_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_048876041.1|824233_825256_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|825280_826297_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929892.1|826729_829852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|830248_830872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|831654_833205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|833499_834255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|834963_835938_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|838846_839518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|840595_841999_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|843586_846988_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|846984_849678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|849981_851481_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|852147_852969_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|853040_853526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|853674_855078_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|855074_856145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316658.1|856390_857302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075316659.1|857286_858564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|858586_859267_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144420705.1|859295_859496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|859581_859809_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876044.1|860887_861388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|861877_862051_+	phosphatase	NA	NA	NA	NA	NA
WP_144420800.1|862348_863050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375730.1|863201_864449_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_017375729.1|864827_865439_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375728.1|865524_866391_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|866394_867156_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375727.1|867319_868225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|868447_869263_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375724.1|869448_869838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375723.1|870116_870575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275340.1|870845_871454_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|871984_872860_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|873100_873775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|873803_874292_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|875336_875771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|875976_877380_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927811.1|877627_879139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|880099_880393_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|880350_880929_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|881014_881890_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|881882_882239_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|882247_882643_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|883967_884528_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|885650_887540_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048876049.1|887574_888000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876050.1|888185_888779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|888781_890080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|890060_891284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|891333_892134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|892130_892529_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|892525_892834_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|893227_893956_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|893996_894641_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|894653_895121_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|895175_896150_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|896179_896797_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|896775_897237_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|897280_898216_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|898243_899239_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|899462_900425_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|901852_902581_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|902631_904266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|904536_905724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|906325_906763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|909296_909569_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_027243100.1|910039_912223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|912427_912745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|912901_913876_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|913872_914262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|914342_915089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|915057_915786_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|916530_916818_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|916877_917042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|917038_918442_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|918474_919236_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|919521_920238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075278706.1|921015_921921_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|922407_923700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|923935_926686_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242868.1|928324_928792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|928792_929494_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|929755_929938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|930191_930566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|930675_932667_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|932656_933703_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|934143_934995_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|934995_935913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|936308_936482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|937084_938056_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	944142	997940	3192742	protease,transposase,tRNA	Burkholderia_virus(20.0%)	50	NA	NA
WP_017377031.1|944142_945072_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	30.6	2.2e-31
WP_144420711.1|945228_945654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|945770_945998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|946151_947126_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|947392_947662_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|947806_948763_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|948923_949850_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|950145_950907_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|951108_951720_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|951740_952940_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|953034_953175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|953187_953592_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|953822_954392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|954458_955499_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|955525_955753_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|956803_957661_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|957657_958419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|958503_961233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|961366_962242_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_065653747.1|962506_963847_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|963909_964623_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|964791_965283_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|965422_965914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|966116_967007_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|967391_967976_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|968056_968995_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|969046_970141_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|970265_971588_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|971635_976522_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|976616_976919_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|977029_978952_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|978973_980269_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|980265_981876_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|981982_982876_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|982985_983609_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|984315_985014_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|985157_985727_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|986042_986669_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|986865_987612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|987707_988547_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|988597_988945_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|989135_990023_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|990137_990740_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|990736_991456_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|991524_993237_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|993384_995322_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|995434_996484_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|996483_996759_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|996839_997388_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|997712_997940_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 18
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1015070	1067002	3192742	transposase	Staphylococcus_phage(38.46%)	46	NA	NA
WP_017376510.1|1015070_1015691_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.5	1.4e-18
WP_016210310.1|1015751_1015958_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_017376509.1|1015979_1018124_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.1	1.0e-12
WP_017376506.1|1020319_1021243_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	40.4	4.3e-24
WP_017376505.1|1021309_1022593_+	MFS transporter	NA	NA	NA	NA	NA
WP_036771330.1|1022833_1023808_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|1024123_1024285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1024281_1025685_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|1025798_1026566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1026924_1028328_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|1029148_1029349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|1029589_1031035_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|1032230_1033106_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|1034557_1034839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|1035057_1035237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|1035396_1036416_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|1036402_1036825_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|1036826_1037300_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|1037425_1038082_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|1038078_1038753_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|1038758_1039907_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|1039903_1040365_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|1040440_1041691_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|1041817_1043497_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|1043608_1044490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|1045465_1046059_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|1046420_1046936_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|1047875_1048160_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|1048709_1048985_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1049357_1050332_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242983.1|1050488_1051127_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|1051208_1051607_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|1051759_1052077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377747.1|1052155_1052410_-	LapA family protein	NA	NA	NA	NA	NA
WP_017377748.1|1052562_1054224_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|1054284_1054968_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|1054967_1056053_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_036773644.1|1056094_1058731_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	1.5e-98
WP_155051395.1|1059710_1059854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|1060535_1061855_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|1061858_1062575_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|1062571_1063213_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|1063205_1063340_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|1063588_1064044_-	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_027242980.1|1064135_1064480_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|1065598_1067002_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1070883	1071939	3192742		Halovirus(100.0%)	1	NA	NA
WP_017375707.1|1070883_1071939_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	34.7	1.5e-49
>prophage 20
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1075205	1080196	3192742		Paramecium_bursaria_Chlorella_virus(33.33%)	4	NA	NA
WP_017375710.1|1075205_1076162_+	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.3	3.6e-50
WP_027242977.1|1076210_1076747_+	orotate phosphoribosyltransferase	NA	A0A1V0SHG3	Hokovirus	39.9	1.3e-20
WP_017375712.1|1076743_1077505_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_027242976.1|1077607_1080196_-	ATP-dependent chaperone ClpB	NA	K4FB40	Cronobacter_phage	37.1	4.3e-122
>prophage 21
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1089645	1091709	3192742	tRNA	Catovirus(100.0%)	1	NA	NA
WP_027242971.1|1089645_1091709_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	26.2	5.5e-35
>prophage 22
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1098690	1099365	3192742		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_017376751.1|1098690_1099365_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	45.4	8.9e-35
>prophage 23
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1118318	1168627	3192742	transposase,tRNA	Organic_Lake_phycodnavirus(16.67%)	45	NA	NA
WP_017377990.1|1118318_1119362_+	SIS domain-containing protein	NA	F2Y1G4	Organic_Lake_phycodnavirus	27.6	3.1e-18
WP_017377989.1|1119374_1119845_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377988.1|1119977_1121168_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_144420806.1|1121526_1121778_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_048875859.1|1121919_1122714_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|1123003_1123927_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|1124194_1124488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|1125690_1126614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|1126749_1127592_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|1127679_1128330_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|1128343_1129384_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|1129506_1130592_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|1130618_1131728_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|1132032_1132350_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|1132346_1132706_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|1132808_1135541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|1137030_1137708_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|1137954_1138173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420716.1|1138317_1139526_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|1139953_1141411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|1142246_1142522_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|1145225_1145405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|1145401_1145773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1145783_1146866_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|1146862_1147084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|1148069_1148288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1148778_1149045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|1149303_1149624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|1151009_1152260_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|1152248_1153130_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|1153122_1154208_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|1154204_1155464_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|1155632_1156292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|1156462_1157125_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|1157471_1158419_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|1158515_1159142_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|1159147_1159729_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|1159800_1160892_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|1160981_1161695_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|1161788_1162613_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|1162846_1163524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|1165201_1165459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1165859_1166834_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|1167008_1167653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|1167832_1168627_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1172262	1211445	3192742	protease,transposase	Acinetobacter_phage(23.08%)	37	NA	NA
WP_027243053.1|1172262_1173288_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	30.5	4.5e-30
