The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	5111	54216	3187888	tRNA,transposase	Staphylococcus_phage(21.43%)	51	NA	NA
WP_017377815.1|5111_6650_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.5	3.5e-87
WP_017375632.1|6970_7306_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_017377700.1|8118_8412_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_036773116.1|8782_9757_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971645.1|9800_10127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377817.1|10266_10764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377818.1|10999_11644_+	porin family protein	NA	NA	NA	NA	NA
WP_053856754.1|11748_12000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377819.1|12144_13140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210813.1|13217_13646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210814.1|13995_14193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210817.1|14435_15068_-	riboflavin synthase	NA	A0A1V0SE20	Indivirus	32.8	1.1e-13
WP_016210815.1|15488_16439_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_017377820.1|16435_17968_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_017377821.1|17964_18495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|19582_19810_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875857.1|20066_21041_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_048876031.1|21464_22868_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420615.1|22901_23690_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_017376557.1|23820_24516_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	27.4	1.2e-10
WP_017376558.1|25020_25527_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242585.1|25620_26178_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_080999966.1|26475_27825_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046619.1|27911_28169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376564.1|28236_28947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420761.1|29091_29271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376566.1|29794_31054_-	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_017376567.1|31186_31660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376568.1|31668_33051_+	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_026063542.1|33043_33658_+	UbiX family flavin prenyltransferase	NA	NA	NA	NA	NA
WP_017376570.1|33737_34454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376571.1|34628_36953_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	49.7	7.6e-25
WP_036771330.1|37119_38094_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420616.1|39257_40766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376574.1|40937_42029_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376575.1|42061_42700_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_017376576.1|42738_43011_-	DUF1315 family protein	NA	NA	NA	NA	NA
WP_144420763.1|43109_43352_-	BolA/IbaG family iron-sulfur metabolism protein	NA	NA	NA	NA	NA
WP_017376578.1|43369_43672_-	YciI family protein	NA	NA	NA	NA	NA
WP_017376579.1|43755_44298_-	septation protein A	NA	NA	NA	NA	NA
WP_016210074.1|44458_45085_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_017376580.1|45090_45930_+	hypothetical protein	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	24.2	4.2e-10
WP_017376581.1|45919_46570_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	33.5	3.9e-19
WP_026063543.1|46573_47407_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_017376583.1|47496_48624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963588.1|48890_49043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927249.1|49150_49345_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376585.1|49537_50188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376586.1|50442_51534_-	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_017376587.1|51530_52895_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A088FRM7	Mycobacterium_phage	52.2	2.6e-17
WP_017376588.1|53019_54216_+|tRNA	tyrosine--tRNA ligase	tRNA	A0A2I2L594	Orpheovirus	24.8	2.8e-07
>prophage 2
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	64102	113171	3187888	tRNA,transposase	Bacillus_phage(35.71%)	53	NA	NA
WP_017377700.1|64102_64396_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_080999967.1|64512_64662_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|65990_66965_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420617.1|67063_67219_-	phosphatase	NA	NA	NA	NA	NA
WP_080999968.1|67137_67398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046618.1|67574_68102_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	48.9	3.8e-33
WP_026063680.1|68356_68581_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	46.2	1.2e-07
WP_144420618.1|68725_69547_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.9	1.2e-41
WP_017377700.1|69504_69798_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.4e-06
WP_027243138.1|71274_71562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875909.1|72054_72825_-|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_081329471.1|72894_74307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910635.1|74673_76044_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046582.1|76040_76205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377223.1|76264_76552_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_017377833.1|77583_78174_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_026063682.1|78300_79686_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017377835.1|79783_79981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243136.1|80073_80907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420766.1|81444_81798_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_027243135.1|81810_82047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243134.1|82046_82253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377840.1|82414_83134_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_017377841.1|83222_85007_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_155601396.1|85313_85469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377842.1|85395_85650_+	DUF2282 domain-containing protein	NA	NA	NA	NA	NA
WP_027243133.1|85795_86617_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_080963580.1|86799_87024_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|87129_88533_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377200.1|89097_89286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243131.1|89415_89682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377198.1|90067_91708_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_017377197.1|91820_93170_+	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	37.0	3.0e-74
WP_027243130.1|93166_94036_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.2	9.3e-69
WP_017377194.1|94960_96274_+	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_048875913.1|96270_97041_+	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_017375625.1|97037_97265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875914.1|97969_99130_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_069971647.1|99098_99695_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|100663_100891_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048875916.1|101858_102263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048063.1|102266_103262_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420620.1|103247_104450_-	MFS transporter	NA	NA	NA	NA	NA
WP_036774946.1|104376_104991_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	G9E4Q1	Emiliania_huxleyi_virus	35.1	3.8e-16
WP_155046615.1|105687_105849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377737.1|106128_106674_+	non-canonical purine NTP phosphatase	NA	NA	NA	NA	NA
WP_017377736.1|106707_107373_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_027243185.1|107432_108389_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	31.6	6.3e-34
WP_144420767.1|108667_109345_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_048875918.1|109387_109969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046614.1|110113_110785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927746.1|111387_111975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|112943_113171_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 3
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	124853	156530	3187888	tRNA,transposase	Staphylococcus_phage(50.0%)	29	NA	NA
WP_017377787.1|124853_125081_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377716.1|125215_126679_+	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_017377715.1|126681_127734_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	M4QRZ2	Synechococcus_phage	41.1	3.1e-10
WP_017377714.1|127723_128179_+	arginine repressor	NA	NA	NA	NA	NA
WP_027242900.1|128203_128530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377712.1|128873_129185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927332.1|129314_130097_+	lipoprotein	NA	NA	NA	NA	NA
WP_144420768.1|130109_131045_-	EamA family transporter	NA	NA	NA	NA	NA
WP_017377709.1|131176_131380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242901.1|131720_132410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875919.1|132436_132754_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377706.1|132771_132984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|133937_134165_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420621.1|135322_136084_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771325.1|138274_139249_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242902.1|139373_140810_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_017376308.1|140889_142350_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_017376309.1|142470_142758_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_016210526.1|142955_143999_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_017376311.1|144014_144914_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_017376312.1|144910_145429_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_017376313.1|145498_146116_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_026063524.1|146125_147613_+	ribonuclease G	NA	NA	NA	NA	NA
WP_027242903.1|147622_151303_+	DUF3971 domain-containing protein	NA	NA	NA	NA	NA
WP_017376318.1|151376_152186_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_017376319.1|152185_152866_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_036773116.1|153490_154465_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_048875923.1|154507_155503_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|155555_156530_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
>prophage 4
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	191981	225430	3187888	tRNA,transposase	uncultured_Caudovirales_phage(33.33%)	23	NA	NA
WP_017376198.1|191981_193442_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_017376197.1|193477_195007_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	42.6	1.1e-85
WP_080999970.1|195040_196444_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420624.1|198355_200170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|200254_201658_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876012.1|201803_203207_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|203691_204666_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420769.1|205134_206025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243146.1|206685_207522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243147.1|207810_210483_+	DUF4135 domain-containing protein	NA	NA	NA	NA	NA
WP_080963645.1|210731_211922_+	MFS transporter	NA	NA	NA	NA	NA
WP_155046613.1|212254_212449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377214.1|212385_214038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927663.1|214638_215865_+	MFS transporter	NA	NA	NA	NA	NA
WP_027243150.1|216260_216806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377217.1|216765_217143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|217139_218543_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_082300719.1|218761_219187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243151.1|219238_220726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377221.1|221035_221575_-	superoxide dismutase family protein	NA	NA	NA	NA	NA
WP_082300723.1|221864_222092_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017377224.1|223337_223913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999971.1|224026_225430_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	264675	333486	3187888	integrase,transposase,protease	Staphylococcus_phage(17.65%)	59	317105:317164	333262:333758
WP_036771330.1|264675_265650_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_053093666.1|268186_268864_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.4	1.4e-48
WP_144420627.1|270362_270584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000005.1|271464_271626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999972.1|271562_272063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376821.1|272158_272587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875928.1|272846_273296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420628.1|273348_273783_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999973.1|273759_274725_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.6	2.0e-48
WP_017377288.1|274943_275204_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_087910637.1|275298_276033_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.3	2.0e-24
WP_155046611.1|276061_276214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875930.1|276418_277363_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377293.1|277348_277777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875931.1|277921_278173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243030.1|278560_279469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377295.1|279932_280898_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	38.1	1.8e-44
WP_016209646.1|280942_281518_-	VOC family protein	NA	NA	NA	NA	NA
WP_036771756.1|281548_282823_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420629.1|283471_284188_+	aldolase	NA	NA	NA	NA	NA
WP_017377300.1|284266_285004_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_017377301.1|285124_286480_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_075275279.1|286659_287331_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_017377303.1|287446_288322_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.7	9.8e-34
WP_017377304.1|288922_290227_+	trigger factor	NA	NA	NA	NA	NA
WP_016209647.1|290339_290945_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	59.8	8.4e-61
