The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	5110	54217	3187881	tRNA,transposase	Staphylococcus_phage(21.43%)	50	NA	NA
WP_017377815.1|5110_6649_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|6969_7305_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|8117_8411_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|8781_9756_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017377817.1|10267_10765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|11000_11645_+	porin family protein	NA	NA	NA	NA	NA
WP_053856754.1|11749_12001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|12145_13141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|13218_13647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|13996_14194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|14436_15069_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|15489_16440_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_017377820.1|16436_17969_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|17965_18496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|19583_19811_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|20067_21042_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|21465_22869_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242584.1|22902_23868_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|23821_24517_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|25021_25528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|25621_26179_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|26476_27826_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|27912_28170_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|28237_28948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|29092_29272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|29795_31055_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|31187_31661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|31669_33052_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|33044_33659_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|33738_34455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|34629_36954_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|37120_38095_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420616.1|39258_40767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|40938_42030_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|42062_42701_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|42739_43012_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|43110_43353_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|43370_43673_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|43756_44299_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|44459_45086_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|45091_45931_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|45920_46571_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|46574_47408_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|47497_48625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|48891_49044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|49151_49346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|49538_50189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|50443_51535_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|51531_52896_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|53020_54217_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
>prophage 2
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	64103	113172	3187881	tRNA,transposase	Bacillus_phage(35.71%)	53	NA	NA
WP_017377700.1|64103_64397_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|64513_64663_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|65991_66966_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|67064_67220_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|67138_67399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|67575_68103_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|68357_68582_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|68726_69548_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|69505_69799_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|71275_71563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|72055_72826_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_080963670.1|72895_74308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|74674_76045_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|76041_76206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|76265_76553_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|77584_78175_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|78301_79687_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|79784_79982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|80074_80908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|81445_81799_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|81811_82048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|82047_82254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|82415_83135_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|83223_85008_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|85314_85470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|85396_85651_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|85796_86618_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|86800_87025_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|87130_88534_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|89098_89287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|89416_89683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|90068_91709_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|91821_93171_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|93167_94037_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|94961_96275_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|96271_97042_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|97038_97266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|97970_99131_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|99099_99696_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|100664_100892_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|101859_102264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048063.1|102267_103263_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|103248_104451_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|104377_104992_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|105688_105850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|106129_106675_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|106708_107374_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|107433_108390_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|108668_109346_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|109388_109970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|110114_110786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|111388_111976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|112944_113172_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 3
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	124854	156531	3187881	tRNA,transposase	Staphylococcus_phage(50.0%)	29	NA	NA
WP_017377787.1|124854_125082_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377716.1|125216_126680_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377715.1|126682_127735_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377714.1|127724_128180_+	arginine repressor	NA	NA	NA	NA	NA
WP_017377713.1|128204_128762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377712.1|128874_129186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927332.1|129315_130098_+	lipoprotein	NA	NA	NA	NA	NA
WP_144420768.1|130110_131046_-	EamA family transporter	NA	NA	NA	NA	NA
WP_017377709.1|131177_131381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242901.1|131721_132411_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|132437_132755_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|132772_132985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|133938_134166_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|135323_136085_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|138275_139250_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|139374_140811_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|140890_142351_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|142471_142759_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|142956_144000_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|144015_144915_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|144911_145430_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|145499_146117_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|146126_147614_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|147623_151304_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|151377_152187_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|152186_152867_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|153491_154466_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|154508_155504_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|155556_156531_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 4
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	191982	333487	3187881	protease,tRNA,integrase,transposase	Staphylococcus_phage(15.38%)	113	317106:317165	333263:333759
WP_017376198.1|191982_193443_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|193478_195008_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|195041_196445_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|198356_200171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|200255_201659_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|201804_203208_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|203692_204667_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|205135_206026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|206686_207523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|207811_210484_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|210732_211923_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|212255_212450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|212386_214039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|214639_215866_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|216261_216807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|216766_217144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|217140_218544_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|218762_219188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|219239_220727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|221036_221576_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|221865_222093_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|223338_223914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|224027_225431_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377226.1|225427_225718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377227.1|226085_226499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106211.1|227187_228975_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017377229.1|229141_229762_+	DUF2272 domain-containing protein	NA	NA	NA	NA	NA
WP_155046612.1|230108_230249_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377230.1|230268_232245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377231.1|232617_234075_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	42.1	9.4e-98
WP_017377232.1|234143_235724_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	27.3	1.1e-16
WP_017377234.1|236364_240261_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	54.4	3.4e-118
WP_016210741.1|240267_240591_-	late competence development ComFB family protein	NA	NA	NA	NA	NA
WP_017377235.1|240664_241138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772195.1|241169_242165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243012.1|242416_244054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910659.1|244413_245361_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	35.2	4.3e-35
WP_017377238.1|245679_246024_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_144420626.1|246117_246789_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_017377240.1|246829_247657_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_036772199.1|247743_248271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243013.1|249156_249576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052106212.1|249685_250267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377245.1|250621_251902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377246.1|252022_252886_-	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_017377247.1|252974_253769_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036772212.1|254006_254993_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_027243014.1|254998_256525_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_144420771.1|256620_257865_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017377251.1|257918_259298_+	leucyl aminopeptidase family protein	NA	Q6GYZ8	Mycoplasma_phage	35.8	2.4e-34
WP_026063614.1|259415_260201_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	33.3	3.7e-32
WP_016211687.1|260543_261188_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_017377253.1|261222_263028_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_016211684.1|263051_263627_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036771330.1|264676_265651_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_053093666.1|268187_268865_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|270363_270585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|271465_271627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|271563_272064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|272159_272588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|272847_273297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|273349_273784_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|273760_274726_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|274944_275205_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|275299_276034_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|276062_276215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|276419_277364_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377293.1|277349_277778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|277922_278174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243030.1|278561_279470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|279933_280899_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|280943_281519_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|281549_282824_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|283472_284189_+	aldolase	NA	NA	NA	NA	NA
WP_017377300.1|284267_285005_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|285125_286481_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|286660_287332_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377303.1|287447_288323_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_017377304.1|288923_290228_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|290340_290946_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377305.1|291027_292329_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|292396_294829_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|294932_295205_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|295287_297186_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|297217_298102_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|298110_298506_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|298929_301077_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|301048_302398_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|302394_304515_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|304511_306215_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|306349_307492_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|307548_308577_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|308703_310218_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|310324_310525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|310669_311005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155062824.1|311149_311365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|311656_312535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|313171_314116_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|314389_315793_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|315797_316583_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|316973_317816_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
317106:317165	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|317812_318109_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|319590_320202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|320270_321077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|321380_322355_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|322526_324419_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|324991_327307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|327721_329125_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|329565_330045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|330112_331369_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|331515_332040_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|332444_332585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|332782_333487_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
333263:333759	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
>prophage 5
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	337949	477957	3187881	protease,tRNA,transposase	Staphylococcus_phage(20.0%)	116	NA	NA