WP_087910651.1|1174322_1174499_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_155764740.1|1174794_1175115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377929.1|1175421_1176891_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|1176884_1178261_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|1178273_1178666_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|1178662_1179766_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|1179944_1181237_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|1181247_1182195_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|1182206_1183019_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|1183021_1183801_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|1183815_1184874_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|1184870_1185881_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|1185887_1186085_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|1186145_1189052_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|1189093_1189945_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|1190027_1190573_-	chorismate lyase	NA	NA	NA	NA	NA
WP_155764733.1|1190670_1190823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377818.1|1190843_1191530_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027243058.1|1191621_1192038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|1192119_1192626_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|1192671_1195623_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|1195644_1195977_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|1196094_1196604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|1197137_1197293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|1198367_1199534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|1199678_1200431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1200786_1201761_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|1201893_1202604_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|1202600_1203635_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|1203738_1204080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|1204590_1205751_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|1205719_1206316_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|1207284_1207455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1207451_1208426_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|1209445_1210599_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_017376389.1|1210824_1211445_-	dTMP kinase	NA	A0A1L2BX49	Bacteriophage	43.7	2.7e-38
>prophage 25
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1214808	1215051	3192742		Erythrobacter_phage(100.0%)	1	NA	NA
WP_016210413.1|1214808_1215051_-	acyl carrier protein	NA	A0A1P8VVJ5	Erythrobacter_phage	39.7	2.0e-05
>prophage 26
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1226349	1227033	3192742		Harp_seal_herpesvirus(100.0%)	1	NA	NA
WP_016209511.1|1226349_1227033_-	uracil-DNA glycosylase	NA	A0A0R5YU95	Harp_seal_herpesvirus	49.5	2.3e-46
>prophage 27
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1232685	1236456	3192742		Planktothrix_phage(33.33%)	5	NA	NA
WP_016209539.1|1232685_1233486_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	7.6e-25
WP_027242848.1|1233625_1234606_+	KpsF/GutQ family sugar-phosphate isomerase	NA	A0A2P0VNK5	Tetraselmis_virus	30.4	3.5e-32
WP_016209499.1|1234611_1235169_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_027242849.1|1235200_1235728_+	lipopolysaccharide transport periplasmic protein LptA	NA	NA	NA	NA	NA
WP_016209538.1|1235724_1236456_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.7	1.3e-20
>prophage 28
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1240226	1243417	3192742		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_017376362.1|1240226_1241066_-	carbon-nitrogen hydrolase family protein	NA	M1I6H3	Paramecium_bursaria_Chlorella_virus	26.6	3.9e-16
WP_017376361.1|1241216_1241861_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_017376360.1|1241878_1242265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376359.1|1242484_1243417_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.8	1.2e-21
>prophage 29
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1255743	1389133	3192742	transposase,plate,tRNA	Acinetobacter_phage(13.64%)	110	NA	NA
WP_027242858.1|1255743_1257051_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|1257055_1257766_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|1257778_1260949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|1261015_1262152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|1263014_1263872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|1264012_1264813_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|1264911_1265487_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|1265569_1266241_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|1266286_1267186_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|1267220_1267604_-	response regulator	NA	NA	NA	NA	NA
WP_080963653.1|1267753_1268584_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376328.1|1269214_1270240_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|1270370_1272875_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|1272881_1274150_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|1274151_1275135_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|1275147_1275969_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|1276013_1276406_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|1276480_1277287_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|1277474_1277903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1277961_1278936_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|1278959_1279397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1279431_1280835_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|1281415_1281577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|1282797_1283169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|1283276_1284827_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|1284859_1285699_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|1285695_1286211_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|1286214_1287207_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|1287585_1288956_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|1289164_1290304_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_075275355.1|1290517_1291492_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_017375775.1|1291539_1291734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376024.1|1291811_1292060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|1297715_1298396_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|1298460_1299747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|1300348_1300618_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|1300801_1301773_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|1301840_1302815_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|1302912_1303989_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|1304069_1305062_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|1305066_1306869_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|1306886_1308188_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027243118.1|1308203_1309487_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|1309619_1310012_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|1310118_1311204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|1311419_1312436_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|1312438_1313446_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|1313449_1314604_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|1314618_1314981_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|1314977_1316693_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|1316792_1317467_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|1317495_1317900_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|1317924_1318884_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|1319016_1319799_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|1319900_1320860_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|1321004_1321352_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376611.1|1322564_1323101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376610.1|1323908_1324919_+	DUF475 domain-containing protein	NA	A0A172Q0Y5	Acinetobacter_phage	40.6	9.5e-57
WP_144420814.1|1325353_1326271_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875883.1|1326415_1326952_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|1327211_1328114_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|1329103_1330093_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|1330261_1330600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|1330596_1331172_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|1331220_1331436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|1331622_1332462_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|1336158_1337067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|1337197_1337854_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|1337962_1338889_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|1339207_1339768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|1340237_1341557_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|1341624_1342491_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|1342483_1343359_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|1343417_1343636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|1345036_1345366_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_026063593.1|1345600_1346305_+	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_017377043.1|1346285_1348514_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|1348785_1349799_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|1349907_1350129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|1350133_1351771_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|1351909_1352443_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|1352563_1353682_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027242608.1|1353674_1354997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|1354983_1356120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|1356350_1356776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|1360105_1360459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1360493_1361369_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|1361525_1361930_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|1362077_1363253_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_155764735.1|1363512_1363968_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.5e-09
WP_017377059.1|1364054_1365539_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|1365762_1366716_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|1366696_1367788_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|1368090_1368333_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155048025.1|1369233_1369419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|1369400_1369976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420722.1|1370092_1370275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|1370850_1371123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|1371275_1371530_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|1371644_1373048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|1373132_1373639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|1374203_1376024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|1376090_1376621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|1378167_1378884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|1378926_1379364_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377074.1|1381174_1383169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|1383633_1384446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|1384629_1386093_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|1386452_1387832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|1388584_1389133_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 30
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1421210	1464570	3192742	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|1421210_1422185_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|1422181_1422619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|1422793_1424197_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|1424207_1424483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|1424760_1425231_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|1425533_1426904_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|1427233_1427701_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|1427713_1428724_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|1428925_1430329_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|1430755_1431544_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|1431530_1432559_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|1432536_1432941_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|1433168_1435136_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|1435331_1435823_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|1435857_1436700_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|1436745_1437198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|1437487_1438120_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|1438120_1439371_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|1439404_1440502_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|1440831_1442217_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|1442256_1442514_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|1444929_1446333_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|1446329_1447370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|1447762_1448158_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|1448154_1448943_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|1449128_1449854_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|1450098_1451286_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|1451578_1452121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|1452117_1452804_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|1452807_1453419_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|1453465_1454485_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|1454587_1455382_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|1455395_1456196_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|1456274_1457324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|1457499_1458780_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|1458825_1459503_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|1459588_1459870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|1459961_1460816_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|1460755_1461154_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|1461681_1462623_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|1463341_1463563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|1463559_1464570_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1472898	1530619	3192742	transposase	Staphylococcus_phage(71.43%)	51	NA	NA
WP_048875873.1|1472898_1474302_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375570.1|1474298_1474436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875872.1|1474608_1475892_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875871.1|1476096_1476300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376862.1|1476474_1477479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376863.1|1477836_1479072_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376864.1|1479238_1480189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875857.1|1480696_1481671_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_087910670.1|1482626_1482812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910671.1|1482905_1483370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1483757_1484732_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_032126138.1|1485159_1485423_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|1485864_1486839_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876253.1|1486835_1487492_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036772347.1|1487653_1488070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242641.1|1488072_1488414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420817.1|1488444_1488978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772352.1|1489159_1489387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242642.1|1489429_1489906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420818.1|1489917_1490106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242644.1|1490307_1493634_-	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_017376870.1|1493636_1494533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376871.1|1494809_1497113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772357.1|1497154_1498774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242646.1|1499225_1500728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242647.1|1500789_1503789_-	ATPase AAA	NA	NA	NA	NA	NA
WP_048875870.1|1503825_1504251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376878.1|1504257_1504911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242649.1|1504903_1505980_-	type IVB secretion system coupling complex protein DotM/IcmP	NA	NA	NA	NA	NA
WP_027242650.1|1505982_1506471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420726.1|1508960_1509200_-	type IV secretion protein IcmT	NA	NA	NA	NA	NA
WP_017376886.1|1509204_1510335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376887.1|1510337_1511084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376888.1|1511076_1511580_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_027242651.1|1511632_1512043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242652.1|1512157_1513198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242653.1|1513213_1514140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242654.1|1514157_1515381_-	conjugal transfer protein TrbI	NA	NA	NA	NA	NA