WP_017377305.1|291026_292328_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.3	6.5e-135
WP_017377306.1|292395_294828_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.7	1.2e-219
WP_016209655.1|294931_295204_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	62.9	2.0e-22
WP_075275280.1|295286_297185_+	surA N-terminal domain protein	NA	NA	NA	NA	NA
WP_017377308.1|297216_298101_+	hypothetical protein	NA	A0A1W6JP29	Morganella_phage	35.7	2.2e-41
WP_017377309.1|298109_298505_-	CrcB family protein	NA	NA	NA	NA	NA
WP_048875932.1|298928_301076_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	36.2	3.1e-25
WP_017377313.1|301047_302397_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377314.1|302393_304514_-	ATP-binding cassette domain-containing protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	28.1	2.0e-16
WP_017377315.1|304510_306214_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	25.0	3.4e-22
WP_017377316.1|306348_307491_-	galactokinase	NA	NA	NA	NA	NA
WP_017377317.1|307547_308576_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_026063623.1|308702_310217_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_017377319.1|310323_310524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420630.1|310668_311004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275281.1|311148_311385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420772.1|311655_312534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875933.1|313170_314115_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999974.1|314388_315792_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420631.1|315796_316582_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	29.7	1.2e-06
WP_075275282.1|316972_317815_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
317105:317164	attL	TCTAATTACCGAAATTTTAAGATGTATTATCTTCATGTAATAAAAGGTAGCATGGTAAAA	NA	NA	NA	NA
WP_017377467.1|317811_318108_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_017377471.1|319589_320201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377472.1|320269_321076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|321379_322354_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377475.1|322525_324418_+	DNA topoisomerase IV subunit B	NA	A0A172JHT4	Bacillus_phage	32.3	3.6e-81
WP_144420632.1|324990_327306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|327720_329124_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875935.1|329564_330044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420633.1|330111_331368_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772665.1|331514_332039_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017376899.1|332443_332584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929562.1|332781_333486_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
333262:333758	attR	TTTTACCATGCTACCTTTTATTACATGAAGATAATACATCTTAAAATTTCGGTAATTAGATTTGTGAAAATAAATCATAATTGTCATTATTTCACTTGTTGACATTTGTGAAGGCTTATTACGTTTTTTATTCGTATCTTCTAGCAAAATAGCATTCCATTGAGGTAATAACTCTTGGCAGAAATCATCTATTACACAAAAGAGAGAAATCAATGTTAAGTCCATTTTATTGCTTCTTTAGAACTAAATTTAGACTCTATTTAGCCGCAAAATCACTGGTTTTTCAAATACTTCTTATGTCGAACTCACGTTAGAATCACAAATGATTACTGATGAGGTGTTTTTATCATTTTGTCAAACAACTATCTTGACTATAACAAAAGTTATGAGTGATTTTTGTGTGGGTTATAAGGACTTTGAACATAAAGAAATTTGGCTGGAAGGCGTGAAAGATAAAATTCATCAGGGAGTAGACAAATTTTTTAATGCAGGAAATG	NA	NA	NA	NA
>prophage 6
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	337948	533383	3187888	tRNA,transposase,protease	Staphylococcus_phage(17.95%)	171	NA	NA
WP_048875878.1|337948_339352_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376909.1|339821_340799_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_027243158.1|340895_342356_-	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_017376911.1|342382_343036_-	protein-L-isoaspartate O-methyltransferase	NA	NA	NA	NA	NA
WP_017376912.1|343160_343727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774028.1|344023_345757_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	30.0	1.6e-32
WP_047927497.1|345828_347535_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	26.3	3.6e-24
WP_017376916.1|347526_348585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875936.1|348838_349687_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.4	1.4e-16
WP_017375855.1|350281_350728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420773.1|351417_352830_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_017375857.1|353221_354664_+	MFS transporter	NA	NA	NA	NA	NA
WP_144420774.1|354795_354864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420634.1|355062_356394_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036771639.1|356498_357473_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017377669.1|357522_358227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420635.1|358667_359480_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420636.1|359538_362049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036815620.1|362394_363570_+	outer membrane transport family protein	NA	NA	NA	NA	NA
WP_144420637.1|364917_365142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875940.1|365170_366334_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.4e-25
WP_036774146.1|368576_369722_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_027243152.1|370314_371250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875941.1|372747_373059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|373055_374138_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377679.1|374453_374660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243160.1|374757_375288_+	prokaryotic cytochrome b561 family protein	NA	NA	NA	NA	NA
WP_017377681.1|375575_376754_-	mandelate racemase/muconate lactonizing enzyme family protein	NA	Q6A202	Oenococcus_phage	31.6	7.7e-50
WP_144420775.1|376902_380667_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_017377683.1|380725_382228_-	sodium/proline symporter PutP	NA	NA	NA	NA	NA
WP_036773927.1|382779_383415_+	peroxiredoxin C	NA	NA	NA	NA	NA
WP_016211781.1|383926_385174_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_075275285.1|385396_386833_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048875943.1|387008_388226_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999976.1|388687_389467_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|390185_391160_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_048875941.1|392205_392517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420638.1|392513_393596_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046609.1|393906_394113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243178.1|395833_397195_-	Do family serine endopeptidase	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	35.5	4.3e-12
WP_017375734.1|397305_397677_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_017375735.1|397899_398550_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375736.1|398592_399675_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_069971648.1|400401_401376_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_082300723.1|402246_402474_-|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017376860.1|404654_406208_+	protein kinase family protein	NA	NA	NA	NA	NA
WP_017376859.1|406996_407233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275287.1|407352_408396_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|408642_409044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774710.1|409217_410117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875946.1|410511_411723_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.8e-25
WP_036771959.1|411733_411958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376857.1|412279_412510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|412536_413940_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027243219.1|414106_414415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052687.1|414699_414870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875947.1|415498_416548_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875948.1|416616_417639_+|transposase	IS481 family transposase	transposase	E9P643	Wolbachia_endosymbiont_wVitB_of_Nasonia_vitripennis_phage	72.4	3.9e-135
WP_017378198.1|417684_418599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|419567_419795_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017378197.1|419751_420621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093667.1|422058_422775_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376026.1|423219_425091_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	28.4	1.4e-34
WP_027243175.1|425182_426928_-	DNA primase	NA	A0A1S5RGL3	Helicobacter_phage	36.7	7.6e-46
WP_017376029.1|427007_427457_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	44.9	1.4e-20
WP_016211035.1|427509_427725_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_017376030.1|427971_428988_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	54.2	1.8e-100
WP_017376031.1|429036_429666_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_017376032.1|430006_431218_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_048875949.1|431250_431601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420640.1|431566_432247_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376035.1|432523_432943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_146619425.1|433088_433775_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774346.1|433919_434213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|434256_435231_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_144420641.1|435250_435886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275290.1|436129_437131_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376037.1|437229_438438_-	MFS transporter	NA	NA	NA	NA	NA
WP_036771498.1|438427_440158_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_036771517.1|440341_441478_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875952.1|442222_442858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376043.1|442972_444307_-	dihydroorotase	NA	NA	NA	NA	NA
WP_017376044.1|444435_445077_-	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_017376045.1|445382_445805_+	universal stress protein	NA	NA	NA	NA	NA
WP_017376046.1|446082_447045_+	formimidoylglutamase	NA	NA	NA	NA	NA
WP_075275404.1|447083_448259_+	imidazolonepropionase	NA	NA	NA	NA	NA
WP_087910638.1|448347_450048_+	urocanate hydratase	NA	NA	NA	NA	NA
WP_017376050.1|450047_451586_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	37.4	2.1e-71
WP_017376051.1|451625_453278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210558.1|453351_454107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063502.1|454293_455169_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420642.1|455433_455628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773960.1|455772_456246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046586.1|456515_456689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|456893_458207_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376055.1|458203_458848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772015.1|459366_460554_-	MFS transporter	NA	NA	NA	NA	NA
WP_027242844.1|460734_461376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376060.1|461449_462799_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	E4ZFI6	Streptococcus_phage	27.6	7.5e-33
WP_048876123.1|462902_465083_+	GTP diphosphokinase	NA	NA	NA	NA	NA
WP_036772169.1|465152_466028_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_080999977.1|466074_466371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376065.1|466494_466902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420776.1|466881_467460_-	TIGR00730 family Rossman fold protein	NA	A0A1D8KUT5	Synechococcus_phage	34.3	6.9e-20
WP_017376067.1|467882_468545_+	adenylate kinase	NA	NA	NA	NA	NA
WP_016211263.1|468575_468944_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_017376068.1|468954_470271_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420644.1|470517_471129_+	DedA family protein	NA	NA	NA	NA	NA
WP_065653731.1|471204_471384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211261.1|471554_471848_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.5	5.8e-15
WP_036772670.1|472088_472391_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A218MMY6	uncultured_virus	40.0	7.5e-10
WP_017376072.1|472445_474719_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.3e-167
WP_016211259.1|474778_475024_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_048875954.1|475148_475904_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875955.1|476012_476987_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	4.3e-30
WP_036771709.1|477194_477956_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_017376076.1|477939_478896_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	43.7	1.6e-61
WP_017376077.1|479158_481657_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	42.9	2.4e-85
WP_017376078.1|481660_482401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376079.1|482850_483645_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_017376080.1|483807_484596_+|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_017376081.1|484592_485804_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_144420777.1|485796_486153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376083.1|486247_486676_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	39.4	1.8e-17
WP_036771725.1|486827_487937_+	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_017376085.1|487933_488662_+	type IV pilus biogenesis/stability protein PilW	NA	NA	NA	NA	NA
WP_017376086.1|488719_489607_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376087.1|489691_490066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376088.1|490165_491443_+|tRNA	histidine--tRNA ligase	tRNA	A0A2I2L577	Orpheovirus	24.8	3.6e-21
WP_080963644.1|491454_492186_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_144420645.1|492157_493414_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_027242841.1|493523_494927_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_155046606.1|495079_495250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275292.1|496655_497486_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046605.1|497713_497863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242840.1|498057_498879_+	ParA family protein	NA	H7BUL8	unidentified_phage	33.0	3.9e-16
WP_017375751.1|498875_499769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375750.1|499814_500336_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017375749.1|500413_500899_+	DUF2802 domain-containing protein	NA	NA	NA	NA	NA
WP_048875957.1|501032_501689_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.9	9.6e-10
WP_017375746.1|501685_501994_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	41.4	1.7e-09