WP_048875878.1|337949_339353_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|339822_340800_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|340896_342357_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|342383_343037_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|343161_343728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|344024_345758_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|345829_347536_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|347527_348586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|348839_349688_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|350282_350729_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420773.1|351418_352831_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|353222_354665_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|354796_354865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420634.1|355063_356395_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|356499_357474_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|357523_358228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|358668_359481_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|359539_362050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|362395_363571_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_048875940.1|365171_366335_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|368577_369723_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|370315_371251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|372748_373060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|373056_374139_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|374454_374661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|374758_375289_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|375576_376755_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|376903_380668_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|380726_382229_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|382780_383416_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|383927_385175_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|385397_386834_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|387009_388227_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|388688_389468_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|390186_391161_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|392206_392518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|392514_393597_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|393907_394114_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|395834_397196_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|397306_397678_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|397900_398551_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|398593_399676_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|400402_401377_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|402247_402475_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|404655_406209_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|406997_407234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|407353_408397_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|408643_409045_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|409218_410118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|410512_411724_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|411734_411959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046608.1|412280_412445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|412537_413941_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|414107_414416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046607.1|414700_414883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155051404.1|414923_415094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|415499_416549_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|416617_417640_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|417685_418600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|419568_419796_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|419752_420622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|422059_422776_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|423220_425092_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|425183_426929_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|427008_427458_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|427510_427726_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|427972_428989_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|429037_429667_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|430007_431219_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|431251_431602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|431567_432248_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|432524_432944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619425.1|433089_433776_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155048060.1|433920_434178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|434257_435232_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|435251_435887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|436130_437132_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|437230_438439_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|438428_440159_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|440342_441479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|442223_442859_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|442973_444308_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|444436_445078_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|445383_445806_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|446083_447046_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|447084_448260_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|448348_450049_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|450048_451587_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|451626_453279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|453352_454108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|454294_455170_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|455434_455629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|455773_456247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|456516_456690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|456894_458208_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|458204_458849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|459367_460555_-	MFS transporter	NA	NA	NA	NA	NA
WP_027242844.1|460735_461377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|461450_462800_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|462903_465084_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|465153_466029_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|466075_466372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|466495_466903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|466882_467461_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|467883_468546_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|468576_468945_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|468955_470272_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|470518_471130_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|471205_471385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|471555_471849_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|472089_472392_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|472446_474720_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|474779_475025_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|475149_475905_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|476013_476988_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|477195_477957_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	483808	537420	3187881	tRNA,transposase	unidentified_phage(16.67%)	56	NA	NA
WP_017376080.1|483808_484597_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|484593_485805_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|485797_486154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|486248_486677_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|486828_487938_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|487934_488663_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|488720_489608_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|489692_490067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|490166_491444_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|491455_492187_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144420645.1|492158_493415_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|493524_494928_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|495080_495251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|496656_497487_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|497714_497864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|498058_498880_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|498876_499770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|499815_500337_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|500414_500900_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|501033_501690_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|501686_501995_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|502343_503315_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|503619_504411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|504400_505264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|505290_505710_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|505762_506719_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|507201_509874_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|509954_510581_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|510737_512336_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|512425_513847_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|513877_514399_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|514395_515001_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|515077_516088_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|516200_516905_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|516939_517371_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|517373_518468_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|518527_519880_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|519915_520557_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|520629_521529_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|521531_522179_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|522229_523033_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|523214_523430_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|523433_523667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|523728_525321_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|525523_526453_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|526454_527222_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|527587_528358_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_036771330.1|528416_529391_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|529498_529861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|530030_531740_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|531980_533384_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_146619530.1|533435_533693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048058.1|533998_534181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242834.1|534729_536037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773793.1|536496_536874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376708.1|537018_537420_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	547812	599576	3187881	protease,transposase	Burkholderia_virus(28.57%)	42	NA	NA
WP_048875961.1|547812_549216_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378006.1|549335_549965_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|550203_550923_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|551036_554576_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378003.1|554642_555473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773465.1|555459_557499_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|557514_558570_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|558580_559111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875965.1|561268_562189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|562333_562474_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|563362_563746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|563755_564115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|565049_565196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|565434_566691_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|566946_567126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|567445_568099_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|568303_568630_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|569401_570805_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|570975_572346_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|572392_573292_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|573272_576077_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|576156_576753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|577166_577922_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|578011_578239_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|579355_579997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|580266_581592_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|581588_583646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|583623_584196_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|584278_584611_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|584675_585710_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|585697_586819_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|586912_587896_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|588052_589720_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|590006_590858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|591266_593735_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|593748_594723_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|594709_595978_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|596011_597760_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|597939_598143_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|598361_599039_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_155062818.1|599176_599377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927086.1|599318_599576_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
>prophage 8
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	639764	673746	3187881	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	28	NA	NA
WP_051929562.1|639764_640469_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|640719_641694_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|642581_645308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|645831_646806_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|647003_648485_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|648944_649607_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|649848_651081_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|651237_654009_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|654077_654521_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|654673_656146_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|656257_657319_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|657315_658350_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|658352_659393_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|659577_660693_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|660731_661085_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|661105_662974_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|662995_663940_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|664173_664452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|664814_665453_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|665427_666852_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|667052_667730_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|667850_669125_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|669192_669948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|669999_670917_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_144420654.1|671341_672121_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|672173_672461_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|672520_672871_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081078111.1|672993_673746_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	683492	742191	3187881	transposase	Escherichia_phage(20.0%)	49	NA	NA
WP_017375910.1|683492_684221_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|684623_685352_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|685415_686243_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|686424_686793_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|686789_687608_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|687708_688524_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|688807_690868_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|690864_691290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|691475_692969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|693101_693917_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|694012_694429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|694811_695351_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|696267_696429_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|697140_698202_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|699692_700046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|700254_701967_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|702413_704267_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|704369_704702_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|704732_705329_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|705325_706450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|706561_707209_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|707260_709174_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|709378_710416_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|710474_713801_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|714507_715476_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|715605_716094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|716535_716769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|717078_717267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|717755_718241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|718511_718781_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|718815_720141_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|720196_720844_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|721037_722996_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|723139_726070_+	peptidase M16	NA	NA	NA	NA	NA
WP_048875980.1|726875_728279_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|729719_730505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|730595_732245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|732389_733235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|733348_734752_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927801.1|734748_735195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|735436_736096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|736114_736990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|737125_738115_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|738091_738853_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_144420659.1|738885_739665_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|739941_740577_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|740573_740738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|740936_741911_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378288.1|741969_742191_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	804326	844732	3187881	tRNA,transposase	Tupanvirus(22.22%)	38	NA	NA
WP_017378228.1|804326_805247_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|809410_809554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|810163_810982_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|811089_811551_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|811567_812491_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|812514_813564_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|813701_814295_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|814317_814788_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|814897_816148_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|816836_817301_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|817739_819212_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|819328_819781_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|819905_820061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|820205_820409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|820599_820998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|821183_821789_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|821797_822094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|822098_822635_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046598.1|822779_823349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|823428_824403_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|824399_824897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|825304_825721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|825788_827192_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|827188_827809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|828080_829055_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|829219_829843_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|829839_831780_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|831935_832589_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|832757_833933_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|834286_835612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|835704_836493_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|836594_837467_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|837653_838916_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|838989_839520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|839541_841047_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|841059_841725_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|841818_843579_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|843856_844732_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	850398	955825	3187881	protease,tRNA,transposase	Burkholderia_phage(13.04%)	95	NA	NA
WP_017376460.1|850398_852993_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|853299_853563_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|853935_854811_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046597.1|854925_855102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376465.1|855646_857209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772167.1|857750_858698_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376467.1|858917_860393_-	APC family permease	NA	NA	NA	NA	NA
WP_017376469.1|860912_861935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376470.1|862291_863659_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|863934_864189_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_048876132.1|864237_865491_+	GTPase HflX	NA	NA	NA	NA	NA