WP_017376891.1|1515377_1516280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420727.1|1516449_1517220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242655.1|1517524_1518421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376894.1|1518644_1518878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046566.1|1519094_1519688_+	DedA family protein	NA	NA	NA	NA	NA
WP_027242656.1|1519705_1520524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420728.1|1520803_1521610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242658.1|1521685_1523149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|1524491_1525895_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|1526014_1526653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|1527000_1527975_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|1528283_1529309_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|1529416_1530619_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
>prophage 32
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1535787	1536291	3192742		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_017377353.1|1535787_1536291_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
>prophage 33
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1545119	1546544	3192742		Synechococcus_phage(100.0%)	1	NA	NA
WP_017377343.1|1545119_1546544_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
>prophage 34
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1554046	1589137	3192742	transposase	Escherichia_phage(16.67%)	39	NA	NA
WP_048875864.1|1554046_1555072_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|1555455_1556313_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|1556482_1557211_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|1557411_1558815_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|1558960_1559458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|1559527_1560430_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376921.1|1560687_1561020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772950.1|1561081_1561618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376923.1|1561716_1562883_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.7	1.3e-25
WP_017376924.1|1563188_1565987_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4P767	Pseudomonas_phage	45.1	1.1e-179
WP_017376925.1|1566045_1567266_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A1V0EEL7	Caulobacter_phage	28.7	4.2e-35
WP_017376927.1|1567771_1567909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376929.1|1568335_1568623_+	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_017376930.1|1568779_1569109_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_017376931.1|1569143_1570781_-	response regulator	NA	NA	NA	NA	NA
WP_017376932.1|1570882_1571932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376933.1|1572004_1572649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063581.1|1572645_1573899_-	UbiH/UbiF/VisC/COQ6 family ubiquinone biosynthesis hydroxylase	NA	NA	NA	NA	NA
WP_017376935.1|1573916_1575188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376936.1|1575212_1575803_-	UPF0149 family protein	NA	NA	NA	NA	NA
WP_017376937.1|1575947_1576172_+	TIGR02449 family protein	NA	NA	NA	NA	NA
WP_016209991.1|1576152_1576482_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_026063582.1|1576708_1577272_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_017376939.1|1577308_1577770_+	EVE domain-containing protein	NA	NA	NA	NA	NA
WP_017376940.1|1577847_1579533_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.6	2.9e-26
WP_026063583.1|1579582_1580410_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_016210000.1|1580409_1580958_-	ADP compounds hydrolase NudE	NA	NA	NA	NA	NA
WP_017376942.1|1581087_1581480_+	ribosome-associated heat shock protein Hsp15	NA	NA	NA	NA	NA
WP_017376943.1|1581730_1581988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046564.1|1581984_1582596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910653.1|1582800_1583016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046563.1|1583032_1583170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971662.1|1583639_1584614_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|1584897_1586100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|1586396_1586654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|1586611_1587052_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|1587157_1587724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|1587868_1588123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|1588267_1589137_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 35
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1592156	1593434	3192742		Stx2-converting_phage(100.0%)	1	NA	NA
WP_017376955.1|1592156_1593434_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
>prophage 36
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1601247	1627597	3192742	protease,transposase,tRNA	Staphylococcus_phage(40.0%)	28	NA	NA
WP_017376964.1|1601247_1603728_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|1603790_1604222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|1604422_1604713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|1604772_1606371_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|1606535_1606871_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|1606899_1608564_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|1608563_1609205_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|1609204_1609948_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|1610006_1610243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|1610393_1611761_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|1611771_1612323_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|1612403_1613507_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|1613508_1615266_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|1615488_1616112_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|1616166_1616586_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_027242668.1|1617397_1618183_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|1618814_1619831_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|1619833_1620346_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|1620387_1620861_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|1620916_1621702_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|1621745_1622486_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|1622575_1622824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|1623199_1623853_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420733.1|1623821_1624001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856770.1|1624398_1625613_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875859.1|1625921_1626716_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375625.1|1626848_1627076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772490.1|1627318_1627597_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 37
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1643434	1656242	3192742		Klosneuvirus(25.0%)	6	NA	NA
WP_016209759.1|1643434_1644625_-	elongation factor Tu	NA	A0A1V0SLW6	Klosneuvirus	27.0	2.4e-14
WP_017378035.1|1644652_1646764_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	26.7	7.0e-54
WP_016209732.1|1646779_1647253_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_016209765.1|1647357_1647732_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_017378036.1|1647893_1652102_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	1.4e-69
WP_017378037.1|1652165_1656242_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.6	1.2e-22
>prophage 38
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1671507	1674669	3192742		Cafeteria_roenbergensis_virus(50.0%)	2	NA	NA
WP_017378059.1|1671507_1672650_-	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	38.5	2.7e-31
WP_017378060.1|1672734_1674669_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	52.6	6.3e-150
>prophage 39
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1681665	1744549	3192742	protease,transposase,tRNA	Staphylococcus_phage(33.33%)	65	NA	NA
WP_017378070.1|1681665_1682139_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	1.9e-28
WP_036771446.1|1682329_1683223_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_017378072.1|1683232_1684051_-	hypothetical protein	NA	M1HWP4	Paramecium_bursaria_Chlorella_virus	28.5	1.3e-16
WP_017378073.1|1684144_1685086_-	glutaminase A	NA	NA	NA	NA	NA
WP_017378074.1|1685216_1686170_+	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_027242674.1|1686173_1686611_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_027242675.1|1686630_1687530_+	DUF1853 family protein	NA	NA	NA	NA	NA
WP_075275368.1|1688137_1688491_+	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_026063702.1|1688557_1689355_-	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_017378078.1|1689402_1689762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1689936_1690911_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378082.1|1691732_1692086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378083.1|1692115_1692694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242676.1|1692811_1693573_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_048875857.1|1693811_1694786_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017378088.1|1694889_1695246_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_017378089.1|1695235_1695952_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017378090.1|1695959_1696445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929647.1|1696553_1696835_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	39.2	9.1e-10
WP_017378092.1|1697708_1698173_+	DUF3757 domain-containing protein	NA	NA	NA	NA	NA
WP_027242677.1|1698246_1698591_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_047927317.1|1698674_1701014_-	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_017378095.1|1701182_1702592_+	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	30.0	7.6e-28
WP_047927315.1|1702588_1703086_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4VNV0	Pandoravirus	33.6	1.1e-13
WP_017378097.1|1703282_1704461_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_017378098.1|1704544_1705297_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_017378099.1|1705404_1705920_+	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_017378100.1|1706050_1706461_+	phasin family protein	NA	NA	NA	NA	NA
WP_027242678.1|1706600_1706948_+	phasin family protein	NA	NA	NA	NA	NA
WP_017378103.1|1707013_1708081_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017378104.1|1708074_1708593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378105.1|1708688_1710860_-	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_016209298.1|1710927_1711194_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_017378106.1|1711257_1712202_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|1712201_1712555_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|1712603_1715279_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|1715295_1716813_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|1716889_1717342_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|1717560_1719000_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|1718999_1720538_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|1720552_1722523_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|1722526_1722832_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|1722855_1723479_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|1723498_1723987_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|1724000_1725026_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|1725030_1727424_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|1727473_1728763_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|1728769_1729270_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|1729269_1730523_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|1730524_1731202_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|1731219_1731705_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|1731695_1732064_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|1732742_1733105_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|1733118_1733880_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|1734181_1735528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|1735624_1736167_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|1736282_1737116_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|1737137_1737731_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|1737905_1738925_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|1739195_1739597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|1739607_1739931_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_017378130.1|1739954_1740842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378132.1|1741030_1741879_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|1741995_1742907_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|1743673_1744549_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 40
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1750628	1800805	3192742	transposase	Erwinia_phage(16.67%)	43	NA	NA
WP_036773116.1|1750628_1751603_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|1751661_1752714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|1753032_1753998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|1754300_1755125_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|1755326_1756403_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|1756487_1757474_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|1757492_1758137_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|1758148_1759258_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|1759324_1759987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764736.1|1760246_1762034_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|1762442_1763942_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|1764032_1764815_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|1764942_1765863_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|1765886_1766345_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|1766466_1767342_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|1767375_1768641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1768828_1769704_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|1769901_1770093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|1770297_1771593_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|1771912_1772131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|1772167_1773547_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|1773574_1774033_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|1774010_1775228_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|1775420_1775657_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|1775670_1775826_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|1775906_1776869_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|1777028_1778345_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|1778354_1779023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|1779433_1781248_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|1781963_1782149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|1782330_1782789_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1783507_1784383_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420737.1|1784614_1785013_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|1785016_1785259_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|1786148_1787900_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|1787910_1788711_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|1788813_1789302_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|1789801_1790725_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|1790821_1791166_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|1796860_1797823_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|1797861_1798737_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|1798996_1800256_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|1800478_1800805_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
>prophage 41
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1821123	1822098	3192742	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036771330.1|1821123_1822098_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 42
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1828655	1829612	3192742		Enterobacteria_phage(100.0%)	1	NA	NA
WP_017377563.1|1828655_1829612_-	type IV pilus secretin PilQ	NA	G4WZN6	Enterobacteria_phage	24.5	1.0e-12
>prophage 43
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1843309	1845554	3192742	tRNA	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage(50.0%)	2	NA	NA
WP_017377407.1|1843309_1843831_-	phospholipase D family protein	NA	E9P5Z4	Wolbachia_endosymbiont_wVitA_of_Nasonia_vitripennis_phage	46.2	1.7e-30
WP_017377406.1|1844156_1845554_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9KZD3	Tupanvirus	36.2	3.9e-77
>prophage 44
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1855092	1915735	3192742	transposase,tRNA	Acinetobacter_phage(33.33%)	57	NA	NA