WP_036771957.1|502342_503314_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377899.1|503618_504410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875958.1|504399_505263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377897.1|505289_505709_-	response regulator	NA	W8CYM9	Bacillus_phage	29.4	1.2e-05
WP_017377896.1|505761_506718_-	23S rRNA pseudouridine(955/2504/2580) synthase RluC	NA	NA	NA	NA	NA
WP_027242839.1|507200_509873_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_017377894.1|509953_510580_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_026063687.1|510736_512335_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_017377892.1|512424_513846_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_017377891.1|513876_514398_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	34.2	2.0e-10
WP_017377890.1|514394_515000_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_017377889.1|515076_516087_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.9e-07
WP_017377888.1|516199_516904_+	protein TolQ	NA	NA	NA	NA	NA
WP_017377887.1|516938_517370_+	protein TolR	NA	NA	NA	NA	NA
WP_036771700.1|517372_518467_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_048875959.1|518526_519879_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_017377882.1|519914_520556_+	OmpA family protein	NA	NA	NA	NA	NA
WP_144420778.1|520628_521528_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_027242836.1|521530_522178_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	38.6	1.6e-36
WP_027242835.1|522228_523032_-	AAA family ATPase	NA	A0A0E3G5H5	Synechococcus_phage	43.1	6.8e-42
WP_017377879.1|523213_523429_+	SlyX family protein	NA	NA	NA	NA	NA
WP_017377878.1|523432_523666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377877.1|523727_525320_-	exodeoxyribonuclease VII large subunit	NA	NA	NA	NA	NA
WP_017377875.1|525522_526452_+	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.9	7.0e-14
WP_017377874.1|526453_527221_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927659.1|527586_528357_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_036771330.1|528415_529390_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017377870.1|529497_529860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377869.1|530029_531739_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_048875961.1|531979_533383_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	537017	599575	3187888	transposase,protease	Burkholderia_virus(28.57%)	50	NA	NA
WP_017376708.1|537017_537419_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875964.1|537983_538763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046604.1|538830_538971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420647.1|539171_539369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053093668.1|539506_540106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420648.1|540288_541761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378009.1|542163_543909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243143.1|544344_545205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378007.1|545722_547666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|547811_549215_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378006.1|549334_549964_-	response regulator	NA	NA	NA	NA	NA
WP_017378005.1|550202_550922_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_017378004.1|551035_554575_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_017378003.1|554641_555472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773465.1|555458_557498_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	40.9	7.1e-128
WP_027243145.1|557513_558569_+|protease	protease SohB	protease	NA	NA	NA	NA
WP_017377998.1|558579_559110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875965.1|561267_562188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420649.1|562332_562473_-	phosphatase	NA	NA	NA	NA	NA
WP_017375623.1|563361_563745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774918.1|563754_564114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080999979.1|565048_565195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420650.1|565433_566690_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|566945_567125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420651.1|567444_568098_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	33.1	5.8e-15
WP_075275295.1|568302_568629_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999971.1|569400_570804_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377761.1|570974_572345_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_144420780.1|572391_573291_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377763.1|573271_576076_-	response regulator	NA	A0A1V0SGX0	Hokovirus	31.8	6.9e-57
WP_017377764.1|576155_576752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377765.1|577165_577921_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377787.1|578010_578238_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242898.1|579354_579996_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377768.1|580265_581591_+	acetyl-CoA C-acetyltransferase	NA	NA	NA	NA	NA
WP_047927230.1|581587_583645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377771.1|583622_584195_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420781.1|584277_584610_+	DUF1820 family protein	NA	NA	NA	NA	NA
WP_017377773.1|584674_585709_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_027242897.1|585696_586818_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_122941582.1|586911_587895_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_027242896.1|588051_589719_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	1.2e-19
WP_027242895.1|590005_590857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377782.1|591265_593734_+	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_017377783.1|593747_594722_+	homoserine kinase	NA	NA	NA	NA	NA
WP_017377784.1|594708_595977_+	threonine synthase	NA	NA	NA	NA	NA
WP_027242894.1|596010_597759_-	PLD-like domain protein	NA	NA	NA	NA	NA
WP_017375591.1|597938_598142_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_144420652.1|598360_599038_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	38.8	2.6e-34
WP_047927086.1|599317_599575_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.8	4.1e-09
>prophage 8
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	639763	673745	3187888	tRNA,transposase	uncultured_Mediterranean_phage(40.0%)	29	NA	NA
WP_051929562.1|639763_640468_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036771332.1|640718_641693_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017376395.1|642580_645307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|645830_646805_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017376397.1|647002_648484_-	MFS transporter	NA	NA	NA	NA	NA
WP_016209947.1|648943_649606_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_017376398.1|649847_651080_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017376399.1|651236_654008_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	6.9e-150
WP_017376400.1|654076_654520_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_017376401.1|654672_656145_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	30.2	1.8e-43
WP_017376402.1|656256_657318_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_027242800.1|657314_658349_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_017376405.1|658351_659392_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_026063528.1|659576_660692_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.2	2.2e-94
WP_017376407.1|660730_661084_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	46.5	1.1e-07
WP_017376408.1|661104_662973_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_017376409.1|662994_663939_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.2	2.4e-38
WP_017376410.1|664172_664451_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016209938.1|664813_665452_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_017376411.1|665426_666851_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	33.4	3.9e-40
WP_017376412.1|667051_667729_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_027242801.1|667849_669124_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	1.7e-90
WP_017376414.1|669191_669947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376415.1|669998_670916_+	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_017376416.1|671050_671221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420654.1|671340_672120_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376231.1|672172_672460_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_051929627.1|672519_672870_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_081078111.1|672992_673745_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	683491	742191	3187888	transposase	Escherichia_phage(20.0%)	50	NA	NA
WP_017375910.1|683491_684220_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017375910.1|684622_685351_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_075275409.1|685414_686242_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242802.1|686423_686792_-	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_017376425.1|686788_687607_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_017376424.1|687707_688523_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_017376423.1|688806_690867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420655.1|690863_691289_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376421.1|691474_692968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376420.1|693100_693916_-	exodeoxyribonuclease III	NA	NA	NA	NA	NA
WP_017376419.1|694011_694428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376418.1|694810_695350_-	DUF2975 domain-containing protein	NA	NA	NA	NA	NA
WP_144420656.1|696266_696428_-	phosphatase	NA	NA	NA	NA	NA
WP_144420657.1|697139_698201_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772905.1|699691_700045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242803.1|700253_701966_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.9	2.5e-25
WP_027242804.1|702412_704266_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	40.5	2.2e-43
WP_016209821.1|704368_704701_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017377485.1|704731_705328_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_017377486.1|705324_706449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377487.1|706560_707208_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	30.8	1.4e-08
WP_017377488.1|707259_709173_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.6	1.8e-117
WP_017377489.1|709377_710415_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242805.1|710473_713800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242806.1|714506_715475_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242807.1|715604_716093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036777920.1|716534_716768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036817939.1|717077_717266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375667.1|717754_718240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275301.1|718510_718780_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_017377496.1|718814_720140_-	ribonuclease HI	NA	G3MB70	Bacillus_virus	36.3	1.3e-37
WP_144420783.1|720195_720843_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027242809.1|721036_722995_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.2	2.5e-45
WP_047927313.1|723138_726069_+	peptidase M16	NA	NA	NA	NA	NA
WP_048875980.1|726874_728278_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378296.1|729718_730504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378295.1|730594_732244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378294.1|732388_733234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|733347_734751_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927801.1|734747_735194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148037443.1|735199_735409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242792.1|735435_736095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378290.1|736113_736989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275303.1|737124_738114_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|738090_738852_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_144420659.1|738884_739664_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875973.1|739940_740576_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046582.1|740572_740737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|740935_741910_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_081329472.1|741945_742191_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	804329	844735	3187888	tRNA,transposase	Tupanvirus(22.22%)	38	NA	NA
WP_017378228.1|804329_805250_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_155046600.1|809413_809557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378223.1|810166_810985_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_016211418.1|811092_811554_-	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_017378221.1|811570_812494_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_027242798.1|812517_813567_-	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_047927040.1|813704_814298_+	oligoribonuclease	NA	A0A1B3B0T8	Gordonia_phage	29.6	1.2e-14
WP_017378219.1|814320_814791_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_144420785.1|814900_816151_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	27.4	1.7e-15
WP_016211840.1|816839_817304_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	32.9	4.7e-19
WP_017378214.1|817742_819215_+	catalase	NA	A0A2K9L572	Tupanvirus	46.5	3.3e-98
WP_017378213.1|819331_819784_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_155046599.1|819908_820064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420662.1|820208_820412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378212.1|820602_821001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875983.1|821186_821792_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.3e-48
WP_017375549.1|821800_822097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|822101_822638_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875985.1|822782_823388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|823431_824406_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048875986.1|824402_824900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910640.1|825307_825724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053856767.1|825791_827195_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275305.1|827191_827812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|828083_829058_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_036773538.1|829222_829846_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017376442.1|829842_831783_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	33.0	1.8e-72