WP_027242811.1|865510_866725_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|866724_867618_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|867815_869114_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|869203_870481_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_036772166.1|870494_872894_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_017376476.1|872890_873649_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|873825_874215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|876337_876625_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_081078114.1|876990_877782_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017375672.1|878440_878932_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|878920_879649_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377465.1|879667_880525_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_027242813.1|880530_881784_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_027242814.1|881817_883686_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_052106215.1|883672_884911_-	MFS transporter	NA	NA	NA	NA	NA
WP_080963599.1|884895_886743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377461.1|886727_887933_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_017377460.1|887944_890134_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377459.1|890702_891332_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275307.1|891354_891774_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_036772544.1|891754_892171_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275308.1|892170_893013_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242817.1|893068_894049_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377453.1|894029_896027_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242818.1|896044_897220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|897501_898905_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|899053_899416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|899587_899806_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|900351_902379_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|902460_903711_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|904010_904346_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|904657_904906_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|904941_905451_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|905450_906230_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|906247_906595_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|906704_906980_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|907141_907498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|907896_908232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|908436_909213_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|909169_910042_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|910326_910614_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|910697_911417_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|911547_912156_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|912961_913936_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|914015_914393_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927093.1|914491_915595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|917255_917753_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|917897_918296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|918381_919287_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|919505_919826_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_047927608.1|919907_920630_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|921257_922091_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|922120_922975_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_144420667.1|923351_924362_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|924506_924764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|924877_926134_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|926389_926569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|927062_927305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|927330_928689_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|928970_929330_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|929761_931396_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|931402_932239_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|932260_933538_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377577.1|933624_933942_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377576.1|933964_935056_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377575.1|935246_936836_+	APC family permease	NA	NA	NA	NA	NA
WP_017377574.1|936896_937670_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|937840_938890_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_036816899.1|939618_939810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|940639_941416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420668.1|941616_941928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|942020_942986_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275315.1|944197_944452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420669.1|944858_945101_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875996.1|945113_945989_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036816928.1|946315_946756_-	universal stress protein	NA	NA	NA	NA	NA
WP_081000007.1|948339_948744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999986.1|948905_949103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|949306_950281_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017377185.1|950629_951568_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|951631_953626_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_026063604.1|953628_954225_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_017377182.1|954221_954560_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_036774017.1|954949_955825_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1014160	1029731	3187881	transposase	unidentified_phage(25.0%)	15	NA	NA
WP_048876002.1|1014160_1015144_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1015943_1017097_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1017218_1017911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1017919_1019107_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1019256_1019883_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1019928_1021158_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1021352_1021799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1021990_1023349_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|1024014_1024188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|1024317_1025235_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1025576_1026236_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1026316_1026820_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1026792_1027080_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1027372_1028494_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|1028756_1029731_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 13
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1044718	1150319	3187881	protease,tRNA,integrase,transposase	Staphylococcus_phage(24.0%)	100	1064901:1064960	1092366:1093360
WP_036771330.1|1044718_1045693_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|1045768_1046086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275321.1|1046089_1046458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|1047191_1048160_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1048369_1049782_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1049969_1050683_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1050703_1051117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1051217_1052291_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1052427_1053327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1053582_1053834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1053882_1054518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|1054642_1055500_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_048876031.1|1055687_1057091_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1057266_1057770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1057846_1059148_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1059316_1060417_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1060767_1061010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1061003_1061321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1062543_1062771_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|1063381_1063852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1064074_1064374_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1064370_1064616_-	hypothetical protein	NA	NA	NA	NA	NA
1064901:1064960	attL	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGAT	NA	NA	NA	NA
WP_144420679.1|1064908_1065865_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375591.1|1066149_1066353_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1066483_1067512_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1067875_1068121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1068483_1069458_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|1070929_1072636_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|1072681_1073533_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1073735_1076192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1076711_1077113_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1077699_1078674_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1078714_1080043_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1080306_1080876_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1080891_1081203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1081212_1082181_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1082313_1082667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1082670_1083735_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1083735_1085475_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1085481_1085904_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1085887_1086517_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1086752_1086851_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|1086883_1088755_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1088902_1089877_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_155046591.1|1089956_1090100_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1090273_1091617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1092373_1093330_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1093656_1094040_+	hypothetical protein	NA	NA	NA	NA	NA
1092366:1093360	attR	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTACCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGCGTGATGGTGCTTACGCTTAGTTGTCACTTTATAAGCTTTACGTTGCAGCACCTTTAAACCGAGTTTTTGCATTAGGCTTCTCGCCCGATAACGGCCTACTTGAAAGCCTTCTTCTTGAAGTTTATATGCCATCATTCGTGATCCTAAGCTGCCGCGACTTTCTTTAAAAAGCTCCTTACAGCGCCGATAAAGCTGAAGCTCTTCAATTGAAATCACTTTAGCAGGCCGCTTGTCCCAAGCATAAAAGGCAGAACGGCTTACCTTCATCACTTTACAGGTCAGATTAATAGGATATAACACTTTGTTCTTCCGAATAAAATTAAATTTTACTTCATTTCTTTCGCGAAGAAGGCACTCGCCTTTTTTAAAATTTCTTTCTCCATCTGCAGTTGCTTTACTTTCTTTCGCAGGGATTGAAGCTCAGCCTTTTCATCAGGAGTCAGA	NA	NA	NA	NA
WP_144420680.1|1094055_1094976_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|1095291_1096167_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1096168_1096333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1096623_1097499_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1097500_1097665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|1097844_1098030_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1098073_1099048_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_027242577.1|1099044_1100346_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_027242578.1|1100363_1100900_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017376784.1|1100936_1101122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376785.1|1101362_1102268_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420682.1|1103674_1103836_+	phosphatase	NA	NA	NA	NA	NA
WP_155046588.1|1104370_1104580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243099.1|1105695_1107009_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_027243098.1|1107244_1108390_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_027243097.1|1108455_1108641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243096.1|1108676_1109309_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|1109485_1110142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1110130_1112416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|1112689_1113049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|1113330_1113966_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|1115153_1115978_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|1116033_1117245_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|1118028_1118736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1118798_1118978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243093.1|1119039_1119357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|1119469_1120213_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|1120226_1121270_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|1121408_1123178_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1123402_1124536_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|1125385_1128205_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|1128579_1129305_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|1131899_1132460_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|1132664_1132997_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1133056_1133344_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|1133996_1135022_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1135149_1136124_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1136318_1137272_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_144420684.1|1137441_1137690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1137872_1138397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1138851_1139679_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|1139747_1139933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1140133_1140592_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1140732_1140960_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1141124_1142510_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1142805_1143120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1143228_1144854_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1145266_1146256_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1146577_1146763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1147152_1149108_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1149179_1149302_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1149344_1150319_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 14
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1170083	1233856	3187881	tRNA,transposase	Acinetobacter_phage(15.38%)	58	NA	NA
WP_048876011.1|1170083_1171133_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1171332_1171710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1172899_1173187_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1173246_1173543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1173687_1174344_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1174583_1174964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1175615_1177019_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1177015_1177297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1177691_1178156_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1178336_1178930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1179115_1180090_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1180493_1181318_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1181392_1182541_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1182556_1184185_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|1184528_1185722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1191836_1192337_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1192750_1192891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|1193013_1194474_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|1194551_1195034_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1195192_1196458_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1196542_1197802_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1197873_1198146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1198483_1198819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1199179_1199428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1199698_1200109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1200253_1200790_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1200800_1200986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1201421_1202393_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1202374_1203346_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1203459_1204233_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|1204503_1204833_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|1205088_1205607_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1205659_1205887_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|1206868_1207744_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1207935_1208313_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1208872_1209922_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1210235_1211621_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1211627_1213166_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1213208_1213934_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1214104_1215337_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1215536_1216358_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|1216407_1217217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|1217372_1221239_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|1221404_1222280_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|1222344_1222623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1222767_1223343_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1223391_1223550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1224298_1225015_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1226143_1226560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1227474_1228404_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|1228375_1228534_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|1228682_1228997_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|1229906_1230890_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|1231040_1231388_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|1231387_1231987_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|1232361_1232700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420692.1|1232518_1232908_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|1232911_1233856_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1252823	1386193	3187881	transposase	Staphylococcus_phage(28.57%)	113	NA	NA
WP_036772026.1|1252823_1253699_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1253736_1254651_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1254715_1255345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1255389_1255824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1255804_1256545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1256558_1257956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1257958_1260907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1260906_1262628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1262642_1263047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1263047_1265927_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1265929_1266652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971655.1|1267013_1268906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1268937_1271478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|1271509_1272673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|1272678_1273302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|1273316_1274816_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|1274832_1275339_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|1276594_1276666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|1276848_1277031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1278232_1278505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1278520_1279954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1280098_1281364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1281649_1283401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|1283413_1284577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420697.1|1284580_1284877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1284916_1285144_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|1287012_1287987_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1288045_1288309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1288318_1289632_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1289836_1290010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1290077_1290221_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1290239_1290437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1290454_1290961_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1291883_1292759_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242571.1|1292824_1293073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378158.1|1293238_1296319_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017378159.1|1296336_1297389_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378160.1|1297912_1298563_+	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1298896_1299541_+	porin family protein	NA	NA	NA	NA	NA