WP_075278722.1|1855092_1855968_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|1856492_1857089_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|1857359_1857938_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|1862460_1863966_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|1863993_1864275_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|1864423_1864765_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|1864885_1866790_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|1866922_1868494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316667.1|1868651_1869722_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017377379.1|1869843_1870842_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|1870845_1871604_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|1871605_1872805_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|1872788_1873460_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|1873481_1874258_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|1874261_1875260_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|1875261_1875840_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|1875836_1877306_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|1877349_1877637_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|1877837_1878758_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|1878873_1879428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|1879543_1879969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|1880239_1880590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|1880783_1881323_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|1881407_1881944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|1882602_1882905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|1883353_1883923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242708.1|1883991_1884336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|1884514_1885489_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|1885755_1885929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1886034_1887438_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|1887442_1888462_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|1889078_1889408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|1889633_1890032_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|1890899_1891850_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|1891849_1893928_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|1894069_1894585_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|1894593_1895157_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|1895137_1895884_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|1896022_1896475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|1896610_1897447_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|1897443_1898340_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|1898372_1899440_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|1899458_1899827_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_080963575.1|1899852_1901304_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|1901310_1902690_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|1902730_1904044_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|1904033_1905008_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|1905101_1905605_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|1905739_1906891_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|1906887_1907367_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|1907513_1909835_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|1909779_1910406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|1910410_1911310_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|1911490_1912045_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1912084_1913059_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378420.1|1913648_1914026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1914760_1915735_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 45
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1925928	1927236	3192742		Moraxella_phage(100.0%)	1	NA	NA
WP_027242742.1|1925928_1927236_-	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	28.4	1.2e-24
>prophage 46
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1935325	1938019	3192742		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_027242743.1|1935325_1938019_+	DNA polymerase I	NA	A0A2H4J6W7	uncultured_Caudovirales_phage	30.7	9.9e-69
>prophage 47
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1948647	1949781	3192742		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_017378449.1|1948647_1949781_-	hypothetical protein	NA	F2NZ38	Diadromus_pulchellus_ascovirus	31.8	3.1e-40
>prophage 48
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1972802	1975214	3192742		Bacillus_virus(100.0%)	1	NA	NA
WP_017378470.1|1972802_1975214_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.0	2.1e-110
>prophage 49
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	1982124	2101083	3192742	protease,transposase,tRNA	Escherichia_phage(18.18%)	108	NA	NA
WP_017378478.1|1982124_1983504_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|1983618_1985511_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|1985558_1986185_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|1986204_1987089_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|1987121_1988012_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|1988126_1988525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|1988529_1989345_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|1989396_1989801_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|1989855_1990326_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|1990337_1990865_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|1990881_1992423_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|1992448_1993309_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|1993339_1994731_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|1994755_1995184_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|1995277_1996642_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|1996698_1998534_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|1998647_1999376_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|1999902_2001444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|2001710_2002367_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|2003064_2003724_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|2003868_2004126_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|2004238_2004991_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|2005049_2005763_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|2005954_2006587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2008321_2009725_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|2009721_2009946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2010025_2011000_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376724.1|2011413_2011626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|2011872_2012292_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|2012389_2012836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|2013180_2014179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|2014211_2014565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|2014609_2014882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|2015278_2016697_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|2016923_2017865_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|2017899_2019879_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|2019875_2020481_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|2020482_2020824_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|2020824_2021661_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|2021826_2022144_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|2022221_2023643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|2023639_2024335_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|2025521_2026367_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|2026376_2026715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|2027283_2028687_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|2028719_2029664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|2029868_2030042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|2030649_2031699_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2031853_2032072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2032391_2033795_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|2033805_2034363_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|2034359_2035235_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|2035459_2035750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|2038373_2039147_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|2039565_2039922_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|2039953_2040406_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243065.1|2040558_2043621_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_017376261.1|2043617_2044682_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376260.1|2045045_2045999_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376259.1|2046031_2047195_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376258.1|2047200_2047800_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376257.1|2047987_2048488_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376256.1|2048505_2049594_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376255.1|2049732_2050977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|2050973_2051816_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376253.1|2051795_2052605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420746.1|2052791_2053007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376251.1|2053007_2053970_+	TonB family protein	NA	NA	NA	NA	NA
WP_017376250.1|2054025_2054577_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376249.1|2054706_2055129_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376248.1|2055121_2055883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376247.1|2055937_2056636_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_026063518.1|2056622_2057471_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376244.1|2058088_2058613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376243.1|2058745_2059960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376242.1|2060274_2061336_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376241.1|2061349_2063077_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_027243064.1|2063110_2063842_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_027243063.1|2063841_2064630_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243062.1|2064734_2065358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376237.1|2066689_2067442_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027242703.1|2073121_2073745_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376193.1|2073784_2074270_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017376192.1|2074316_2075462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653742.1|2075463_2077734_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_036771610.1|2077735_2078596_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_017376188.1|2078592_2079465_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_017376187.1|2079461_2080469_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376186.1|2080488_2080896_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_065653741.1|2080924_2082313_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_027242702.1|2082309_2083482_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_017376183.1|2083513_2084365_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242701.1|2084374_2085538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242700.1|2085534_2086542_+	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242699.1|2086538_2087675_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017376177.1|2087671_2088598_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_017376176.1|2088692_2090093_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_144420747.1|2090380_2091769_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_036771589.1|2091850_2092678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771607.1|2092896_2093901_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209597.1|2093954_2094185_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771588.1|2094192_2095071_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_017376171.1|2095207_2096182_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376170.1|2096539_2097640_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
WP_017376169.1|2097705_2098416_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036771603.1|2098465_2099707_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_016209598.1|2099773_2100358_+	YggT family protein	NA	NA	NA	NA	NA
WP_144420748.1|2100447_2101083_+	alpha/beta hydrolase fold domain-containing protein	NA	A0A0N9R3I3	Chrysochromulina_ericina_virus	28.9	6.9e-05
>prophage 50
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2109222	2113601	3192742		Burkholderia_virus(50.0%)	3	NA	NA
WP_017376155.1|2109222_2110125_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.7	4.5e-18
WP_058893787.1|2110148_2111033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376152.1|2111591_2113601_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	8.6e-110
>prophage 51
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2116854	2124385	3192742		Staphylococcus_phage(50.0%)	4	NA	NA
WP_017376147.1|2116854_2118375_+	AMP-binding protein	NA	A0A2H4PQM9	Staphylococcus_phage	27.4	3.2e-32
WP_047927418.1|2119365_2120685_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017376145.1|2120788_2121172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075278724.1|2121319_2124385_-	MMPL family transporter	NA	S5VTK5	Leptospira_phage	20.8	7.1e-55
>prophage 52
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2135901	2136159	3192742		Rhizobium_phage(100.0%)	1	NA	NA
WP_017376129.1|2135901_2136159_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	42.1	1.2e-11
>prophage 53
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2142007	2144200	3192742		Bacillus_phage(100.0%)	1	NA	NA
WP_017376121.1|2142007_2144200_+	DNA helicase II	NA	A7KV33	Bacillus_phage	35.9	1.7e-106
>prophage 54
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2170631	2301413	3192742	protease,tail,transposase,tRNA	Acinetobacter_phage(11.11%)	113	NA	NA
WP_017377604.1|2170631_2172614_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|2172823_2174167_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|2174433_2177103_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|2177126_2179043_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|2179212_2180634_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|2180778_2181753_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|2181762_2182062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|2182179_2182401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|2182564_2184226_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|2184298_2184589_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|2184815_2185271_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|2185335_2185800_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|2185891_2187238_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|2187237_2188143_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|2188204_2189191_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2189183_2189426_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|2189544_2191089_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|2191135_2192422_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|2192464_2193868_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|2193872_2196410_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|2196806_2197055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|2196986_2197448_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|2197942_2198638_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|2198739_2200302_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|2200629_2202423_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|2202509_2202782_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|2202787_2203414_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|2203400_2204831_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|2205152_2206208_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|2206176_2206854_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|2206843_2207692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|2207837_2208131_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|2208242_2209055_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|2209353_2210208_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|2210361_2211411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|2211456_2212113_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|2212130_2213411_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|2213684_2215046_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|2215106_2215658_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|2221088_2222360_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|2222416_2223400_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|2223396_2224182_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|2224489_2224939_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2225032_2226436_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|2226873_2228355_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|2228410_2229520_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|2231092_2231305_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|2231345_2232041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075316668.1|2232304_2234491_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|2234693_2235260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|2235417_2235978_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|2236097_2237501_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|2237497_2237854_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|2238109_2238934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|2239631_2240156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2240441_2241416_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|2241515_2242067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2242179_2242833_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|2243084_2244542_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|2244655_2245135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2245372_2245978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|2246257_2247373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2247311_2247998_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|2247991_2248969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2249003_2250167_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|2250506_2250731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|2251113_2251401_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|2251575_2252331_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2252363_2252795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|2252770_2253247_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|2253253_2254831_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|2254833_2255598_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|2255651_2256188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2256184_2256916_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|2257140_2257902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2258227_2259103_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|2260505_2260661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2260854_2262564_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|2263217_2263526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|2263543_2265736_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|2266543_2266792_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|2266904_2267138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|2267372_2267903_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|2267907_2268621_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|2269248_2269974_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_017375917.1|2269982_2271242_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	2.4e-17