WP_017376443.1|831938_832592_+	glutaredoxin 2	NA	NA	NA	NA	NA
WP_017376444.1|832760_833936_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_017376445.1|834289_835615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063532.1|835707_836496_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_017376447.1|836597_837470_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_017376448.1|837656_838919_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_017376449.1|838992_839523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376450.1|839544_841050_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	40.4	7.7e-87
WP_017376451.1|841062_841728_+|tRNA	tRNA-(ms[2]io[6]A)-hydroxylase	tRNA	NA	NA	NA	NA
WP_017376452.1|841821_843582_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_036773947.1|843859_844735_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	850401	955828	3187888	tRNA,transposase,protease	Burkholderia_phage(13.04%)	95	NA	NA
WP_017376460.1|850401_852996_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	41.3	2.4e-88
WP_017376461.1|853302_853566_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	68.6	4.1e-12
WP_069971651.1|853938_854814_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046597.1|854928_855105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376465.1|855649_857212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772167.1|857753_858701_-	sphingomyelin phosphodiesterase	NA	NA	NA	NA	NA
WP_017376467.1|858920_860396_-	APC family permease	NA	NA	NA	NA	NA
WP_017376469.1|860915_861938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376470.1|862294_863662_+	glycerol-3-phosphate transporter	NA	NA	NA	NA	NA
WP_026063533.1|863937_864192_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_048876132.1|864240_865494_+	GTPase HflX	NA	NA	NA	NA	NA
WP_027242811.1|865513_866728_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_017376474.1|866727_867621_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_017376475.1|867818_869117_+	adenylosuccinate synthase	NA	A0A2R8FF47	Brazilian_cedratvirus	34.1	2.4e-65
WP_027242812.1|869206_870484_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.1	7.5e-51
WP_036772166.1|870497_872897_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.3	5.2e-69
WP_017376476.1|872893_873652_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_017376477.1|873828_874218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|876340_876628_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_081078114.1|876993_877785_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.4	1.9e-44
WP_017375672.1|878443_878935_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377694.1|878923_879652_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377465.1|879670_880528_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	31.3	5.3e-16
WP_027242813.1|880533_881787_-	type III PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_027242814.1|881820_883689_-	IucA/IucC family siderophore biosynthesis protein	NA	NA	NA	NA	NA
WP_052106215.1|883675_884914_-	MFS transporter	NA	NA	NA	NA	NA
WP_080963599.1|884898_886746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377461.1|886730_887936_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_017377460.1|887947_890137_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_017377459.1|890705_891335_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275307.1|891357_891777_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_027242816.1|891769_892174_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_075275308.1|892173_893016_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_027242817.1|893071_894052_+	iron-siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_017377453.1|894032_896030_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_027242818.1|896047_897223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875989.1|897504_898908_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242819.1|899056_899419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377447.1|899590_899809_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_027242820.1|900354_902382_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_017377445.1|902463_903714_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377444.1|904013_904349_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_016211283.1|904660_904909_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_017377443.1|904944_905454_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_017377442.1|905453_906233_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_017377441.1|906250_906598_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_017377440.1|906707_906983_+	hypothetical protein	NA	A0A1B0Z0G5	Vibrio_phage	50.6	6.6e-13
WP_080963600.1|907144_907501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036816484.1|907899_908235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875990.1|908439_909216_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420664.1|909172_910045_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.8e-49
WP_017376231.1|910329_910617_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_080999985.1|910700_911420_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275310.1|911550_912159_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036773116.1|912964_913939_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_051929549.1|914018_914396_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027242786.1|914494_915586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856757.1|917258_917756_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875992.1|917900_918299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420665.1|918384_919290_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.5	1.3e-49
WP_047927606.1|919508_919829_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	36.6	3.1e-06
WP_036773204.1|919910_920684_-	DUF2807 domain-containing protein	NA	NA	NA	NA	NA
WP_027242597.1|921260_922094_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_144420786.1|922123_922978_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_144420667.1|923354_924365_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.5	2.5e-25
WP_017377585.1|924509_924767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875994.1|924880_926137_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|926392_926572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377584.1|927065_927308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377583.1|927333_928692_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.9	3.1e-71
WP_026063647.1|928973_929333_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_017377580.1|929764_931399_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.5	1.7e-143
WP_017377579.1|931405_932242_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.3	1.7e-51
WP_017377578.1|932263_933541_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	60.9	9.6e-139
WP_017377577.1|933627_933945_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_017377576.1|933967_935059_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_017377575.1|935249_936839_+	APC family permease	NA	NA	NA	NA	NA
WP_017377574.1|936899_937673_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	52.4	6.5e-66
WP_017377573.1|937843_938893_+	RNA polymerase sigma factor RpoS	NA	M4SMP8	Cyanophage	30.8	1.7e-29
WP_036816899.1|939621_939813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772584.1|940642_941419_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420668.1|941619_941931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875874.1|942023_942989_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275315.1|944200_944455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420669.1|944861_945104_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875996.1|945116_945992_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036816928.1|946318_946759_-	universal stress protein	NA	NA	NA	NA	NA
WP_081000007.1|948342_948747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999986.1|948908_949106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|949309_950284_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_017377185.1|950632_951571_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027242821.1|951634_953629_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_026063604.1|953631_954228_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_017377182.1|954224_954563_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_036774017.1|954952_955828_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1014163	1029734	3187888	transposase	unidentified_phage(25.0%)	15	NA	NA
WP_048876002.1|1014163_1015147_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.0	4.5e-27
WP_087910642.1|1015946_1017100_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	6.8e-59
WP_048876004.1|1017221_1017914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242833.1|1017922_1019110_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	34.3	5.2e-22
WP_017376484.1|1019259_1019886_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.3	1.2e-33
WP_017376485.1|1019931_1021161_+	hypothetical protein	NA	B2YG43	Musca_hytrovirus	21.9	2.6e-08
WP_144420789.1|1021355_1021802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376487.1|1021993_1023352_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_075275317.1|1024017_1024191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876005.1|1024320_1025238_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	32.4	4.6e-26
WP_053093673.1|1025579_1026239_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420674.1|1026319_1026823_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.7	3.0e-19
WP_017376491.1|1026795_1027083_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771628.1|1027375_1028497_-	calcium:proton antiporter	NA	NA	NA	NA	NA
WP_036771330.1|1028759_1029734_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 13
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1044721	1233859	3187888	integrase,tRNA,transposase,protease	Staphylococcus_phage(17.07%)	170	1064904:1064963	1092369:1093363
WP_036771330.1|1044721_1045696_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420675.1|1045771_1046089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275321.1|1046092_1046461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243029.1|1047194_1048163_-	threonine/serine dehydratase	NA	NA	NA	NA	NA
WP_027243028.1|1048372_1049785_-	MFS transporter	NA	NA	NA	NA	NA
WP_017375994.1|1049972_1050686_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	1.7e-36
WP_017375995.1|1050706_1051120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375996.1|1051220_1052294_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_027243027.1|1052430_1053330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772860.1|1053585_1053837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243025.1|1053885_1054521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772872.1|1054645_1055503_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_048876031.1|1055690_1057094_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_047927520.1|1057269_1057773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377328.1|1057849_1059151_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.3	8.2e-29
WP_027243024.1|1059319_1060420_+	carbohydrate kinase family protein	NA	NA	NA	NA	NA
WP_027243023.1|1060770_1061013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772851.1|1061006_1061324_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082300723.1|1062546_1062774_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036774927.1|1063384_1063855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212018.1|1064077_1064377_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_047927838.1|1064373_1064619_-	hypothetical protein	NA	NA	NA	NA	NA
1064904:1064963	attL	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGAT	NA	NA	NA	NA
WP_144420679.1|1064911_1065868_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375591.1|1066152_1066356_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_065653736.1|1066486_1067515_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_047927336.1|1067878_1068124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971648.1|1068486_1069461_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.6	4.7e-29
WP_075275420.1|1070932_1072639_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_036773893.1|1072684_1073536_-	DUF4402 domain-containing protein	NA	NA	NA	NA	NA
WP_146619459.1|1073738_1076195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420677.1|1076714_1077116_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|1077702_1078677_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378512.1|1078717_1080046_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_016211143.1|1080309_1080879_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	39.5	7.3e-30
WP_017378513.1|1080894_1081206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378514.1|1081215_1082184_-	ferrochelatase	NA	NA	NA	NA	NA
WP_016211147.1|1082316_1082670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378515.1|1082673_1083738_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_017378516.1|1083738_1085478_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	31.2	5.8e-54
WP_017378517.1|1085484_1085907_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_017378518.1|1085890_1086520_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_075275322.1|1086755_1086854_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_047927346.1|1086886_1088758_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_048876007.1|1088905_1089880_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_017378522.1|1089923_1090103_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243017.1|1090276_1091620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420679.1|1092376_1093333_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	39.0	3.6e-50
WP_017375696.1|1093659_1094043_+	hypothetical protein	NA	NA	NA	NA	NA
1092369:1093363	attR	TGTTCTGGTCAAGTCATATTGGACACTTTTAATTGAGACTTTTCAAAATTAATAGGCGATAGGTTACCATTGGCTGTATGCAACCGATCATGATTGTAATATCGAATATAGGCCTCAACATCCTCCTTCATAGTATCACGGGTTAAGTGAATCACATTCAACAGCCATTCGTGCTTTAGGCTGCCAAAAAAACGCTCGACAACCGCATTGTCAACGCAAGCACCGACACTGCTCATAGAAGCGGTGATTTTATGCTTCTTCAACAGTTTTCGATATTTTTTACTGGTATACTGCGAACCACGATCACTGTGAAATAACAAGTGTTCTGTCGGCTGCCGCAAGTGAATCGCCATATCCATTGCACGACAAACTAGATTTTCGCTCATTCTCTTATTCATCGCCCAGCCAATCACTTTTCGAGAGTATAAATCAATAACGACCGCAAGATACAACCAGCCTTCAGCAGTTCTAAGGTAGGTAATGTCACCTGCCCATGAGTGATTTGCAATGACTGGATTAAACTGCTGATTCAATACGTTATCTGCAACAGCGTGATGGTGCTTACGCTTAGTTGTCACTTTATAAGCTTTACGTTGCAGCACCTTTAAACCGAGTTTTTGCATTAGGCTTCTCGCCCGATAACGGCCTACTTGAAAGCCTTCTTCTTGAAGTTTATATGCCATCATTCGTGATCCTAAGCTGCCGCGACTTTCTTTAAAAAGCTCCTTACAGCGCCGATAAAGCTGAAGCTCTTCAATTGAAATCACTTTAGCAGGCCGCTTGTCCCAAGCATAAAAGGCAGAACGGCTTACCTTCATCACTTTACAGGTCAGATTAATAGGATATAACACTTTGTTCTTCCGAATAAAATTAAATTTTACTTCATTTCTTTCGCGAAGAAGGCACTCGCCTTTTTTAAAATTTCTTTCTCCATCTGCAGTTGCTTTACTTTCTTTCGCAGGGATTGAAGCTCAGCCTTTTCATCAGGAGTCAGA	NA	NA	NA	NA