WP_017378162.1|1299879_1300419_+	porin family protein	NA	NA	NA	NA	NA
WP_144420698.1|1300933_1301095_+	phosphatase	NA	NA	NA	NA	NA
WP_075275334.1|1301243_1301537_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_155046686.1|1302311_1302458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377969.1|1302551_1302791_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_144420699.1|1303126_1303456_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_026063694.1|1303545_1304130_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_017377966.1|1304265_1304952_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_027242960.1|1305075_1306260_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377963.1|1306475_1307918_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242961.1|1308057_1309008_+	DMT family transporter	NA	NA	NA	NA	NA
WP_048876021.1|1309106_1309880_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_017377960.1|1309883_1310633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1310705_1312175_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_027242964.1|1312489_1313062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773041.1|1313170_1314670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242965.1|1314991_1317424_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017377953.1|1317992_1319189_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_017377952.1|1319236_1321603_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_144420700.1|1322227_1322377_+	phosphatase	NA	NA	NA	NA	NA
WP_048876022.1|1322514_1323366_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|1323778_1324932_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1325022_1326126_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1326465_1326966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1327662_1328016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1328316_1330044_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1330147_1330873_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1330865_1332104_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1332241_1333279_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|1333333_1334236_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|1334345_1335599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1335656_1339148_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1339264_1339942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1340069_1340618_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_048875857.1|1340842_1341817_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017375873.1|1342488_1342650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1343841_1344408_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1344410_1345535_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1345619_1346438_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1346568_1348548_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|1348607_1349261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1349945_1351316_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1353031_1353679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|1353716_1354109_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1354361_1355108_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1355706_1356612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1356727_1357702_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1357847_1358576_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|1358695_1359277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|1359299_1362140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1364182_1365133_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|1365215_1365998_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_065653744.1|1366096_1366372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1366912_1367557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1367590_1368235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1368283_1369138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1369275_1369788_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1369855_1370050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1370263_1370617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1371825_1372800_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1373547_1374249_-	cyclase family protein	NA	NA	NA	NA	NA
WP_087910647.1|1374323_1374983_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|1375120_1376377_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|1376651_1377314_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1377303_1378536_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1378667_1379285_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1379362_1379869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1379879_1380107_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_146619475.1|1381389_1381641_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|1381885_1383004_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1383148_1383484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1383494_1383908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1385116_1385281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1385317_1386193_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1395621	1455921	3187881	tRNA,transposase	Staphylococcus_phage(25.0%)	59	NA	NA
WP_048876030.1|1395621_1396725_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1396794_1397670_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|1397666_1398011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|1398020_1398482_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1398495_1399887_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|1399928_1402916_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1402985_1403819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|1403873_1405061_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1405048_1405753_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1405798_1406584_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1406611_1407349_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1407453_1409649_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1409723_1410407_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1410417_1410849_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1410894_1411293_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1411669_1412377_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1412441_1412738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619421.1|1412776_1413256_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1413309_1413831_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1413912_1415007_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1415973_1417377_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1417546_1418110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1418245_1419721_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1419727_1419934_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1419991_1421062_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|1421259_1423230_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|1423590_1425150_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1425746_1426103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1426943_1427603_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1427698_1429060_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|1429201_1429429_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|1430480_1431821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1432471_1432633_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036815628.1|1432732_1433560_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|1433913_1434789_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|1434832_1435807_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1435826_1436015_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242753.1|1436659_1437202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242754.1|1437482_1437836_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242755.1|1437828_1438974_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242756.1|1439384_1440632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242757.1|1440769_1441153_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242758.1|1441149_1441881_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242759.1|1441883_1442627_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_144420798.1|1442640_1443540_-	GTPase Era	NA	NA	NA	NA	NA
WP_027242761.1|1443545_1444220_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_087910649.1|1444631_1445573_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|1445569_1447372_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_027242764.1|1447681_1448251_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242765.1|1448405_1449980_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_129556541.1|1449987_1450302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242767.1|1450426_1450672_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080963649.1|1450713_1451751_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242769.1|1451897_1452224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1452380_1452791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242771.1|1452933_1453251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062365727.1|1453517_1454210_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|1454206_1454350_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1455693_1455921_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 17
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1462822	1598939	3187881	transposase	Staphylococcus_phage(22.73%)	115	NA	NA
WP_048876036.1|1462822_1463461_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|1464174_1465362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|1465527_1466481_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|1466503_1468522_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|1468610_1468934_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|1469182_1469359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|1469586_1470306_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|1470921_1471305_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|1471949_1472423_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|1472528_1473899_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|1474014_1474746_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|1474770_1475868_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|1475903_1477322_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|1477531_1477984_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1477995_1478223_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|1478272_1478599_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|1478802_1479492_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|1479640_1480129_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_027242781.1|1480169_1481273_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|1481315_1482398_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|1482390_1482951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|1482941_1484246_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_027242784.1|1484299_1484848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|1484900_1485878_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929890.1|1485896_1486445_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|1486469_1487486_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929892.1|1487918_1491041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|1491437_1492061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|1492843_1494394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|1494688_1495444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1496152_1497127_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|1500035_1500707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1501785_1503189_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155764134.1|1504274_1504430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242788.1|1504776_1508178_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|1508174_1510868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|1511171_1512671_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|1513337_1514159_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_017378190.1|1514230_1514722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1514864_1516268_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|1516264_1517335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|1517580_1519755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1519777_1520458_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_036774233.1|1520486_1520720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1520772_1521000_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876044.1|1522078_1522579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420799.1|1523068_1523242_+	phosphatase	NA	NA	NA	NA	NA
WP_144420800.1|1523539_1524241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375730.1|1524392_1525640_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	72.2	1.4e-14
WP_017375729.1|1526018_1526630_-	PilZ domain-containing protein	NA	NA	NA	NA	NA
WP_017375728.1|1526715_1527582_-	OmpA family protein	NA	NA	NA	NA	NA
WP_016211119.1|1527585_1528347_-	flagellar motor protein PomA	NA	NA	NA	NA	NA
WP_017375727.1|1528510_1529416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963658.1|1529638_1530454_+	GTP cyclohydrolase I FolE2	NA	NA	NA	NA	NA
WP_017375724.1|1530639_1531029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375723.1|1531307_1531766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275340.1|1532036_1532645_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1533175_1534051_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|1534291_1534966_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1534994_1535483_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|1536528_1536963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1537168_1538251_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|1538247_1538559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927811.1|1538806_1540318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|1541278_1541572_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|1541529_1542108_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|1542193_1543069_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1543061_1543418_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|1543426_1543822_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|1545146_1545707_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|1546829_1548719_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|1548753_1549959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|1549961_1551260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|1551240_1552464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|1552513_1553314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155048038.1|1553310_1553673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243102.1|1553705_1554014_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1554407_1555136_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|1555176_1555821_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|1555833_1556301_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1556355_1557330_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|1557359_1557977_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1557955_1558417_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|1558460_1559396_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|1559423_1560419_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|1560632_1561595_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|1562734_1563463_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|1563513_1565148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1565418_1566606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|1567207_1567645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1570178_1570451_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|1570526_1570835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|1573310_1573628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1573784_1574759_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|1574755_1575145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|1575225_1575972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1575940_1576669_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|1577413_1577701_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|1577760_1577925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|1577921_1579325_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1579357_1580119_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|1580404_1581121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1581898_1582804_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|1583290_1584583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619460.1|1584818_1587602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420709.1|1589255_1589675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1589675_1590377_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|1590638_1590821_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|1591074_1591449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|1591558_1593550_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|1593539_1594586_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|1595026_1595878_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|1595878_1596796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|1597191_1597365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1597967_1598939_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1607034	1658823	3187881	protease,tRNA,transposase	Burkholderia_virus(22.22%)	48	NA	NA