WP_017375916.1|2271340_2272045_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_027243033.1|2272224_2272704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2273196_2274564_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|2274955_2275753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2275864_2277154_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|2277334_2278321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|2278437_2278617_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|2278628_2279060_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|2279272_2279632_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|2279801_2281427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2282150_2283578_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|2283871_2285053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|2287654_2288953_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|2289308_2290202_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|2290198_2290504_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|2290529_2291309_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|2291338_2291569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|2291720_2291966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|2292152_2292944_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|2293643_2294366_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|2294362_2295244_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|2295267_2296758_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|2296847_2297735_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|2298407_2298899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2298903_2299131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2299223_2300198_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|2300174_2301413_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 55
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2309377	2365678	3192742	transposase	Staphylococcus_phage(50.0%)	51	NA	NA
WP_053856767.1|2309377_2310781_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2310886_2311072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2311770_2313174_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|2313264_2313768_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2313807_2314782_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|2314778_2315348_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|2315833_2316526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|2317133_2318126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|2318115_2319888_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|2319888_2320077_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|2320114_2321089_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|2321147_2321342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2321408_2321636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2321765_2322641_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2322868_2323018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|2323009_2323276_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|2323420_2324320_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2324406_2324664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2325276_2326503_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|2326592_2327132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|2327253_2327892_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|2327925_2328414_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|2328660_2328963_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|2328943_2329432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2330002_2331301_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|2331417_2331708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2331746_2334401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|2335113_2335368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|2335677_2336406_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|2337176_2338361_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|2338379_2339324_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|2339629_2340415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|2340528_2340897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|2341125_2342703_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|2343486_2347911_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|2348047_2349571_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|2349775_2350003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|2350147_2350405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|2350972_2351944_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|2351868_2352177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|2352240_2352462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2352581_2353556_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|2353609_2354581_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2354660_2355635_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|2355995_2358665_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|2358835_2359717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|2359727_2360384_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|2360450_2361155_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|2361385_2362789_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378310.1|2362819_2363749_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027242738.1|2363983_2365678_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.3	5.3e-20
>prophage 56
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2401282	2403988	3192742	transposase	uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_017378343.1|2401282_2402857_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	21.3	9.4e-11
WP_048875857.1|2403013_2403988_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
>prophage 57
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2414290	2414839	3192742		Klosneuvirus(100.0%)	1	NA	NA
WP_017378355.1|2414290_2414839_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.9	5.9e-29
>prophage 58
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2418113	2542155	3192742	transposase,tRNA	Staphylococcus_phage(24.14%)	106	NA	NA
WP_017378360.1|2418113_2419682_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.9	6.7e-09
WP_048875895.1|2419773_2420937_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|2420990_2421992_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|2422073_2422643_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|2422856_2423828_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|2423839_2425435_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|2425455_2426487_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|2426818_2427922_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|2428033_2429218_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|2429295_2431284_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_144420609.1|2432443_2433817_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|2433834_2434821_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|2434823_2435978_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|2435974_2436670_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|2436812_2438303_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|2438323_2439373_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|2439439_2440834_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|2441766_2443698_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|2443702_2444233_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|2444267_2444462_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|2444504_2444864_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|2444995_2445991_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|2446003_2448385_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|2448390_2448678_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|2448944_2449151_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|2450759_2451533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|2451534_2452476_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|2452609_2454187_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|2454380_2454779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|2455779_2455986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|2456790_2457435_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|2457502_2458759_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|2459014_2459194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|2459416_2459644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|2460919_2461678_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|2461895_2462459_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|2462562_2463111_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|2463707_2464860_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|2465205_2465502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|2465761_2466673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|2466907_2467447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|2468609_2468747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|2468993_2469722_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|2469768_2470377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|2471651_2471912_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|2472085_2473624_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|2473802_2474729_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|2474833_2475766_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
WP_017377279.1|2476262_2479076_+|tRNA	isoleucine--tRNA ligase	tRNA	K7YVP8	Megavirus	26.8	1.0e-76
WP_017377278.1|2479068_2479578_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_017377277.1|2479581_2480025_+	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_027243089.1|2480120_2481422_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377276.1|2481684_2482053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377275.1|2482044_2482767_-	aquaporin family protein	NA	M1H9L8	Acanthocystis_turfacea_Chlorella_virus	37.6	1.6e-26
WP_155052690.1|2483849_2485181_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	45.7	2.4e-36
WP_144420611.1|2485213_2485414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875901.1|2485948_2486923_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017377271.1|2487333_2487663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377270.1|2488048_2488414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377269.1|2488537_2489398_+	DUF692 domain-containing protein	NA	NA	NA	NA	NA
WP_017377268.1|2489384_2490164_+	DUF2063 domain-containing protein	NA	NA	NA	NA	NA
WP_016210168.1|2490239_2490923_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036771941.1|2491083_2491689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377265.1|2491904_2492408_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_017377264.1|2492609_2492864_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_017377263.1|2493365_2493833_+	DoxX family protein	NA	NA	NA	NA	NA
WP_036771922.1|2494399_2495590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2496424_2497828_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275269.1|2498134_2498755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875903.1|2498934_2499909_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	6.2e-29
WP_017376501.1|2500074_2500341_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_144420759.1|2500337_2500838_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_048875904.1|2500958_2501834_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375999.1|2503493_2504024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376000.1|2504023_2504548_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	58.4	1.5e-50
WP_017376001.1|2504710_2505826_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_017376003.1|2506061_2507222_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	58.7	2.8e-121
WP_017376004.1|2507673_2509677_+	transketolase	NA	NA	NA	NA	NA
WP_017376005.1|2509745_2510753_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_017376006.1|2510826_2512011_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_017376007.1|2512020_2513475_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_017376008.1|2513505_2514543_+	fructose-bisphosphate aldolase class II	NA	NA	NA	NA	NA
WP_017376009.1|2514865_2515156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2516510_2517485_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_155046691.1|2517684_2518281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377794.1|2518804_2519056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377795.1|2519260_2520424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275388.1|2520446_2521136_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017377798.1|2521283_2521934_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_017377799.1|2522034_2522694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875907.1|2524755_2525517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377800.1|2525935_2526196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377801.1|2526281_2526944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377802.1|2527060_2528188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377803.1|2528563_2528725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420613.1|2530856_2531228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243006.1|2531507_2532749_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_075275272.1|2532886_2533117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377811.1|2533250_2534135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243005.1|2534163_2534790_-	ribonuclease T	NA	NA	NA	NA	NA
WP_036773165.1|2534820_2536020_-	Bcr/CflA family efflux MFS transporter	NA	NA	NA	NA	NA
WP_144420614.1|2536258_2537356_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	43.1	1.1e-05
WP_017377815.1|2537509_2539048_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|2539368_2539704_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|2540516_2540810_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|2541180_2542155_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 59
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2546835	2547468	3192742		Indivirus(100.0%)	1	NA	NA
WP_016210817.1|2546835_2547468_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
>prophage 60
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2551982	2660406	3192742	transposase,tRNA	Bacillus_phage(16.13%)	113	NA	NA
WP_017377787.1|2551982_2552210_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|2552466_2553441_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048875941.1|2553864_2554176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|2554172_2555255_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|2555288_2556077_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|2556207_2556903_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|2557407_2557914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|2558007_2558565_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|2558862_2560212_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2560298_2560556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|2560623_2561334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|2561478_2561658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|2562181_2563441_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|2563573_2564047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|2564055_2565438_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|2565430_2566045_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|2566124_2566841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|2567015_2569340_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|2569506_2570481_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376573.1|2571410_2573153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|2573324_2574416_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|2574448_2575087_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|2575125_2575398_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|2575496_2575739_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|2575756_2576059_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|2576142_2576685_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|2576845_2577472_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|2577477_2578317_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|2578306_2578957_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|2578960_2579794_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|2579883_2581011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|2581277_2581430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|2581537_2581732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|2581924_2582575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|2582829_2583921_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|2583917_2585282_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|2585406_2586603_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