WP_144420680.1|1094058_1094979_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_036774017.1|1095294_1096170_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1096171_1096336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774017.1|1096626_1097502_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046590.1|1097503_1097668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420681.1|1097847_1098033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876008.1|1098076_1099051_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.6	8.1e-29
WP_027242577.1|1099047_1100349_-	ComEC/Rec2 family competence protein	NA	NA	NA	NA	NA
WP_027242578.1|1100366_1100903_+	DUF2062 domain-containing protein	NA	NA	NA	NA	NA
WP_017376785.1|1101365_1102271_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_144420682.1|1103677_1103839_+	phosphatase	NA	NA	NA	NA	NA
WP_155046588.1|1104373_1104583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243099.1|1105698_1107012_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	7.7e-51
WP_027243098.1|1107247_1108393_+	carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_155049745.1|1108467_1108644_+	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_027243096.1|1108679_1109312_-	MarC family protein	NA	NA	NA	NA	NA
WP_144420683.1|1109488_1110145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243095.1|1110133_1112419_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376797.1|1112692_1113052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376798.1|1113333_1113969_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017376801.1|1115156_1115981_+	hypothetical protein	NA	X2KR27	Campylobacter_phage	28.3	6.2e-06
WP_144420791.1|1116036_1117248_-	protein kinase	NA	NA	NA	NA	NA
WP_027243094.1|1118031_1118739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619422.1|1118801_1118981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243093.1|1119042_1119360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376807.1|1119472_1120216_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_017376808.1|1120229_1121273_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_017376809.1|1121411_1123181_-|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	40.7	4.9e-08
WP_048876146.1|1123405_1124539_-	MFS transporter	NA	S4TR35	Salmonella_phage	23.0	2.6e-15
WP_026063564.1|1125388_1128208_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.3	5.2e-312
WP_017376814.1|1128582_1129308_+	single-stranded DNA-binding protein	NA	A0A2I7QWB5	Vibrio_phage	65.6	6.2e-42
WP_081377820.1|1131902_1132463_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	47.2	1.6e-37
WP_051929542.1|1132667_1133000_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017376231.1|1133059_1133347_-|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_048876009.1|1133999_1135025_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1135152_1136127_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027243041.1|1136321_1137275_-	chemotaxis protein CheV	NA	NA	NA	NA	NA
WP_144420684.1|1137444_1137693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420792.1|1137875_1138400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376827.1|1138854_1139682_+	DsbA family protein	NA	NA	NA	NA	NA
WP_144420685.1|1139750_1139936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376828.1|1140136_1140595_+	amino acid permease	NA	NA	NA	NA	NA
WP_017376829.1|1140735_1140963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876010.1|1141127_1142513_-	protein kinase family protein	NA	A0A1M7XTW9	Cedratvirus	27.7	1.4e-05
WP_017376830.1|1142808_1143123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243043.1|1143231_1144857_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	25.3	3.9e-28
WP_017376832.1|1145269_1146259_-	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_016212182.1|1146580_1146766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376833.1|1147155_1149111_+	transglycosylase SLT domain-containing protein	NA	K4NWI2	Pseudomonas_phage	39.7	9.2e-16
WP_080963614.1|1149182_1149305_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1149347_1150322_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017378302.1|1150544_1151006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378301.1|1151390_1152188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772310.1|1152653_1154459_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.9	5.8e-57
WP_027243044.1|1154546_1155893_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_075275422.1|1158530_1158962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772316.1|1159113_1159857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377201.1|1161504_1161975_-	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_017377202.1|1162536_1163139_+	short chain dehydrogenase	NA	NA	NA	NA	NA
WP_027243048.1|1163908_1165396_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_017377206.1|1165457_1166915_+	hypothetical protein	NA	A0A1C3NFI8	Phage_NCTB	24.8	4.3e-10
WP_065653751.1|1166951_1167416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243049.1|1167443_1168022_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	37.7	2.3e-15
WP_017377209.1|1168292_1170110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876011.1|1170086_1171136_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772296.1|1171335_1171713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376231.1|1172902_1173190_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_036773200.1|1173249_1173546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420686.1|1173690_1174347_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.8	4.7e-41
WP_017377324.1|1174586_1174967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1175618_1177022_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_087910660.1|1177018_1177300_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876013.1|1177694_1178159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927610.1|1178339_1178933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876007.1|1179118_1180093_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	2.1e-29
WP_051929845.1|1180496_1181321_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027243222.1|1181395_1182544_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_027243221.1|1182559_1184188_-	cytochrome d terminal oxidase subunit I	NA	NA	NA	NA	NA
WP_017375698.1|1184531_1185725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063486.1|1191839_1192340_+	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
WP_155046587.1|1192753_1192894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772592.1|1193016_1194477_-	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	33.4	2.3e-56
WP_026063485.1|1194554_1195037_-	DUF4442 domain-containing protein	NA	NA	NA	NA	NA
WP_017375881.1|1195195_1196461_+	sodium:proton antiporter	NA	A0A2H4J178	uncultured_Caudovirales_phage	42.8	1.2e-48
WP_027243180.1|1196545_1197805_+	phosphoesterase	NA	NA	NA	NA	NA
WP_017375878.1|1197876_1198149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876014.1|1198486_1198822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375877.1|1199182_1199431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876016.1|1199701_1200112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875984.1|1200256_1200793_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420687.1|1200803_1200989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376772.1|1201424_1202396_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243181.1|1202377_1203349_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_144420793.1|1203462_1204236_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017376768.1|1204506_1204836_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876149.1|1205091_1205610_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1205662_1205890_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420688.1|1206871_1207747_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929549.1|1207938_1208316_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_048876011.1|1208875_1209925_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017376108.1|1210238_1211624_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.7	3.4e-49
WP_017376107.1|1211630_1213169_-|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	22.4	2.6e-05
WP_017376106.1|1213211_1213937_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_017376105.1|1214107_1215340_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.2	8.9e-33
WP_017376104.1|1215539_1216361_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_017376103.1|1216410_1217220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876018.1|1217375_1221242_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	26.5	1.6e-51
WP_017376100.1|1221407_1222283_+	ParA family protein	NA	NA	NA	NA	NA
WP_075275424.1|1222347_1222626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420689.1|1222770_1223346_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_017376099.1|1223394_1223553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929528.1|1224301_1225018_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063521.1|1226146_1226563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420690.1|1227477_1228407_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.9	2.2e-60
WP_144420691.1|1228378_1228537_+	phosphatase	NA	NA	NA	NA	NA
WP_017376276.1|1228685_1229000_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.5	6.9e-06
WP_026063520.1|1229909_1230893_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	32.7	1.3e-34
WP_017376274.1|1231043_1231391_+	arsenate reductase (glutaredoxin)	NA	NA	NA	NA	NA
WP_017376273.1|1231390_1231990_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075275328.1|1232364_1232703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420692.1|1232521_1232911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876152.1|1232914_1233859_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1252826	1386196	3187888	transposase	Staphylococcus_phage(28.57%)	113	NA	NA
WP_036772026.1|1252826_1253702_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376663.1|1253739_1254654_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027242913.1|1254718_1255348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376662.1|1255392_1255827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376661.1|1255807_1256548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376660.1|1256561_1257959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242914.1|1257961_1260910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772028.1|1260909_1262631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242917.1|1262645_1263050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376655.1|1263050_1265930_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_075275426.1|1265932_1266655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971655.1|1267016_1268909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376650.1|1268940_1271481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242920.1|1271512_1272676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242921.1|1272681_1273305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242922.1|1273319_1274819_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_036772036.1|1274835_1275342_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_075275427.1|1276597_1276669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275333.1|1276851_1277034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971656.1|1278235_1278508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420695.1|1278523_1279957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420696.1|1280101_1281367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242924.1|1281652_1283404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242925.1|1283416_1284580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420697.1|1284583_1284880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1284919_1285147_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_036771639.1|1287015_1287990_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_081000010.1|1288048_1288312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420643.1|1288321_1289635_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_155046586.1|1289839_1290013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420794.1|1290080_1290224_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_027243218.1|1290242_1290440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772025.1|1290457_1290964_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_036772663.1|1291886_1292762_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242571.1|1292827_1293076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378158.1|1293241_1296322_-	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017378159.1|1296339_1297392_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017378160.1|1297915_1298566_+	porin family protein	NA	NA	NA	NA	NA
WP_017378161.1|1298899_1299544_+	porin family protein	NA	NA	NA	NA	NA
WP_017378162.1|1299882_1300422_+	porin family protein	NA	NA	NA	NA	NA
WP_144420698.1|1300936_1301098_+	phosphatase	NA	NA	NA	NA	NA
WP_075275334.1|1301246_1301540_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017377970.1|1302314_1302506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377969.1|1302554_1302794_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_144420699.1|1303129_1303459_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_026063694.1|1303548_1304133_-	superoxide dismutase	NA	NA	NA	NA	NA
WP_017377966.1|1304268_1304955_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	36.0	2.8e-28
WP_027242960.1|1305078_1306263_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377963.1|1306478_1307921_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	24.2	3.5e-20
WP_027242961.1|1308060_1309011_+	DMT family transporter	NA	NA	NA	NA	NA
WP_048876021.1|1309109_1309883_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_017377960.1|1309886_1310636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242963.1|1310708_1312178_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_027242964.1|1312492_1313065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036773041.1|1313173_1314673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242965.1|1314994_1317427_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_017377953.1|1317995_1319192_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_017377952.1|1319239_1321606_-	3-hydroxyacyl-CoA dehydrogenase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_144420700.1|1322230_1322380_+	phosphatase	NA	NA	NA	NA	NA