WP_036771330.1|1607034_1608009_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|1608275_1608545_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|1608689_1609646_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|1609806_1610733_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|1611028_1611790_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|1611991_1612603_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|1612623_1613823_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|1613917_1614058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1614070_1614475_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|1614705_1615275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|1615341_1616382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1616408_1616636_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|1617686_1618544_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_144420712.1|1618540_1619302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|1619386_1622116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|1622249_1623125_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242874.1|1623389_1624364_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|1624792_1625506_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|1625674_1626166_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|1626305_1626797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|1626999_1627890_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|1628274_1628859_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|1628939_1629878_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|1629929_1631024_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|1631148_1632471_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|1632518_1637405_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|1637499_1637802_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|1637912_1639835_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|1639856_1641152_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|1641148_1642759_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|1642865_1643759_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|1643868_1644492_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|1645198_1645897_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|1646040_1646610_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|1646925_1647552_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|1647748_1648495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|1648590_1649430_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|1649480_1649828_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|1650018_1650906_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|1651020_1651623_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|1651619_1652339_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|1652407_1654120_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|1654267_1656205_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|1656317_1657367_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|1657366_1657642_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|1657722_1658271_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_016210338.1|1658390_1658528_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1658595_1658823_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 19
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1683717	1728153	3187881	transposase	Staphylococcus_phage(50.0%)	41	NA	NA
WP_036771330.1|1683717_1684692_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|1685007_1685169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1685165_1686569_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|1686682_1687450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365735.1|1687808_1689212_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|1690032_1690233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|1690473_1691919_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|1693114_1693990_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|1695441_1695723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|1695941_1696121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|1696280_1697300_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|1697286_1697709_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|1697710_1698184_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|1698309_1698966_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|1698962_1699637_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|1699642_1700791_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|1700787_1701249_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|1701324_1702575_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|1702701_1704381_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|1704492_1705374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|1706616_1707210_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|1707571_1708087_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|1709026_1709311_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|1709860_1710136_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1710508_1711483_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242983.1|1711639_1712278_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|1712359_1712758_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|1712910_1713228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377747.1|1713306_1713561_-	LapA family protein	NA	NA	NA	NA	NA
WP_017377748.1|1713713_1715375_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|1715435_1716119_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|1716118_1717204_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377751.1|1717245_1719882_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_155051395.1|1720861_1721005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|1721686_1723006_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|1723009_1723726_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|1723722_1724364_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|1724356_1724491_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|1724739_1725195_-	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_027242980.1|1725286_1725631_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|1726749_1728153_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1783071	1829779	3187881	tRNA,transposase	Synechococcus_phage(20.0%)	41	NA	NA
WP_048875859.1|1783071_1783866_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|1784155_1785079_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|1785346_1785640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|1786842_1787766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|1787901_1788744_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|1788831_1789482_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|1789495_1790536_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|1790658_1791744_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|1791770_1792880_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|1793184_1793502_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|1793498_1793858_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|1793960_1796693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|1798182_1798860_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|1799106_1799325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048033.1|1799469_1800678_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|1801105_1802563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|1803398_1803674_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|1806377_1806557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|1806553_1806925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1806935_1808018_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|1808014_1808236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|1809221_1809440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1809930_1810197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|1810455_1810776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|1812161_1813412_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|1813400_1814282_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|1814274_1815360_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|1815356_1816616_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|1816784_1817444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|1817614_1818277_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|1818623_1819571_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|1819667_1820294_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|1820299_1820881_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|1820952_1822044_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|1822133_1822847_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|1822940_1823765_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|1823998_1824676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|1826353_1826611_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1827011_1827986_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|1828160_1828805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|1828984_1829779_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 21
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1835474	1871753	3187881	protease,transposase	Acinetobacter_phage(25.0%)	34	NA	NA
WP_087910651.1|1835474_1835651_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|1835946_1836381_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|1836574_1838044_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|1838037_1839414_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|1839426_1839819_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|1839815_1840919_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|1841097_1842390_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|1842400_1843348_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|1843359_1844172_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|1844174_1844954_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|1844968_1846027_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|1846023_1847034_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|1847040_1847238_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|1847298_1850205_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|1850246_1851098_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|1851180_1851726_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|1851823_1852684_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_155048031.1|1852826_1853192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|1853273_1853780_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|1853825_1856777_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|1856798_1857131_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|1857248_1857758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|1858291_1858447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|1859521_1860688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|1860832_1861585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1861940_1862915_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|1863047_1863758_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|1863754_1864789_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_146619455.1|1864892_1865150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|1865744_1866905_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|1866873_1867470_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|1868438_1868609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1868605_1869580_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|1870599_1871753_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 22
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1916882	1982781	3187881	plate,tRNA,transposase	Staphylococcus_phage(18.18%)	57	NA	NA
WP_027242858.1|1916882_1918190_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|1918194_1918905_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|1918917_1922088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|1922154_1923291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|1924153_1925011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|1925152_1925953_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|1926051_1926627_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|1926709_1927381_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|1927426_1928326_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|1928360_1928744_-	response regulator	NA	NA	NA	NA	NA
WP_080963653.1|1928893_1929724_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|1929648_1930359_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|1930355_1931381_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|1931511_1934016_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|1934022_1935291_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|1935292_1936276_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|1936288_1937110_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|1937154_1937547_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|1937621_1938428_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|1938615_1939044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1939102_1940077_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|1940100_1940538_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1940572_1941976_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|1942556_1942718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|1943938_1944310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|1944417_1945968_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|1946000_1946840_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|1946836_1947352_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|1947355_1948348_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|1948726_1950097_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|1950305_1951445_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_062365741.1|1951658_1952261_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.0e-10
WP_036816881.1|1952944_1953163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376024.1|1953240_1953489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|1959144_1959825_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|1959889_1961176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|1961777_1962047_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|1962230_1963202_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|1963269_1964244_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|1964341_1965418_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|1965498_1966491_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|1966495_1968298_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|1968315_1969617_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027243118.1|1969632_1970916_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|1971048_1971441_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|1971547_1972633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|1972848_1973865_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|1973867_1974875_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|1974878_1976033_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|1976047_1976410_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|1976406_1978122_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|1978221_1978896_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|1978924_1979329_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|1979353_1980313_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|1980445_1981228_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|1981329_1982289_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|1982433_1982781_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	1986782	2050554	3187881	transposase	Planktothrix_phage(10.0%)	51	NA	NA
WP_144420814.1|1986782_1987700_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875984.1|1987844_1988381_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|1988640_1989543_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|1990532_1991522_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|1991690_1992029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|1992025_1992601_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|1992649_1992865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|1993051_1993891_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|1997587_1998496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|1998626_1999283_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|1999391_2000318_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2000636_2001197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2001666_2002986_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2003053_2003920_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2003912_2004788_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2004846_2005065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2006465_2006795_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377043.1|2007713_2009942_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2010204_2011218_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2011326_2011548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2011552_2013190_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2013328_2013862_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|2013982_2015101_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027242608.1|2015093_2016416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2016402_2017539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2017769_2018195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2021524_2021878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2021912_2022788_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2022944_2023349_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2023496_2024672_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2024931_2025435_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377059.1|2025474_2026959_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|2027182_2028136_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2028116_2029208_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2029510_2029753_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155048025.1|2030653_2030839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|2030820_2031396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2032270_2032543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2032695_2032950_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2033064_2034468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2034552_2035059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|2035623_2037444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2037510_2038041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2039587_2040304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2040346_2040784_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|2040821_2042201_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|2042595_2044590_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|2045054_2045867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2046050_2047514_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2047873_2049253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2050005_2050554_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 24
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	2082345	2125705	3187881	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|2082345_2083320_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2083316_2083754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2083928_2085332_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2085342_2085618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2085895_2086366_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2086668_2088039_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2088368_2088836_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2088848_2089859_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2090060_2091464_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|2091890_2092679_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2092665_2093694_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2093671_2094076_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2094303_2096271_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2096466_2096958_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2096992_2097835_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2097880_2098333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2098622_2099255_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2099255_2100506_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|2100539_2101637_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|2101966_2103352_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2103391_2103649_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|2106064_2107468_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2107464_2108505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2108897_2109293_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2109289_2110078_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2110263_2110989_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2111233_2112421_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2112713_2113256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2113252_2113939_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2113942_2114554_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2114600_2115620_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|2115722_2116517_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|2116530_2117331_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2117409_2118459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|2118634_2119915_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2119960_2120638_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2120723_2121005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|2121096_2121951_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|2121890_2122289_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|2122816_2123758_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2124476_2124698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|2124694_2125705_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	2178398	2214338	3187881	transposase	Staphylococcus_phage(16.67%)	32	NA	NA