WP_144420764.1|2586659_2587223_+	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_017376590.1|2588155_2588824_-	hypothetical protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	44.1	4.7e-28
WP_017376591.1|2588970_2590272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376593.1|2591762_2592167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243040.1|2592400_2593483_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.2	1.4e-18
WP_017376596.1|2593467_2594088_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376597.1|2594152_2595028_+	hypothetical protein	NA	A0A140B3P3	Vibrio_phage	24.0	1.8e-11
WP_017376598.1|2595105_2595681_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_017377700.1|2596489_2596783_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|2596899_2597049_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2598377_2599352_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|2599450_2599606_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|2599524_2599785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|2599961_2600489_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|2600743_2600968_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|2601112_2601934_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|2601891_2602185_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|2603661_2603949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|2604441_2605212_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|2605281_2606694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|2607060_2608431_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|2608427_2608592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|2608651_2608939_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|2609970_2610561_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|2610687_2612073_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|2612170_2612368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|2612460_2613294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|2613831_2614185_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|2614197_2614434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|2614433_2614640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|2614801_2615521_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|2615609_2617394_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|2617700_2617856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|2617782_2618037_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|2618182_2619004_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|2619186_2619411_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2619516_2620920_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|2621484_2621673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|2621802_2622069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|2622454_2624095_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|2624207_2625557_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|2625553_2626423_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|2627347_2628661_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|2628657_2629428_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|2629424_2629652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046617.1|2630356_2630497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046616.1|2630641_2631805_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	31.4	2.1e-20
WP_069971647.1|2631773_2632370_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2633338_2633566_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|2634533_2634938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875923.1|2634941_2635937_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|2635922_2637125_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|2637051_2637666_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|2638361_2638523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|2638802_2639348_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|2639381_2640047_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_155764145.1|2640106_2640718_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	31.3	5.1e-13
WP_048875917.1|2640657_2641062_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_144420767.1|2641340_2642018_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|2642060_2642642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|2642786_2643458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|2644060_2644648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2645616_2645844_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036773915.1|2645816_2646212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377727.1|2646640_2647456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377726.1|2647546_2648533_+	transaldolase	NA	V5UTB0	Synechococcus_phage	33.5	1.3e-13
WP_017377725.1|2648702_2649224_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.8	1.8e-27
WP_017377724.1|2649257_2649509_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.6	3.9e-20
WP_017377723.1|2649519_2650797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377722.1|2651488_2652016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377721.1|2652132_2654445_-	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_036773913.1|2654573_2655389_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075316670.1|2655641_2656109_+	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|2657525_2657753_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377716.1|2657887_2659351_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377715.1|2659353_2660406_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
>prophage 61
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2665108	2872021	3192742	protease,transposase,integrase,tRNA	Staphylococcus_phage(20.59%)	167	2849774:2849833	2865931:2866427
WP_048875919.1|2665108_2665426_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|2665443_2665656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2666609_2666837_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|2667994_2668756_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|2670946_2671921_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|2672045_2673482_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|2673561_2675022_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|2675142_2675430_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|2675627_2676671_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|2676686_2677586_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|2677582_2678101_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|2678170_2678788_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|2678797_2680285_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|2680294_2683975_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|2684048_2684858_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|2684857_2685538_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|2686162_2687137_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|2687179_2688175_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|2688227_2689202_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376224.1|2689514_2690399_-	DUF2608 domain-containing protein	NA	NA	NA	NA	NA
WP_017376223.1|2690529_2691351_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_017376222.1|2691352_2692390_-	asparaginase	NA	NA	NA	NA	NA
WP_017376221.1|2692393_2695051_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_017376220.1|2695128_2695938_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_017376219.1|2696344_2697112_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_017376218.1|2697276_2698155_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_017376217.1|2698158_2698896_+	UMP kinase	NA	NA	NA	NA	NA
WP_017376216.1|2698899_2699457_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_026063514.1|2699464_2700211_+	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	44.0	6.6e-23
WP_080963646.1|2700125_2701025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771906.1|2701113_2701989_+	lipid A biosynthesis acyltransferase	NA	NA	NA	NA	NA
WP_144420622.1|2702085_2703663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376212.1|2704107_2706018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376211.1|2706554_2707094_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_017376210.1|2707090_2708119_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_017376209.1|2708108_2709173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155069468.1|2709160_2711374_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_027242906.1|2711375_2712443_-	hydroxymethylglutaryl-CoA reductase	NA	NA	NA	NA	NA
WP_036771893.1|2712727_2715145_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_017376207.1|2715225_2715759_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_017376206.1|2715869_2716919_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_075275393.1|2716936_2717383_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_017376204.1|2717382_2718156_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_027242907.1|2718174_2719329_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_017376201.1|2719542_2720112_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	43.4	3.4e-27
WP_027242908.1|2723718_2724678_+	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_017376198.1|2724652_2726113_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|2726148_2727678_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|2727711_2729115_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|2731026_2732841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2732925_2734329_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|2734474_2735878_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|2736362_2737337_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|2737805_2738696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|2739356_2740193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|2740481_2743154_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|2743402_2744593_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|2744925_2745120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|2745056_2746709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|2747309_2748536_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|2748931_2749477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|2749436_2749814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2749810_2751214_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|2751432_2751858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817095.1|2751965_2753396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|2753705_2754245_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|2754534_2754762_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|2756007_2756583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|2756696_2758100_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|2758096_2758387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|2758754_2759168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|2759856_2761644_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|2761810_2762431_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|2762777_2762918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|2762937_2764914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|2765286_2766744_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|2766812_2768393_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|2769033_2772930_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|2772936_2773260_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|2773333_2773807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|2773838_2774834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420625.1|2775136_2776723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|2777082_2778030_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|2778348_2778693_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|2778786_2779458_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|2779498_2780326_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|2780412_2780940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|2781825_2782245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|2782354_2782936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|2783290_2784571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|2784691_2785555_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|2785643_2786438_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|2786675_2787662_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|2787667_2789194_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|2789289_2790534_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|2790587_2791967_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|2792084_2792870_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|2793212_2793857_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|2793891_2795697_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|2795720_2796296_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|2797345_2798320_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155082198.1|2798609_2798792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093666.1|2800855_2801533_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|2803031_2803253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|2804133_2804295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|2804231_2804732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|2804827_2805256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|2805515_2805965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|2806017_2806452_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|2806428_2807394_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|2807612_2807873_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|2807967_2808702_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|2808730_2808883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|2809087_2810032_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377293.1|2810017_2810446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|2810590_2810842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243030.1|2811229_2812138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|2812601_2813567_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|2813611_2814187_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|2814217_2815492_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|2816140_2816857_+	aldolase	NA	NA	NA	NA	NA
WP_017377300.1|2816935_2817673_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|2817793_2819149_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|2819328_2820000_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377303.1|2820115_2820991_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_017377304.1|2821591_2822896_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|2823008_2823614_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377305.1|2823695_2824997_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|2825064_2827497_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|2827600_2827873_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|2827955_2829854_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|2829885_2830770_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|2830778_2831174_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|2831597_2833745_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|2833716_2835066_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|2835062_2837183_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|2837179_2838883_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|2839017_2840160_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|2840216_2841245_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|2841371_2842886_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|2842992_2843193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|2843337_2843673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|2843817_2844054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|2844324_2845203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|2845839_2846784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|2847057_2848461_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|2848465_2849251_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|2849641_2850484_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
2849774:2849833	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|2850480_2850777_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|2852258_2852870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|2852938_2853745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|2854048_2855023_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|2855194_2857087_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|2857659_2859975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2860389_2861793_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|2862233_2862713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|2862780_2864037_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|2864183_2864708_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|2865112_2865253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|2865450_2866155_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376902.1|2867009_2867321_-	hypothetical protein	NA	NA	NA	NA	NA
2865931:2866427	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