WP_048876022.1|1322517_1323369_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_087910645.1|1323781_1324935_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
WP_048876023.1|1325025_1326129_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	8.0e-25
WP_017375861.1|1326468_1326969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016211829.1|1327665_1328019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375862.1|1328319_1330047_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_047927270.1|1330150_1330876_-	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	38.7	6.4e-31
WP_017375864.1|1330868_1332107_-	lipoprotein-releasing ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375865.1|1332244_1333282_+	agmatine deiminase family protein	NA	NA	NA	NA	NA
WP_017375866.1|1333336_1334239_+	carbon-nitrogen hydrolase	NA	M1HCD5	Acanthocystis_turfacea_Chlorella_virus	40.7	3.2e-56
WP_017375867.1|1334348_1335602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242968.1|1335659_1339151_+	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_144420795.1|1339267_1339945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375871.1|1340072_1340621_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_048875857.1|1340845_1341820_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	2.8e-29
WP_017375873.1|1342491_1342653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063558.1|1343844_1344411_-	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	77.8	2.8e-74
WP_087910646.1|1344413_1345538_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_026063557.1|1345622_1346441_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_027242970.1|1346571_1348551_+	sodium:proton exchanger	NA	NA	NA	NA	NA
WP_017376714.1|1348610_1349264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999995.1|1349948_1351319_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376707.1|1353034_1353682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376706.1|1353719_1354112_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017376705.1|1354364_1355111_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_027243123.1|1355709_1356615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1356730_1357705_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376701.1|1357850_1358579_-	peptidoglycan editing factor PgeF	NA	NA	NA	NA	NA
WP_017376700.1|1358698_1359280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243124.1|1359302_1362143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376696.1|1364185_1365136_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_017376695.1|1365218_1366001_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_027243125.1|1366099_1366393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376693.1|1366915_1367560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376692.1|1367593_1368238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376691.1|1368286_1369141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376690.1|1369278_1369791_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_107517381.1|1369858_1370053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376688.1|1370266_1370620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1371828_1372803_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376683.1|1373550_1374252_-	cyclase family protein	NA	NA	NA	NA	NA
WP_087910647.1|1374326_1374986_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_026063554.1|1375123_1376380_+	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_017376681.1|1376654_1377317_+	HAD-IB family phosphatase	NA	NA	NA	NA	NA
WP_017376680.1|1377306_1378539_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.3	8.2e-95
WP_027243127.1|1378670_1379288_+	VOC family protein	NA	NA	NA	NA	NA
WP_036773258.1|1379365_1379872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1379882_1380110_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_048876026.1|1381392_1381659_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420796.1|1381888_1383007_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774270.1|1383151_1383487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929523.1|1383497_1383911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375562.1|1385119_1385284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|1385320_1386196_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1395624	1521003	3187888	tRNA,transposase	Staphylococcus_phage(23.53%)	109	NA	NA
WP_048876030.1|1395624_1396728_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772169.1|1396797_1397673_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_047927184.1|1397669_1398014_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963581.1|1398023_1398485_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_027242985.1|1398498_1399890_-	flagellar hook-associated protein 3	NA	NA	NA	NA	NA
WP_027242986.1|1399931_1402919_-	flagellar hook-associated protein FlgK	NA	NA	NA	NA	NA
WP_027242987.1|1402988_1403822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910648.1|1403876_1405064_-	flagellar basal body P-ring protein FlgI	NA	NA	NA	NA	NA
WP_027242989.1|1405051_1405756_-	flagellar basal body L-ring protein FlgH	NA	NA	NA	NA	NA
WP_027242990.1|1405801_1406587_-	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_027242991.1|1406614_1407352_-	flagellar basal body rod protein FlgF	NA	NA	NA	NA	NA
WP_016210285.1|1407456_1409652_-	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_027242992.1|1409726_1410410_-	flagellar hook assembly protein FlgD	NA	NA	NA	NA	NA
WP_027242993.1|1410420_1410852_-	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_027242994.1|1410897_1411296_-	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_027242995.1|1411672_1412380_+	flagellar basal body P-ring formation protein FlgA	NA	NA	NA	NA	NA
WP_027242996.1|1412444_1412741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146619421.1|1412779_1413259_+	flagellar protein FlgN	NA	NA	NA	NA	NA
WP_027242998.1|1413312_1413834_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	53.4	3.8e-25
WP_027242999.1|1413915_1415010_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_048876031.1|1415976_1417380_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375890.1|1417549_1418113_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375891.1|1418248_1419724_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_017375892.1|1419730_1419937_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_017375893.1|1419994_1421065_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243001.1|1421262_1423233_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	36.9	7.2e-77
WP_017375757.1|1423593_1425153_+	APC family permease	NA	NA	NA	NA	NA
WP_144420701.1|1425749_1426106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243002.1|1426946_1427606_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027243003.1|1427701_1429063_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_017377787.1|1429204_1429432_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375762.1|1430483_1431824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963648.1|1432474_1432636_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036815628.1|1432735_1433563_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_144420702.1|1433916_1434792_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	33.3	1.4e-19
WP_036771330.1|1434835_1435810_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_047927692.1|1435829_1436018_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242753.1|1436662_1437205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242754.1|1437485_1437839_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_027242755.1|1437831_1438977_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_027242756.1|1439387_1440635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242757.1|1440772_1441156_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_027242758.1|1441152_1441884_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_027242759.1|1441886_1442630_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_144420798.1|1442643_1443543_-	GTPase Era	NA	NA	NA	NA	NA
WP_027242761.1|1443548_1444223_-	ribonuclease III	NA	E5EQH1	Micromonas_sp._RCC1109_virus	33.2	2.2e-25
WP_036771308.1|1444385_1444607_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087910649.1|1444634_1445576_-	signal peptidase I	NA	NA	NA	NA	NA
WP_027242763.1|1445572_1447375_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	25.1	5.1e-21
WP_027242764.1|1447684_1448254_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_027242765.1|1448408_1449983_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_155052681.1|1449990_1450344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242767.1|1450429_1450675_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_080963649.1|1450716_1451754_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_027242769.1|1451900_1452227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155082328.1|1452236_1452374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242770.1|1452383_1452794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420703.1|1452936_1453260_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_062365727.1|1453520_1454213_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017375561.1|1454209_1454353_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377787.1|1455696_1455924_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_017375766.1|1457230_1459261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375767.1|1459327_1460353_-	FUSC family protein	NA	NA	NA	NA	NA
WP_027242772.1|1460345_1461392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771312.1|1461532_1462528_+	glycosyl hydrolase family 17	NA	NA	NA	NA	NA
WP_048876036.1|1462825_1463464_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	2.1e-09
WP_017375978.1|1464177_1465365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375977.1|1465530_1466484_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036771316.1|1466506_1468525_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_017375975.1|1468613_1468937_-	YqcC family protein	NA	NA	NA	NA	NA
WP_155046584.1|1469185_1469362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053093677.1|1469589_1470309_+|transposase	IS982-like element ISPsa1 family transposase	transposase	NA	NA	NA	NA
WP_016209463.1|1470924_1471308_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_048876037.1|1471952_1472426_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_027242774.1|1472531_1473902_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_048876038.1|1474017_1474749_+	hypothetical protein	NA	M1IDP9	Pelagibacter_phage	35.8	9.1e-09
WP_027242775.1|1474773_1475871_-	alanine racemase	NA	NA	NA	NA	NA
WP_048876039.1|1475906_1477325_-	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	62.1	2.0e-153
WP_027242777.1|1477534_1477987_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_016209480.1|1477998_1478226_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_027242778.1|1478275_1478602_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_027242779.1|1478805_1479495_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036771340.1|1479643_1480132_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_027242781.1|1480172_1481276_-	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_027242782.1|1481318_1482401_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	42.4	4.5e-73
WP_080963651.1|1482393_1482954_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771345.1|1482944_1484249_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_146619547.1|1484302_1484902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|1484903_1485881_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929890.1|1485899_1486448_-	chorismate mutase	NA	NA	NA	NA	NA
WP_027242785.1|1486472_1487489_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_051929892.1|1487921_1491044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929877.1|1491440_1492064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378208.1|1492846_1494397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378207.1|1494691_1495447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1496155_1497130_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017378201.1|1500038_1500710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|1501788_1503192_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242788.1|1504779_1508181_-	AAA family ATPase	NA	S5M596	Bacillus_phage	23.3	4.5e-10
WP_017378193.1|1508177_1510871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378192.1|1511174_1512674_+	sugar porter family MFS transporter	NA	O13311	Aichi_virus	28.1	2.2e-33
WP_027242789.1|1513340_1514162_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_146619408.1|1514233_1514719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1514867_1516271_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017378188.1|1516267_1517338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242790.1|1517583_1519758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378184.1|1519780_1520461_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_144420705.1|1520489_1520690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1520775_1521003_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 16
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1532039	1598942	3187888	transposase	Acinetobacter_phage(25.0%)	59	NA	NA
WP_075275340.1|1532039_1532648_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048875904.1|1533178_1534054_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929548.1|1534294_1534969_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_080999996.1|1534997_1535486_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	30.9	7.4e-15
WP_080999997.1|1536531_1536966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1537171_1538254_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875941.1|1538250_1538562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927811.1|1538809_1540321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876046.1|1541281_1541575_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	36.4	4.1e-05
WP_144420706.1|1541532_1542111_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.8	1.1e-28
WP_048876047.1|1542196_1543072_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378015.1|1543064_1543421_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	52.0	3.5e-22