WP_053856766.1|2178398_2179802_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377364.1|2179921_2180758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2180907_2181882_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|2182190_2183216_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|2183323_2184526_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2184763_2185177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063625.1|2185282_2185660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2185678_2186248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2186250_2186589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2186581_2187115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2187133_2187424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2187510_2189142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2189694_2190198_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2190160_2190868_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2190932_2191793_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2191773_2192547_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2192577_2193816_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2193815_2194778_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377348.1|2194821_2195574_+	ComF family protein	NA	NA	NA	NA	NA
WP_017377345.1|2198102_2198339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2198357_2198807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2199027_2200452_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_052106221.1|2200516_2201566_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_036818827.1|2201856_2202588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2202618_2203509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2204851_2207662_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_048875864.1|2207954_2208980_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|2209363_2210221_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2210390_2211119_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2211319_2212723_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2212868_2213366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2213435_2214338_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	2237547	2277763	3187881	protease,tRNA,transposase	Staphylococcus_phage(42.86%)	44	NA	NA
WP_069971662.1|2237547_2238522_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2238805_2240008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2240304_2240562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2240519_2240960_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2241065_2241632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2241776_2242031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2242175_2243045_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063584.1|2243566_2244526_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2244522_2245170_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2245198_2246050_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2246064_2247342_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2247382_2247898_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2247975_2249037_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2249058_2250147_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376959.1|2250191_2252027_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2252069_2252540_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2252576_2252912_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080963574.1|2252924_2253641_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2253577_2254618_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2254590_2255070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2255156_2257637_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2257699_2258131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2258331_2258622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2258681_2260280_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2260444_2260780_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2260808_2262473_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2262472_2263114_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2263113_2263857_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2263915_2264152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2264302_2265670_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2265680_2266232_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2266312_2267416_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2267417_2269175_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2269397_2270021_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2270075_2270495_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|2270635_2271250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2271307_2272093_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2272724_2273741_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2273743_2274256_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2274297_2274771_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2274826_2275612_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2275655_2276396_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2276485_2276734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2277109_2277763_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	2365160	2477222	3187881	protease,tRNA,transposase	Staphylococcus_phage(12.5%)	102	NA	NA
WP_017378106.1|2365160_2366105_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2366104_2366458_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2366506_2369182_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2369198_2370716_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2370792_2371245_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2371463_2372903_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2372902_2374441_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2374455_2376426_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2376429_2376735_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2376758_2377382_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2377401_2377890_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2377903_2378929_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2378933_2381327_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2381376_2382666_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2382672_2383173_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2383172_2384426_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2384427_2385105_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2385122_2385608_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2385598_2385967_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|2386645_2387008_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2387021_2387783_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2388084_2389431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2389527_2390070_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2390185_2391019_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2391040_2391634_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2391809_2392829_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2393099_2393501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2393511_2393835_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2393858_2394869_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2394935_2395784_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2395900_2396812_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2397578_2398454_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2398512_2398893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2399039_2399276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2399572_2400043_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2400097_2400952_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2401423_2401642_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|2401744_2402995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|2403050_2403533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2403769_2404198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2404533_2405508_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2405566_2406619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2406937_2407903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2408205_2409030_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2409231_2410308_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2410392_2411379_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2411397_2412042_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2412053_2413163_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2413229_2413892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2414151_2416035_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2416348_2417848_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2417938_2418721_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2418848_2419769_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2419792_2420251_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|2420372_2421248_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2421281_2422547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2422734_2423610_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2423808_2424000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2424204_2425500_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2425819_2426038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2426074_2427454_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2427481_2427940_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2427917_2429135_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2429327_2429564_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2429577_2429733_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|2429813_2430776_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|2430935_2432252_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|2432261_2432930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|2433340_2435155_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|2435870_2436056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|2436237_2436696_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081078121.1|2437414_2438215_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2438246_2438474_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420737.1|2439754_2440153_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2440156_2440399_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|2441288_2443040_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|2443050_2443851_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|2443953_2444442_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|2444941_2445865_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|2445961_2446306_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|2452000_2452963_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|2453001_2453877_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|2454136_2455396_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2455618_2455945_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|2456139_2457090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|2457147_2459214_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|2459219_2460215_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|2460954_2462535_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2462682_2464092_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|2464151_2465285_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|2465423_2466248_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_017377539.1|2466771_2466984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|2466997_2467135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377540.1|2467272_2467506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2468557_2468929_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|2469239_2469527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|2469678_2470527_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|2470649_2471621_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|2471723_2472764_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|2475302_2475593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|2475860_2476121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2476247_2477222_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 28
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	2510216	2570851	3187881	tRNA,transposase	Acinetobacter_phage(33.33%)	57	NA	NA
WP_053093682.1|2510216_2510960_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|2512126_2512723_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|2512993_2513572_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|2518094_2519600_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|2519627_2519909_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2520057_2520399_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|2520519_2522424_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|2522556_2524128_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929687.1|2524145_2525345_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|2525466_2526465_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|2526468_2527227_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|2527228_2528428_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|2528411_2529083_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|2529104_2529881_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|2529884_2530883_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|2530884_2531463_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|2531459_2532929_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2532972_2533260_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|2533460_2534381_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|2534496_2535051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|2535166_2535592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|2535862_2536213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|2536406_2536946_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|2537030_2537567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|2538225_2538528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377381.1|2538976_2539336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771979.1|2539637_2539958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|2540136_2541111_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|2541377_2541551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2541656_2543060_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|2543064_2544084_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|2544700_2545030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|2545255_2545654_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|2546521_2547472_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|2547471_2549550_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|2549691_2550207_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|2550215_2550779_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|2550759_2551506_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|2551644_2552097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|2552232_2553069_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|2553065_2553962_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|2553994_2555062_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2555080_2555449_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_080963575.1|2555474_2556926_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|2556932_2558312_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|2558352_2559666_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|2559655_2560630_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|2560723_2561227_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|2561361_2562513_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|2562509_2562989_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|2563135_2565457_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|2565401_2566028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|2566032_2566932_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|2567112_2567667_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2567706_2568681_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_069971663.1|2568899_2569142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2569876_2570851_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 29
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	2637243	2752760	3187881	protease,tRNA,transposase	Escherichia_phage(19.05%)	108	NA	NA
WP_017378478.1|2637243_2638623_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|2638737_2640630_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|2640677_2641304_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|2641323_2642208_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|2642240_2643131_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|2643245_2643644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|2643648_2644464_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|2644515_2644920_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|2644974_2645445_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|2645456_2645984_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|2646000_2647542_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|2647567_2648428_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|2648458_2649850_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|2649874_2650303_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|2650396_2651761_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|2651817_2653653_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|2653766_2654495_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|2655021_2656563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|2656829_2657486_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|2658183_2658843_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|2658987_2659245_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|2659357_2660110_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|2660168_2660882_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|2661073_2661706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2663440_2664844_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046628.1|2664840_2665065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2665144_2666119_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|2666138_2666456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|2666533_2666746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|2666992_2667412_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|2667509_2667956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|2668300_2669299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|2669331_2669685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|2669729_2670002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|2670398_2671817_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|2672043_2672985_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|2673019_2674999_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|2674995_2675601_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|2675602_2675944_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|2675944_2676781_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|2676946_2677264_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|2677341_2678763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|2678759_2679455_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_047927112.1|2679618_2679945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420744.1|2680641_2681487_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|2681496_2681835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|2682403_2683807_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|2683839_2684784_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|2684988_2685162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|2685769_2686819_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2686973_2687192_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2687511_2688915_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|2688925_2689483_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|2689479_2690355_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|2690579_2690870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|2693493_2694267_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|2694685_2695042_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|2695073_2695526_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243065.1|2695678_2698741_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_017376261.1|2698737_2699802_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_155048072.1|2699865_2700021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376260.1|2700165_2701119_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376259.1|2701151_2702315_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376258.1|2702320_2702920_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376257.1|2703107_2703608_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376256.1|2703625_2704714_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376255.1|2704852_2706097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|2706093_2706936_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376253.1|2706915_2707725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420746.1|2707911_2708127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376251.1|2708127_2709090_+	TonB family protein	NA	NA	NA	NA	NA