WP_017376903.1|2867384_2867564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243159.1|2868126_2868309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376905.1|2868372_2868600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063576.1|2868807_2869572_+	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	33.0	6.3e-29
WP_026063577.1|2869798_2870092_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	52.8	4.7e-17
WP_048875878.1|2870617_2872021_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 62
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	2876692	3019326	3192742	protease,transposase,tRNA	Staphylococcus_phage(17.86%)	119	NA	NA
WP_036774028.1|2876692_2878426_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|2878497_2880204_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|2880195_2881254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|2881507_2882356_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|2882950_2883397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420773.1|2884086_2885499_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|2885890_2887333_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|2887464_2887533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420634.1|2887731_2889063_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2889167_2890142_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_075275283.1|2890284_2890896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|2891336_2892149_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|2892207_2894718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|2895063_2896239_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|2897586_2897811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|2897839_2899003_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|2901245_2902391_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|2902983_2903919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|2905416_2905728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2905724_2906807_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|2907122_2907329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|2907426_2907957_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|2908244_2909423_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|2909571_2913336_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|2913394_2914897_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|2915448_2916084_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|2916581_2917829_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|2918051_2919488_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|2919663_2920881_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|2921342_2922122_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2923128_2924103_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|2925148_2925460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|2925456_2926539_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|2926849_2927056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|2928776_2930138_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|2930248_2930620_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|2930842_2931493_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|2931535_2932618_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|2933344_2934319_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|2935189_2935417_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|2937597_2939151_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|2939939_2940176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|2940295_2941339_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2941585_2941987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|2942160_2943060_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|2943454_2944666_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|2944676_2944901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376857.1|2945222_2945453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|2945479_2946883_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|2947049_2947358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|2947642_2947813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|2948441_2949491_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|2949559_2950582_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|2950627_2951542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|2952510_2952738_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|2952694_2953564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|2955001_2955718_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|2956161_2958033_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|2958124_2959870_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|2959949_2960399_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|2960451_2960667_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|2960913_2961930_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|2961978_2962608_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|2962948_2964160_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|2964192_2964543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|2964508_2965189_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|2965465_2965885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875951.1|2966030_2966867_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2966910_2967885_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|2967904_2968540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|2968783_2969785_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|2969883_2971092_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|2971081_2972812_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|2972995_2974132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|2974876_2975512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|2975626_2976961_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|2977089_2977731_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|2978036_2978459_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|2978736_2979699_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|2979737_2980913_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|2981001_2982702_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|2982701_2984240_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|2984279_2985932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|2986005_2986761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|2986946_2987822_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|2988086_2988281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|2988425_2988899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|2989168_2989342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|2989546_2990860_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|2990856_2991501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764737.1|2992019_2992517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316669.1|2992758_2993205_-	MFS transporter	NA	NA	NA	NA	NA
WP_036772012.1|2993337_2994027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|2994100_2995450_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|2995553_2997734_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|2997803_2998679_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|2998725_2999022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|2999145_2999553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|2999532_3000111_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|3000533_3001196_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|3001226_3001595_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|3001605_3002922_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|3003168_3003780_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|3003855_3004035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|3004205_3004499_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|3004739_3005042_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|3005096_3007370_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|3007429_3007675_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|3007799_3008555_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155764738.1|3008663_3009617_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.5	2.1e-29
WP_036771709.1|3009844_3010606_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|3010589_3011546_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376077.1|3011808_3014307_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|3014310_3015051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|3015500_3016295_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|3016457_3017246_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|3017242_3018454_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|3018446_3018803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|3018897_3019326_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
>prophage 63
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	3022815	3081575	3192742	transposase,tRNA	unidentified_phage(18.18%)	55	NA	NA
WP_017376088.1|3022815_3024093_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|3024104_3024836_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144420645.1|3024807_3026064_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|3026173_3027577_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|3027729_3027900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|3029305_3030136_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|3030363_3030513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|3030707_3031529_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|3031525_3032419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|3032464_3032986_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|3033063_3033549_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|3033682_3034339_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|3034335_3034644_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|3034992_3035964_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875958.1|3037047_3037911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|3037937_3038357_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|3038409_3039366_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|3039848_3042521_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|3042601_3043228_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|3043384_3044983_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|3045072_3046494_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|3046524_3047046_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|3047042_3047648_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|3047724_3048735_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|3048847_3049552_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|3049586_3050018_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|3050020_3051115_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|3051174_3052527_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|3052562_3053204_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|3053276_3054176_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|3054178_3054826_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|3054876_3055680_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|3055861_3056077_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|3056080_3056314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|3056375_3057968_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|3058170_3059100_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|3059101_3059869_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|3060234_3061005_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_048875960.1|3061063_3062038_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|3062145_3062508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|3062677_3064387_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|3064627_3066031_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|3066082_3066340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|3067088_3068396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|3068855_3069233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|3069377_3069779_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|3070343_3071123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|3071190_3071331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|3071531_3071729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|3071866_3072466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|3072648_3074121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|3074523_3076269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|3076704_3077565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|3078082_3080026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|3080171_3081575_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 64
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	3087818	3131935	3192742	protease,transposase	Burkholderia_virus(28.57%)	36	NA	NA
WP_036773465.1|3087818_3089858_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|3089873_3090929_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|3090939_3091470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875965.1|3093627_3094548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|3094692_3094833_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|3095721_3096105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|3096114_3096474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|3097408_3097555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|3097793_3099050_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|3099305_3099485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|3099804_3100458_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|3100662_3100989_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|3101760_3103164_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|3103334_3104705_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|3104751_3105651_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|3105631_3108436_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|3108515_3109112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|3109525_3110281_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|3110370_3110598_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|3111714_3112356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|3112625_3113951_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|3113947_3116005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|3115982_3116555_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|3116637_3116970_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|3117034_3118069_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|3118056_3119178_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|3119271_3120255_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|3120411_3122079_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|3122365_3123217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|3123625_3126094_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|3126107_3127082_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|3127068_3128337_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|3128370_3130119_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|3130298_3130502_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|3130720_3131398_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|3131677_3131935_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
>prophage 65
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	3155660	3160683	3192742		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_017377423.1|3155660_3157343_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	32.0	2.1e-24
WP_026063633.1|3157494_3157770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963565.1|3157914_3158412_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377424.1|3158805_3159789_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	38.4	6.2e-53
WP_017377425.1|3159781_3160003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377426.1|3160041_3160683_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	29.5	3.3e-07
>prophage 66
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	3173075	3174050	3192742	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036771332.1|3173075_3174050_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
>prophage 67
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	3178184	3179159	3192742	transposase	Staphylococcus_phage(100.0%)	1	NA	NA
WP_036773116.1|3178184_3179159_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 68
NZ_CP013781	Piscirickettsia salmonis strain PM49811B, complete genome	3192742	3187025	3188498	3192742		Mycoplasma_phage(100.0%)	1	NA	NA
WP_017376401.1|3187025_3188498_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
>prophage 1
NZ_CP013782	Piscirickettsia salmonis strain PM49811B plasmid p1PS6, complete sequence	181226	1105	54773	181226	portal,transposase,terminase	Salmonella_phage(30.43%)	57	NA	NA