WP_017378014.1|1543429_1543825_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_082300708.1|1545149_1545710_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876048.1|1546832_1548722_-	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_027243106.1|1548756_1549962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420707.1|1549964_1551263_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243104.1|1551243_1552467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243103.1|1552516_1553317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377848.1|1553313_1553712_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_027243102.1|1553708_1554017_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_017377694.1|1554410_1555139_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377851.1|1555179_1555824_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377852.1|1555836_1556304_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|1556358_1557333_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080963625.1|1557362_1557980_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_017377855.1|1557958_1558420_-	DUF4381 domain-containing protein	NA	NA	NA	NA	NA
WP_017377856.1|1558463_1559399_-	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_017377857.1|1559426_1560422_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_017377858.1|1560635_1561598_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_017377694.1|1562737_1563466_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_080963626.1|1563516_1565151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377862.1|1565421_1566609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377863.1|1567210_1567648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377865.1|1570181_1570454_+	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_036772457.1|1570529_1570838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772454.1|1573313_1573631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1573787_1574762_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_144420708.1|1574758_1575148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876052.1|1575228_1575975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|1575943_1576672_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	41.8	1.1e-43
WP_017377223.1|1577416_1577704_+|transposase	IS3 family transposase	transposase	A9YX41	Burkholderia_phage	37.2	2.2e-06
WP_155046582.1|1577763_1577928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876053.1|1577924_1579328_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420658.1|1579360_1580122_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	42.3	6.9e-44
WP_017376296.1|1580407_1581124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876055.1|1581901_1582807_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376294.1|1583293_1584586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376293.1|1584821_1587572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242868.1|1589210_1589678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376289.1|1589678_1590380_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420801.1|1590641_1590824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773579.1|1591077_1591452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420802.1|1591561_1593553_-	flavohemoglobin expression-modulating QEGLA motif protein	NA	NA	NA	NA	NA
WP_016211518.1|1593542_1594589_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376284.1|1595029_1595881_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	2.7e-12
WP_017376283.1|1595881_1596799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046581.1|1597194_1597368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771957.1|1597970_1598942_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1607037	1658826	3187888	tRNA,transposase,protease	Burkholderia_virus(22.22%)	47	NA	NA
WP_036771330.1|1607037_1608012_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_080999998.1|1608278_1608548_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420803.1|1608692_1609649_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963583.1|1609809_1610736_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_027242871.1|1611031_1611793_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_016211971.1|1611994_1612606_-	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_051929560.1|1612626_1613826_-	site-specific DNA-methyltransferase	NA	A0A2L1IZ21	Streptomyces_phage	33.2	2.7e-42
WP_017377024.1|1613920_1614061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377023.1|1614073_1614478_-	SufE family protein	NA	NA	NA	NA	NA
WP_017377022.1|1614708_1615278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377021.1|1615344_1616385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377787.1|1616411_1616639_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_027242872.1|1617689_1618547_-	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_017377019.1|1618543_1619389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242873.1|1619389_1622119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875904.1|1622252_1623128_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027242874.1|1623392_1624367_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_016209885.1|1624795_1625509_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_027242875.1|1625677_1626169_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_017377014.1|1626308_1626800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242876.1|1627002_1627893_+	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_026063591.1|1628277_1628862_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_027242877.1|1628942_1629881_-	signal peptide peptidase SppA	NA	A0A2I6UGK8	Salinibacter_virus	30.1	4.9e-15
WP_036771855.1|1629932_1631027_-	fusaric acid resistance family protein	NA	NA	NA	NA	NA
WP_047927528.1|1631151_1632474_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	39.9	7.3e-65
WP_017377008.1|1632521_1637408_-	NAD-glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_017377007.1|1637502_1637805_-	DUF2835 family protein	NA	NA	NA	NA	NA
WP_027242879.1|1637915_1639838_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_027242880.1|1639859_1641155_+	YeaH/YhbH family protein	NA	A0A219UQP6	Bacillus_phage	32.8	1.2e-06
WP_017377006.1|1641151_1642762_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_052106204.1|1642868_1643762_-	thiol:disulfide interchange protein DsbG	NA	NA	NA	NA	NA
WP_017377003.1|1643871_1644495_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_017377001.1|1645201_1645900_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_017377000.1|1646043_1646613_-	outer membrane beta-barrel protein	NA	NA	NA	NA	NA
WP_026063589.1|1646928_1647555_-	porin family protein	NA	NA	NA	NA	NA
WP_017376998.1|1647751_1648498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376997.1|1648593_1649433_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	I6XGV6	Vibriophage	35.3	1.0e-32
WP_016210463.1|1649483_1649831_-	cupin domain-containing protein	NA	A0A1V0SH58	Hokovirus	42.1	9.2e-20
WP_017376996.1|1650021_1650909_+	ROK family protein	NA	NA	NA	NA	NA
WP_017376995.1|1651023_1651626_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_017376994.1|1651622_1652342_-	TIGR00266 family protein	NA	NA	NA	NA	NA
WP_080963631.1|1652410_1654123_-	ABC transporter ATP-binding protein/permease	NA	NA	NA	NA	NA
WP_017376991.1|1654270_1656208_+	AsmA family protein	NA	NA	NA	NA	NA
WP_027242882.1|1656320_1657370_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_017376990.1|1657369_1657645_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_017376989.1|1657725_1658274_+	DUF2147 domain-containing protein	NA	NA	NA	NA	NA
WP_017377787.1|1658598_1658826_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
>prophage 18
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1683720	1728156	3187888	transposase	Staphylococcus_phage(50.0%)	41	NA	NA
WP_036771330.1|1683720_1684695_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046579.1|1685010_1685172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|1685168_1686572_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377823.1|1686685_1687453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_062365735.1|1687811_1689215_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080963604.1|1690035_1690236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377826.1|1690476_1691922_+	MFS transporter	NA	NA	NA	NA	NA
WP_048875904.1|1693117_1693993_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_027243174.1|1695444_1695726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046578.1|1695944_1696124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927196.1|1696283_1697303_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_017376520.1|1697289_1697712_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_017376521.1|1697713_1698187_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	43.4	2.4e-26
WP_017376522.1|1698312_1698969_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.2	6.8e-40
WP_017376523.1|1698965_1699640_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	37.7	6.0e-31
WP_017376524.1|1699645_1700794_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.8	4.7e-44
WP_017376525.1|1700790_1701252_-	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_017376526.1|1701327_1702578_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.4	2.4e-102
WP_017376527.1|1702704_1704384_+	energy-dependent translational throttle protein EttA	NA	A0A2K9L3Z8	Tupanvirus	26.6	3.0e-39
WP_027243172.1|1704495_1705377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772261.1|1706619_1707213_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075275347.1|1707574_1708090_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375618.1|1709029_1709314_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420804.1|1709863_1710139_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771330.1|1710511_1711486_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242983.1|1711642_1712281_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_017377745.1|1712362_1712761_-	VOC family protein	NA	NA	NA	NA	NA
WP_017377746.1|1712913_1713231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377747.1|1713309_1713564_-	LapA family protein	NA	NA	NA	NA	NA
WP_017377748.1|1713716_1715378_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_017377749.1|1715438_1716122_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_036773645.1|1716121_1717207_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	43.3	9.8e-76
WP_017377751.1|1717248_1719885_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	32.6	6.9e-99
WP_155051395.1|1720864_1721008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377754.1|1721689_1723009_+	TRZ/ATZ family hydrolase	NA	NA	NA	NA	NA
WP_017377755.1|1723012_1723729_+	bifunctional 2-polyprenyl-6-hydroxyphenol methylase/3-demethylubiquinol 3-O-methyltransferase UbiG	NA	NA	NA	NA	NA
WP_017377756.1|1723725_1724367_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_144420715.1|1724359_1724494_+	VOC family protein	NA	NA	NA	NA	NA
WP_027242981.1|1724742_1725198_-	glyoxalase/bleomycin resistance protein/dioxygenase	NA	NA	NA	NA	NA
WP_027242980.1|1725289_1725634_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_048876031.1|1726752_1728156_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1783074	1829782	3187888	tRNA,transposase	Synechococcus_phage(20.0%)	41	NA	NA
WP_048875859.1|1783074_1783869_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_036773621.1|1784158_1785082_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_017377984.1|1785349_1785643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377983.1|1786845_1787769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377982.1|1787904_1788747_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_017377981.1|1788834_1789485_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	34.6	2.7e-20
WP_017377980.1|1789498_1790539_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	45.3	2.9e-69
WP_036773623.1|1790661_1791747_+	DUF2066 domain-containing protein	NA	NA	NA	NA	NA
WP_027243121.1|1791773_1792883_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_017377976.1|1793187_1793505_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377975.1|1793501_1793861_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_017377974.1|1793963_1796696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081000000.1|1798185_1798863_-	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_144420807.1|1799109_1799328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155048033.1|1799472_1800681_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_065653755.1|1801108_1802566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375695.1|1803401_1803677_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036773050.1|1806380_1806560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063690.1|1806556_1806928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420717.1|1806938_1808021_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420718.1|1808017_1808239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275437.1|1809224_1809443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016212534.1|1809933_1810200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420719.1|1810458_1810779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243154.1|1812164_1813415_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_017377905.1|1813403_1814285_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_017377906.1|1814277_1815363_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.2	4.3e-07
WP_017377907.1|1815359_1816619_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_017377908.1|1816787_1817447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653730.1|1817617_1818280_+	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_026063691.1|1818626_1819574_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	34.3	3.4e-40
WP_017377911.1|1819670_1820297_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_017377912.1|1820302_1820884_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_017377913.1|1820955_1822047_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_017377914.1|1822136_1822850_+	5'-methylthioadenosine/adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_027243155.1|1822943_1823768_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_144420808.1|1824001_1824679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377920.1|1826356_1826614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771639.1|1827014_1827989_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_048876067.1|1828163_1828808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046574.1|1828987_1829782_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1835477	1871756	3187888	transposase,protease	Acinetobacter_phage(25.0%)	34	NA	NA