WP_017376250.1|2709145_2709697_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376249.1|2709826_2710249_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376248.1|2710241_2711003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376247.1|2711057_2711756_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_026063518.1|2711742_2712591_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376244.1|2713208_2713733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376243.1|2713865_2715080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376242.1|2715394_2716456_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376241.1|2716469_2718197_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_027243064.1|2718230_2718962_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_027243063.1|2718961_2719750_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243062.1|2719854_2720478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046626.1|2721039_2721207_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376237.1|2721809_2722562_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027242703.1|2728241_2728865_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376193.1|2728904_2729390_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017376192.1|2729436_2730582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653742.1|2730583_2732854_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_036771610.1|2732855_2733716_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_017376188.1|2733712_2734585_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_017376187.1|2734581_2735589_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376186.1|2735608_2736016_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_065653741.1|2736044_2737433_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_027242702.1|2737429_2738602_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_017376183.1|2738633_2739485_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242701.1|2739494_2740658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242700.1|2740654_2741662_+	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242699.1|2741658_2742795_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017376177.1|2742791_2743718_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_017376176.1|2743812_2745213_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_144420747.1|2745500_2746889_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_036771589.1|2746970_2747798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771607.1|2748016_2749021_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209597.1|2749074_2749305_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771588.1|2749312_2750191_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_017376171.1|2750327_2751302_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376170.1|2751659_2752760_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
>prophage 30
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	2825753	2956865	3187881	tail,protease,tRNA,transposase	Acinetobacter_phage(11.11%)	112	NA	NA
WP_017377604.1|2825753_2827736_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|2827945_2829289_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|2829555_2832225_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|2832248_2834165_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|2834334_2835756_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|2835900_2836875_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|2836884_2837184_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|2837301_2837523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|2837686_2839348_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|2839420_2839711_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|2839937_2840393_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|2840457_2840922_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|2841013_2842360_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|2842359_2843265_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|2843326_2844313_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2844305_2844548_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|2844666_2846211_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|2846257_2847544_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|2847586_2848990_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|2848994_2851532_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|2851928_2852177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|2852108_2852570_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|2853064_2853760_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|2853861_2855424_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|2855751_2857545_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|2857631_2857904_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|2857909_2858536_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|2858522_2859953_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|2860274_2861330_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|2861298_2861976_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|2861965_2862814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|2862959_2863253_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|2863364_2864177_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|2864475_2865330_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|2865483_2866533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|2866578_2867235_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|2867252_2868533_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|2868806_2870168_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|2870228_2870780_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|2876210_2877482_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|2877538_2878522_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|2878518_2879304_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|2879611_2880061_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2880154_2881558_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|2881995_2883477_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|2883532_2884642_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|2886214_2886427_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|2886467_2887163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155763433.1|2887426_2888599_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|2890143_2890710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|2890867_2891428_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|2891547_2892951_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|2892947_2893304_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|2893559_2894384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|2895081_2895606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2895891_2896866_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|2896965_2897517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2897629_2898283_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|2898534_2899992_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|2900105_2900585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2900822_2901428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|2901707_2902823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2902761_2903448_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|2903441_2904419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2904453_2905617_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|2905956_2906181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|2906563_2906851_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|2907025_2907781_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2907813_2908245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|2908220_2908697_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|2908703_2910281_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|2910283_2911048_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|2911101_2911638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2911634_2912366_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|2912590_2913352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2913677_2914553_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|2915955_2916111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2916304_2918014_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|2918667_2918976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|2918993_2921186_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|2921993_2922242_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|2922354_2922588_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|2922822_2923353_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|2923357_2924071_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|2924698_2925424_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|2925432_2927496_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|2927675_2928155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2928647_2930015_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|2930406_2931204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2931315_2932605_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|2932785_2933772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|2933888_2934068_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|2934079_2934511_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|2934723_2935083_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|2935252_2936878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2937601_2939029_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|2939322_2940504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|2943106_2944405_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|2944760_2945654_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|2945650_2945956_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|2945981_2946761_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|2946790_2947021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|2947172_2947418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|2947604_2948396_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|2949095_2949818_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|2949814_2950696_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|2950719_2952210_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|2952299_2953187_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|2953859_2954351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2954355_2954583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2954675_2955650_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|2955626_2956865_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	2964831	3018245	3187881	transposase	Staphylococcus_phage(57.14%)	49	NA	NA
WP_053856767.1|2964831_2966235_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2966340_2966526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2967224_2968628_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|2968718_2969222_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2969261_2970236_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|2970232_2970802_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|2971288_2971981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|2972588_2973581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|2973570_2975343_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|2975343_2975532_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|2975569_2976544_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|2976602_2976797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2976863_2977091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2977220_2978096_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2978323_2978473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|2978464_2978731_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|2978875_2979775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2979861_2980119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2980731_2981958_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|2982047_2982587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|2982708_2983347_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|2983380_2983869_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|2984115_2984418_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|2984398_2984887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2985457_2986756_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|2986872_2987163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2987201_2989856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|2990569_2990824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|2991133_2991862_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|2992632_2993817_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|2993835_2994780_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|2995085_2995871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|2995984_2996353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|2996581_2998159_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|2998942_3003367_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|3003503_3005027_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|3005231_3005459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|3005603_3005861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|3006428_3007400_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|3007324_3007633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772729.1|3007696_3007918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3008037_3009012_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|3009065_3010037_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|3010116_3011091_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|3011451_3014121_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|3014291_3015173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|3015183_3015840_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|3015906_3016611_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|3016841_3018245_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 32
NZ_CP013791	Piscirickettsia salmonis strain AY6297B, complete genome	3187881	3075254	3131247	3187881	tRNA,transposase	Acinetobacter_phage(20.0%)	49	NA	NA
WP_048875895.1|3075254_3076418_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|3076471_3077473_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|3077554_3078124_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|3078337_3079309_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|3079320_3080916_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|3080936_3081968_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|3082299_3083403_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|3083514_3084699_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|3084776_3086765_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_155049760.1|3087340_3087556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420609.1|3087924_3089298_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|3089315_3090302_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|3090304_3091459_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|3091455_3092151_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|3092293_3093784_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|3093804_3094854_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|3094920_3096315_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|3097247_3099179_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|3099183_3099714_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|3099748_3099943_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|3099985_3100345_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|3100476_3101472_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|3101484_3103866_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|3103871_3104159_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|3104425_3104632_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|3106240_3107014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|3107015_3107957_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|3108090_3109668_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|3109861_3110260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378392.1|3110837_3110990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|3111260_3111467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|3112271_3112916_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|3112983_3114240_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|3114495_3114675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|3114897_3115125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|3116400_3117159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|3117376_3117940_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|3118043_3118592_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|3119188_3120341_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|3120686_3120983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|3121242_3122154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|3122388_3122928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|3124090_3124228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|3124474_3125203_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|3125249_3125858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|3127132_3127393_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|3127566_3129105_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|3129283_3130210_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|3130314_3131247_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
>prophage 1
NZ_CP013792	Piscirickettsia salmonis strain AY6297B plasmid p1PS8, complete sequence	188268	0	60025	188268	tail,capsid,portal,transposase,head	Streptococcus_phage(18.18%)	56	NA	NA
WP_036772541.1|214_943_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_048876211.1|954_1659_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
WP_027243193.1|1930_2473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876212.1|2503_3382_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243191.1|3335_4043_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_075275473.1|4159_4336_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_048876213.1|5574_6465_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971688.1|6773_7880_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_155763436.1|7864_10057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|10789_11767_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771353.1|11848_12568_+	ParA family protein	NA	NA	NA	NA	NA