WP_036774350.1|1105_1834_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_075316672.1|2316_3051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876196.1|5151_6300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|6329_7307_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|7222_7612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075317322.1|8407_9922_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|9908_10886_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|11043_11256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|12256_13234_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_047927782.1|13149_13539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075317322.1|14334_15849_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|15835_16813_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_053093683.1|16970_17183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|18183_19161_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_027243212.1|19655_19943_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_027243211.1|19932_20187_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_155046636.1|20404_20566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|20580_21558_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771347.1|22038_23016_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_144420849.1|23481_24462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|24693_25203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242596.1|25242_25605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275482.1|25918_26893_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_017377509.1|26986_27715_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_027243190.1|27895_31240_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_144420848.1|31243_31429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876202.1|32807_33521_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_036771649.1|33567_34302_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_087910668.1|34339_34726_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_047927581.1|34812_35247_-	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_048876205.1|35451_36783_-|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_075278733.1|36785_37268_-|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_027242929.1|37354_37738_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_017375952.1|37933_38137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242930.1|38326_39709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242931.1|39854_40262_-	DUF4411 family protein	NA	NA	NA	NA	NA
WP_027242932.1|40270_40498_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_026063496.1|40630_40996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081078123.1|41874_42237_-	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
WP_146619517.1|42266_42419_+	phosphatase	NA	NA	NA	NA	NA
WP_017375959.1|42556_42790_-	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_017375960.1|43091_44135_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_036817201.1|44242_44650_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_036817204.1|44953_45949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375964.1|46219_46645_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_155048090.1|46595_47114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375966.1|47258_47825_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_048876207.1|47825_49301_+	response regulator	NA	NA	NA	NA	NA
WP_144420845.1|49806_50037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242936.1|50164_50617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242937.1|50613_50832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375841.1|51138_51348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375972.1|51792_52101_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_027242938.1|52102_52471_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_048876229.1|52884_53856_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_155046634.1|53774_53975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771279.1|54044_54773_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
>prophage 2
NZ_CP013782	Piscirickettsia salmonis strain PM49811B plasmid p1PS6, complete sequence	181226	60428	120555	181226	transposase	Streptococcus_phage(52.17%)	59	NA	NA
WP_048876208.1|60428_61256_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_048876229.1|62120_63092_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_017375910.1|63660_64389_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036772441.1|64464_64737_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_032126795.1|64740_65001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046631.1|67632_68283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|68357_69335_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|69462_70191_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|70373_71660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|71680_71845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082884401.1|72261_72384_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|72481_73210_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772437.1|73631_75530_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|75825_76092_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|76637_77366_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|77406_77577_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|77652_78630_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929558.1|78711_79395_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_155046629.1|79422_79575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|79976_81716_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_082304501.1|81718_82081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377658.1|83030_83717_-	Fic family protein	NA	NA	NA	NA	NA
WP_080963659.1|84062_84683_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036772434.1|84661_85390_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_017377656.1|85477_85864_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017377655.1|85860_86106_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075275474.1|86447_87560_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017375840.1|88528_88747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|88791_89196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|89209_89548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|89540_89765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|90136_90745_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|90747_91476_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_051929563.1|91498_91888_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	40.0	1.1e-10
WP_036772541.1|91917_92646_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_048876211.1|92657_93362_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_144420840.1|93744_94176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876212.1|94206_95085_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243191.1|95038_95746_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_075275473.1|95862_96039_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_048876213.1|97277_98168_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243190.1|98476_101821_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017375910.1|102403_103132_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017377521.1|104059_104413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876214.1|104921_105650_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.1e-38
WP_155046640.1|105618_105786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275471.1|106421_107396_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.3e-26
WP_155764741.1|107936_108770_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377526.1|109313_110174_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243210.1|110503_111238_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.9e-36
WP_047927763.1|111651_111915_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|111911_112310_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|112553_113009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|114909_115167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|115311_115482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|116151_117078_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|117273_118002_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_017375558.1|119150_119714_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|119826_120555_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 3
NZ_CP013782	Piscirickettsia salmonis strain PM49811B plasmid p1PS6, complete sequence	181226	150534	160949	181226	transposase	Streptococcus_phage(62.5%)	10	NA	NA
WP_036772541.1|150534_151263_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|151414_152098_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|152102_152672_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|152842_153571_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|154054_154783_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|154835_155231_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|155524_156253_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|156410_159752_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_027243201.1|159815_160055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|160220_160949_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 4
NZ_CP013782	Piscirickettsia salmonis strain PM49811B plasmid p1PS6, complete sequence	181226	174599	181097	181226	portal,transposase	Burkholderia_virus(16.67%)	8	NA	NA
WP_082300723.1|174599_174827_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|175559_176051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|176132_176861_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|177204_177351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|177656_179522_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|179594_179861_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|180041_180383_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|180563_181097_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
>prophage 1
NZ_CP013783	Piscirickettsia salmonis strain PM49811B plasmid p2PS6, complete sequence	50681	0	2996	50681	tail,capsid,transposase,head	Shigella_phage(33.33%)	4	NA	NA
WP_017375778.1|138_450_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|834_1419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|1432_1972_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|2021_2996_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
>prophage 2
NZ_CP013783	Piscirickettsia salmonis strain PM49811B plasmid p2PS6, complete sequence	50681	6446	10086	50681	transposase	unidentified_phage(50.0%)	5	NA	NA
WP_036771330.1|6446_7421_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036773107.1|7708_8026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375691.1|8009_8711_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_017375692.1|8734_8968_-	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_036773116.1|9111_10086_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
>prophage 3
NZ_CP013783	Piscirickettsia salmonis strain PM49811B plasmid p2PS6, complete sequence	50681	19121	23078	50681	transposase	Brucella_phage(33.33%)	5	NA	NA
WP_017377663.1|19121_19451_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	44.9	6.1e-13
WP_017377662.1|19461_19776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275453.1|19863_20838_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.4	2.9e-26
WP_048876255.1|21080_22082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|22100_23078_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
>prophage 4
NZ_CP013783	Piscirickettsia salmonis strain PM49811B plasmid p2PS6, complete sequence	50681	26548	46003	50681	tail,transposase	unidentified_phage(30.0%)	17	NA	NA
WP_048876253.1|26548_27205_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.3e-10
WP_036771639.1|27201_28176_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_032126138.1|28617_28881_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_036771639.1|29308_30283_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_087910671.1|30670_31135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910670.1|31228_31414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|32369_33344_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_036816420.1|33747_34380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929651.1|34383_35436_-	ParA family protein	NA	NA	NA	NA	NA
WP_036771347.1|35597_36575_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375933.1|36974_37967_+	ParA family protein	NA	A0A1X9I765	Streptococcus_phage	28.9	5.0e-10
WP_036771355.1|37983_39420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|39891_40869_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|40896_41325_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|41383_44074_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_144420832.1|44616_45402_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|45331_46003_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
>prophage 1
NZ_CP013784	Piscirickettsia salmonis strain PM49811B plasmid p3PS6, complete sequence	57419	0	9021	57419	transposase	Shewanella_sp._phage(25.0%)	10	NA	NA
WP_155764742.1|126_282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098082828.1|1270_1528_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_052047040.1|1595_2534_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_155046643.1|2581_2734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046642.1|2966_3458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242576.1|3485_5348_-	AAA family ATPase	NA	A0A088C4M0	Shewanella_sp._phage	30.9	1.0e-56
WP_144420830.1|5453_5759_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_027242583.1|6115_6427_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.7	2.3e-14
WP_027242582.1|6423_6825_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_027242581.1|6834_9021_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.3	1.1e-73
>prophage 2
NZ_CP013784	Piscirickettsia salmonis strain PM49811B plasmid p3PS6, complete sequence	57419	41851	47779	57419		Choristoneura_rosaceana_entomopoxvirus(25.0%)	6	NA	NA
WP_053063426.1|41851_42637_+	class I SAM-dependent methyltransferase	NA	R4ZE30	Choristoneura_rosaceana_entomopoxvirus	27.9	2.1e-19
WP_047927059.1|42612_43314_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036775038.1|43299_44040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242605.1|44334_45630_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.8e-12
WP_036774869.1|46073_46922_-	ParB/RepB/Spo0J family partition protein	NA	Q331U1	Clostridium_botulinum_C_phage	25.7	7.1e-05
WP_047927060.1|46918_47779_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.3	9.3e-13
>prophage 3
NZ_CP013784	Piscirickettsia salmonis strain PM49811B plasmid p3PS6, complete sequence	57419	53484	54075	57419	integrase	Caulobacter_virus(100.0%)	1	51765:51795	56087:56117
51765:51795	attL	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_027242600.1|53484_54075_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
WP_027242600.1|53484_54075_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
56087:56117	attR	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
>prophage 1
NZ_CP013785	Piscirickettsia salmonis strain PM49811B plasmid p4PS6, complete sequence	33546	0	16237	33546	capsid,integrase,transposase	unidentified_phage(27.27%)	21	1:60	22823:23579
1:60	attL	GTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTAT	NA	NA	NA	NA
WP_075316673.1|1097_1577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155764743.1|1610_2006_-|capsid	phage major capsid protein	capsid	M1Q1R5	Streptococcus_phage	50.0	1.5e-05
WP_155764744.1|1932_2046_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_027242948.1|3197_3383_-	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_155764745.1|3414_3615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316674.1|3627_3864_-	hypothetical protein	NA	Q6DMU4	Streptococcus_phage	44.3	1.5e-05
WP_027242950.1|3950_4334_-	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_036774306.1|4546_5011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075316675.1|5010_5412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|6037_7012_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_080963620.1|7109_7466_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_027242953.1|7449_7704_-	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_027242954.1|7848_8214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971681.1|8746_9721_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_016211078.1|9897_10251_-	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_027242955.1|10243_10504_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016212329.1|10734_11325_+|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_075278739.1|11390_11747_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|11860_12835_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016211499.1|14260_15244_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027242956.1|15259_16237_-	AAA family ATPase	NA	Q7M293	Enterobacteria_phage	32.7	7.8e-16
22823:23579	attR	GTTGATTCATCAGCGGTTAAGCACTCATACATCCCCCGATGTTATCAGTCAAGAACTTATACGTGAGCATAATATTCAGGTGAGTGAGAGCACGATTTACCGTTATATTTATGATGATAGAGAGCGGGGCGGAGAGCTTTACAAAAACCTGCCTCATTCAGGAAAACCTTATAAGAAGAAGGTGAGTCGTGGTGATCAAACAAAAATACCTAATCGCGTTGGTATTGAACAACGGCCTGCTATTGCTGATGAAAAGACAGAGTTTGGTCATTTTGAAATTGATACGGTTGTGGGTCGTGACCACCAATCTTATTTATTAACACTGGTCGATAAGGCGAATAAAATGTGTTGTATAAGGAAAATGCCTAACAAACAAGCCAAGACTGTTATCAATACATTCATGAATGTGGTTGGCTCAACTTTCTTTGATTTTAAAACCATCACTTCTGACAACGGAACAGAGTTTGCCGGTCATGAGGCCATTTCAAAGATCACTGAAGCAGACTTTTACTTTGCTAGACCTTATCGTTCTTGTGATAGAGGTCTAAATGAACACACAAATGGTTTGATAAGGCGTTTTCTACCTAAAGGGACGGATTTTAATGAAGTTAGTGACAAAGAAATAGCAAAAATAGAGCATACATTGAACACCAGAAGAAGAGCGAGTTTGAATTATCGCTCACCTAATCATGTTTTTTTAGAGTATTTGATGGCGGCTTAGTATAGAGTAGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP013785	Piscirickettsia salmonis strain PM49811B plasmid p4PS6, complete sequence	33546	20495	31339	33546	transposase,tail	unidentified_phage(50.0%)	12	NA	NA
WP_036771332.1|20495_21470_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	2.2e-26
WP_144420852.1|22037_22178_-	phosphatase	NA	NA	NA	NA	NA
WP_036771330.1|22568_23543_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_155046645.1|23562_23724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242941.1|23723_24377_-	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_048876242.1|24388_24766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|25250_26225_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027242942.1|26244_26922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365785.1|26921_27977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876241.1|28121_30098_-	host specificity protein J	NA	C7BGD4	Burkholderia_phage	37.8	3.7e-89
WP_027242943.1|30368_30785_-	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
WP_027242944.1|30781_31339_-|tail	tail assembly protein	tail	K7PGY0	Enterobacteria_phage	36.2	7.9e-21