WP_036771355.1|12584_14021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|14492_15470_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|15497_15926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|15984_18675_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_144420832.1|19217_20003_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|19932_20604_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|20600_20942_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375784.1|23015_23282_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|23338_23662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|23663_24086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|24085_24436_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_081377382.1|24432_24798_-	hypothetical protein	NA	Q7Y404	Yersinia_phage	38.4	1.0e-05
WP_017375779.1|25004_25430_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|25426_25738_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_081377383.1|26122_26386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|26712_27252_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|27301_28276_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_155764136.1|28868_30593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081377385.1|30690_31029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242588.1|31025_31379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|31717_32692_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036773107.1|32979_33297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375691.1|33280_33982_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_017375692.1|34005_34239_-	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_036773116.1|34382_35357_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027243195.1|35722_36769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876259.1|37094_38111_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_047927763.1|38601_38865_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|38861_39260_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|39503_39959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619477.1|41823_42117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|42261_42432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|43101_44028_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|44223_44952_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_036773689.1|46100_46754_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|46776_47505_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_081377386.1|48390_48627_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|48629_49358_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_155764137.1|49404_50319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081377388.1|51215_52532_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_081377389.1|52678_53002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155764138.1|53092_53245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420836.1|54973_55174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876221.1|55901_56357_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_081329475.1|59227_60025_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP013792	Piscirickettsia salmonis strain AY6297B plasmid p1PS8, complete sequence	188268	64806	129214	188268	integrase,portal,transposase	Streptococcus_phage(48.15%)	60	72342:72401	111984:112904
WP_027243203.1|64806_65601_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|65694_65898_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|66092_66428_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_036771296.1|67127_69023_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_144420835.1|69363_71277_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|71572_71839_+|transposase	transposase	transposase	NA	NA	NA	NA
72342:72401	attL	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTA	NA	NA	NA	NA
WP_036771330.1|72378_73353_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|73659_74064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|74064_74811_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_036774644.1|75319_76381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|77360_77579_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|77597_78326_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|78477_79161_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|79165_79735_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|79905_80634_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|81117_81846_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|81898_82294_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|82587_83316_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|83473_86815_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_155046639.1|86914_87118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|87283_88012_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243202.1|88286_89222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876188.1|89935_90709_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_036774373.1|90882_91611_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_155046638.1|91884_92349_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774316.1|92345_92645_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774378.1|92687_93257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420833.1|93461_93653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|93666_94707_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242592.1|94773_95103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774388.1|95126_96089_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017377694.1|97466_98195_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|98441_98591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|98602_99331_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_081000015.1|99360_99747_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|99682_100111_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_082300723.1|101662_101890_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|102622_103114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|103195_103924_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|104267_104414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|104719_106585_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|106657_106924_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|107104_107446_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|107626_108160_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036774350.1|109399_110128_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|110610_111633_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772450.1|113446_114574_+	hypothetical protein	NA	NA	NA	NA	NA
111984:112904	attR	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCGATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAACTTCATTAAAATCCGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGTTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCGGCAAACTCTGTTCCGTTGTCAGAAGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGTTGTTCAATACCAACGCGATTAGGTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCCGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTATAAGTTCTTGACTGATAACATCGGGGGATGTATGAGTGCTTAACCGCTGATGAATCAACATTTTTTCCTCTTCTGAAATTTGTTGAAAAGCTTGTCCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCGCAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAA	NA	NA	NA	NA
WP_051929764.1|115245_115737_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	6.9e-21
WP_032126795.1|117095_117356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|117359_117632_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|117707_118436_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|119004_119976_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|120840_121668_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|122521_122992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|123885_124029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|125235_125835_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|126188_126965_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|127325_128054_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|128123_128324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|128242_129214_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013792	Piscirickettsia salmonis strain AY6297B plasmid p1PS8, complete sequence	188268	135453	140224	188268		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_017375964.1|135453_135879_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|136149_137145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|137448_137856_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|137963_139007_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|139308_139542_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|139679_139832_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|139861_140224_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
>prophage 4
NZ_CP013792	Piscirickettsia salmonis strain AY6297B plasmid p1PS8, complete sequence	188268	144360	188041	188268	portal,transposase,terminase	Streptococcus_phage(37.5%)	50	NA	NA
WP_027242929.1|144360_144744_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|144830_145313_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|145315_146647_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|146851_147286_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|147372_147759_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|147796_148531_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|148577_149291_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|150669_150855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|150858_154203_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|154383_155112_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|155205_156180_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|156493_156856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|156895_157405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|157636_158617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971702.1|159082_159955_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.3	3.8e-38
WP_036771347.1|160036_161014_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|161028_161190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|161407_161662_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|161651_161939_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_155048088.1|162433_163264_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.8	4.9e-35
WP_036771347.1|163264_164242_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_069971704.1|164349_164841_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|164922_165900_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|166027_166756_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|166938_168225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|168245_168410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420842.1|168826_168985_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|169046_169775_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420835.1|170181_172095_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|172390_172657_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|173202_173931_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|173971_174142_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|174217_175195_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929558.1|175276_175960_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_155046629.1|175987_176140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|176541_178281_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_082304501.1|178283_178646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377658.1|179595_180282_-	Fic family protein	NA	NA	NA	NA	NA
WP_080963659.1|180627_181248_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036772434.1|181226_181955_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_017377656.1|182042_182429_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017377655.1|182425_182671_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075275474.1|183012_184125_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017375840.1|185093_185312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|185356_185761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|185774_186113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|186105_186330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046641.1|186356_186521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|186701_187310_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|187312_188041_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
>prophage 1
NZ_CP013793	Piscirickettsia salmonis strain AY6297B plasmid p2PS8, complete sequence	60081	25804	58928	60081	integrase,transposase	unidentified_phage(14.29%)	35	50731:50761	55053:55083
WP_069971648.1|25804_26779_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	2.9e-26
WP_069971679.1|26837_28643_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_036773372.1|28648_29314_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_036773373.1|29322_30312_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_080963562.1|30416_31103_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_080963563.1|31026_31386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774456.1|31360_33940_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_065653727.1|33952_34399_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_051929537.1|34401_35871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929536.1|35880_36585_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_062365791.1|36577_37087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|37119_38523_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036775000.1|38703_38994_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_052106244.1|39009_39327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420828.1|39524_39779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774994.1|39984_40263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927058.1|40341_40698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053063426.1|40817_41603_+	class I SAM-dependent methyltransferase	NA	R4ZE30	Choristoneura_rosaceana_entomopoxvirus	27.9	2.1e-19
WP_047927059.1|41578_42280_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036775038.1|42265_43006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242605.1|43300_44596_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.8e-12
WP_036774869.1|45039_45888_-	ParB/RepB/Spo0J family partition protein	NA	Q331U1	Clostridium_botulinum_C_phage	25.7	7.1e-05
WP_047927060.1|45884_46745_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.3	9.3e-13
WP_053856777.1|46734_46956_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_047927062.1|47472_47799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927063.1|47798_48923_+	hypothetical protein	NA	NA	NA	NA	NA
50731:50761	attL	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_048876031.1|51019_52423_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242600.1|52450_53041_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
WP_032126795.1|53313_53574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|53577_53850_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_155046644.1|54175_54394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963647.1|55423_55594_-	hypothetical protein	NA	NA	NA	NA	NA
55053:55083	attR	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_036774631.1|55932_56397_-	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_098082828.1|57663_57921_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|57920_58928_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013794	Piscirickettsia salmonis strain AY6297B plasmid p3PS8, complete sequence	33557	4510	20533	33557	tail,integrase,transposase,capsid,head,terminase	unidentified_phage(38.46%)	20	3840:3899	18013:18304
3840:3899	attL	CAAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGT	NA	NA	NA	NA
WP_036771330.1|4510_5485_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|6020_6611_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|6841_7102_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|7094_7448_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|7624_8599_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|9131_9497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|9641_9896_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|9879_10236_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|10333_11308_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|11933_12800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|13012_13396_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|13482_13965_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|13967_14153_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|14172_15147_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|15243_15636_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|15671_16253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|16633_17608_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|17681_17897_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|18700_19216_-	hypothetical protein	NA	NA	NA	NA	NA
18013:18304	attR	ACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGCATTGATCCTACTCAGCTTATTGATACGCCGACCGGTACGATACTGATACATTCTCACCCTGATGGCACGGTTGAGCCGTCACTCGCGGATATGGTGGGTCAACGCGATACTGGATTATTATGGGGGATTGTTGCACTCAATCAACACGCTGTGACGGATGCCATTGTTTTTGGTGAGCAGTTATTCACCCAGCAATTACTCGAGCGGCCGTTTTTGCATGGTATTTTTGAT	NA	NA	NA	NA
WP_027242943.1|20116_20533_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
>prophage 1
NZ_CP013795	Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence	45766	0	25688	45766	integrase,transposase	Escherichia_phage(27.27%)	31	4548:4563	30340:30355
WP_021461774.1|406_688_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_069971687.1|759_1971_-	Tet(A)/Tet(B)/Tet(C) family tetracycline efflux MFS transporter	NA	NA	NA	NA	NA
WP_021461772.1|2063_2693_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004235553.1|2990_3923_-|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_011751353.1|4124_4766_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	6.6e-56
4548:4563	attL	TCATCATTACCCTGGG	NA	NA	NA	NA
WP_004235553.1|5439_6372_+|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_155763435.1|6497_6653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|6713_7211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|7286_8075_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|8132_8657_-	streptothricin N-acetyltransferase Sat2	NA	NA	NA	NA	NA
WP_000071896.1|8979_9516_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|9630_9957_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|10144_10384_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_081329474.1|10829_11276_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_012850379.1|11336_12554_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_012850378.1|12553_13306_-	ParA family protein	NA	H7BUL8	unidentified_phage	29.4	9.6e-14
WP_069971684.1|13309_13624_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_041692625.1|13824_14019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850375.1|14392_15388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041692624.1|15497_15920_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	33.0	1.6e-05
WP_012850373.1|16456_17821_-	hypothetical protein	NA	A0A1B1P892	Bacillus_phage	25.8	1.2e-09
WP_012850372.1|18005_18317_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012850370.1|18722_19463_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	33.7	1.6e-05
WP_012850369.1|19462_20110_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012850368.1|20110_21175_-	phosphoribosyltransferase	NA	A0A0R6PHM5	Moraxella_phage	34.9	4.1e-34
WP_012850367.1|21184_21508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850366.1|21614_21752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850365.1|21799_22057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850364.1|22482_22971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012850363.1|22980_23721_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_012850362.1|23717_25688_+	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	34.2	1.2e-76
30340:30355	attR	TCATCATTACCCTGGG	NA	NA	NA	NA
>prophage 2
NZ_CP013795	Piscirickettsia salmonis strain AY6297B plasmid p4PS8, complete sequence	45766	37244	41957	45766		Bdellovibrio_phage(50.0%)	3	NA	NA
WP_012850393.1|37244_40292_+	hypothetical protein	NA	H9C0J7	Bdellovibrio_phage	30.6	5.4e-23
WP_012850392.1|40281_40425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012850391.1|40427_41957_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	6.9e-35