WP_087910651.1|1835477_1835654_+|transposase	transposase	transposase	A4JX31	Burkholderia_virus	46.2	5.5e-05
WP_053856762.1|1835949_1836384_-	hypothetical protein	NA	A0A0P0IY73	Acinetobacter_phage	38.0	7.7e-16
WP_017377929.1|1836577_1838047_-	glycine dehydrogenase subunit 2	NA	M4QFZ1	Prochlorococcus_phage	41.7	2.7e-84
WP_027243054.1|1838040_1839417_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	34.6	4.2e-47
WP_017377930.1|1839429_1839822_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_017377931.1|1839818_1840922_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_144420809.1|1841100_1842393_-	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_017377933.1|1842403_1843351_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	37.6	3.5e-37
WP_027243055.1|1843362_1844175_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_087910662.1|1844177_1844957_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377934.1|1844971_1846030_-	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_017377935.1|1846026_1847037_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_016209904.1|1847043_1847241_-	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_048876070.1|1847301_1850208_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_017377937.1|1850249_1851101_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_144420810.1|1851183_1851729_-	chorismate lyase	NA	NA	NA	NA	NA
WP_027243057.1|1851826_1852687_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_027243058.1|1852778_1853195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377942.1|1853276_1853783_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_027243059.1|1853828_1856780_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017377945.1|1856801_1857134_+	GIY-YIG nuclease family protein	NA	D7F5V9	Apocheima_cinerarium_nucleopolyhedrovirus	34.2	4.7e-05
WP_047927125.1|1857251_1857761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155046571.1|1858294_1858450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774650.1|1859524_1860691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377687.1|1860835_1861588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1861943_1862918_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_016209908.1|1863050_1863761_+	response regulator	NA	W8CYM9	Bacillus_phage	34.8	2.2e-31
WP_017377690.1|1863757_1864792_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	34.2	1.3e-32
WP_017377691.1|1864895_1865237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876071.1|1865747_1866908_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_069971647.1|1866876_1867473_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046570.1|1868441_1868612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1868608_1869583_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_087910645.1|1870602_1871756_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.2	8.9e-59
>prophage 21
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1916887	1982786	3187888	tRNA,transposase,plate	Staphylococcus_phage(18.18%)	57	NA	NA
WP_027242858.1|1916887_1918195_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_027242859.1|1918199_1918910_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_027242860.1|1918922_1922093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242861.1|1922159_1923296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376336.1|1924158_1925016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376335.1|1925157_1925958_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_017376334.1|1926056_1926632_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	50.0	3.2e-57
WP_027242862.1|1926714_1927386_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_027242863.1|1927431_1928331_+	DUF3530 family protein	NA	NA	NA	NA	NA
WP_017376331.1|1928365_1928749_-	response regulator	NA	NA	NA	NA	NA
WP_080963653.1|1928898_1929729_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_017376329.1|1929653_1930364_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_017376328.1|1930360_1931386_-	phosphotransferase	NA	NA	NA	NA	NA
WP_048876074.1|1931516_1934021_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_017376325.1|1934027_1935296_+	peptidyl-prolyl cis-trans isomerase SurA	NA	NA	NA	NA	NA
WP_017376324.1|1935297_1936281_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_017376323.1|1936293_1937115_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_017376322.1|1937159_1937552_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_017376321.1|1937626_1938433_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	NA	NA	NA	NA
WP_036774104.1|1938620_1939049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|1939107_1940082_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017375660.1|1940105_1940543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|1940577_1941981_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376011.1|1942561_1942723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376015.1|1943943_1944315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242569.1|1944422_1945973_-	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_017376017.1|1946005_1946845_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017376018.1|1946841_1947357_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_017376019.1|1947360_1948353_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.1	9.3e-49
WP_017376020.1|1948731_1950102_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_027242570.1|1950310_1951450_+	hypothetical protein	NA	A0A0F6YPT7	Sinorhizobium_phage	41.7	9.3e-61
WP_062365741.1|1951663_1952266_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.0e-10
WP_036816881.1|1952949_1953168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155052676.1|1953206_1953494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772149.1|1959149_1959830_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_017376634.1|1959894_1961181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376633.1|1961782_1962052_-	RNA-binding protein	NA	NA	NA	NA	NA
WP_144420813.1|1962235_1963207_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	29.3	3.0e-15
WP_017376631.1|1963274_1964249_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.3	7.3e-14
WP_017376630.1|1964346_1965423_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_144420721.1|1965503_1966496_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_036772145.1|1966500_1968303_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_027243119.1|1968320_1969622_-	aspartate kinase	NA	NA	NA	NA	NA
WP_027243118.1|1969637_1970921_-	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_017376625.1|1971053_1971446_+	RidA family protein	NA	NA	NA	NA	NA
WP_017376624.1|1971552_1972638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376623.1|1972853_1973870_-	bifunctional UDP-4-keto-pentose/UDP-xylose synthase	NA	D5GW02	Campylobacter_virus	28.7	1.9e-12
WP_017376622.1|1973872_1974880_-	glycosyltransferase	NA	B9UDL7	Salmonella_phage	34.4	2.2e-37
WP_026063550.1|1974883_1976038_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	A0A2K9L0G1	Tupanvirus	33.0	3.9e-38
WP_016209558.1|1976052_1976415_-	small Multidrug Resistance family protein	NA	NA	NA	NA	NA
WP_027243117.1|1976411_1978127_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_026063546.1|1978226_1978901_+|tRNA	tRNA (guanosine(18)-2'-O)-methyltransferase TrmH	tRNA	NA	NA	NA	NA
WP_017376619.1|1978929_1979334_+	RidA family protein	NA	NA	NA	NA	NA
WP_027243116.1|1979358_1980318_-	response regulator	NA	NA	NA	NA	NA
WP_017376616.1|1980450_1981233_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275357.1|1981334_1982294_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	34.3	1.2e-13
WP_017376613.1|1982438_1982786_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	1986787	2050559	3187888	transposase	Planktothrix_phage(10.0%)	51	NA	NA
WP_144420814.1|1986787_1987705_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875984.1|1987849_1988386_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_051929685.1|1988645_1989548_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017376607.1|1990537_1991527_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G9BWD6	Planktothrix_phage	32.4	4.5e-19
WP_017376606.1|1991695_1992034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376605.1|1992030_1992606_+	ribonuclease HI	NA	M4QMN0	Micromonas_pusilla_virus	55.1	1.1e-33
WP_017376604.1|1992654_1992870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376603.1|1993056_1993896_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	1.4e-45
WP_017376601.1|1997592_1998501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875882.1|1998631_1999288_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_053856764.1|1999396_2000323_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036772137.1|2000641_2001202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377036.1|2001671_2002991_+	LbtU family siderophore porin	NA	NA	NA	NA	NA
WP_017377037.1|2003058_2003925_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	31.1	6.3e-25
WP_036772169.1|2003917_2004793_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377039.1|2004851_2005070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377041.1|2006470_2006800_-	Grx4 family monothiol glutaredoxin	NA	NA	NA	NA	NA
WP_017377043.1|2007718_2009947_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	34.8	1.7e-82
WP_017377044.1|2010209_2011223_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_017377045.1|2011331_2011553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377046.1|2011557_2013195_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.8	3.4e-88
WP_017377047.1|2013333_2013867_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_017377048.1|2013987_2015106_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_027242608.1|2015098_2016421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772661.1|2016407_2017544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377052.1|2017774_2018200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242609.1|2021529_2021883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2021917_2022793_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_051929903.1|2022949_2023354_-	heavy metal-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_051929897.1|2023501_2024677_-	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_027242610.1|2024936_2025440_-	peptide deformylase	NA	A0A1D8KUY1	Synechococcus_phage	33.1	2.1e-09
WP_017377059.1|2025479_2026964_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.0	8.5e-46
WP_017377060.1|2027187_2028141_+	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	2.9e-31
WP_027242611.1|2028121_2029213_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_027242612.1|2029515_2029758_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_155048025.1|2030658_2030844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377064.1|2030825_2031401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377065.1|2032275_2032548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377066.1|2032700_2032955_-	DUF493 domain-containing protein	NA	NA	NA	NA	NA
WP_027242613.1|2033069_2034473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377069.1|2034557_2035064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377070.1|2035628_2037449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242614.1|2037515_2038046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774569.1|2039592_2040309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774567.1|2040351_2040789_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017377073.1|2040826_2042206_-	MFS transporter	NA	NA	NA	NA	NA
WP_017377074.1|2042600_2044595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377075.1|2045059_2045872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420815.1|2046055_2047519_-	nuclease	NA	NA	NA	NA	NA
WP_017377077.1|2047878_2049258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772726.1|2050010_2050559_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.3	1.1e-06
>prophage 23
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	2082350	2125710	3187888	transposase	Staphylococcus_phage(22.22%)	42	NA	NA
WP_036773116.1|2082350_2083325_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971661.1|2083321_2083759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875878.1|2083933_2085337_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017377105.1|2085347_2085623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377106.1|2085900_2086371_-	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	36.6	6.0e-22
WP_017377107.1|2086673_2088044_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	1.5e-110
WP_075275363.1|2088373_2088841_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_017377110.1|2088853_2089864_-	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_053856766.1|2090065_2091469_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242632.1|2091895_2092684_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_047927448.1|2092670_2093699_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	1.4e-15
WP_017377113.1|2093676_2094081_-	glycine-rich domain-containing protein-like	NA	NA	NA	NA	NA
WP_017377115.1|2094308_2096276_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_017377116.1|2096471_2096963_+	copper chaperone PCu(A)C	NA	NA	NA	NA	NA
WP_026063598.1|2096997_2097840_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_017377118.1|2097885_2098338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377119.1|2098627_2099260_+	LysE family translocator	NA	NA	NA	NA	NA
WP_017377120.1|2099260_2100511_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.4	2.7e-93
WP_027242633.1|2100544_2101642_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	34.9	3.5e-49
WP_144420723.1|2101971_2103357_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036774495.1|2103396_2103654_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_053856767.1|2106069_2107473_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375801.1|2107469_2108510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927106.1|2108902_2109298_+	YchJ family protein	NA	NA	NA	NA	NA
WP_144420816.1|2109294_2110083_-	DUF45 domain-containing protein	NA	NA	NA	NA	NA
WP_017375804.1|2110268_2110994_-	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_017375805.1|2111238_2112426_+	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_017375806.1|2112718_2113261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375807.1|2113257_2113944_-	acireductone synthase	NA	NA	NA	NA	NA
WP_017375808.1|2113947_2114559_-	methylthioribulose 1-phosphate dehydratase	NA	NA	NA	NA	NA
WP_017375809.1|2114605_2115625_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_017375810.1|2115727_2116522_-	thymidylate synthase	NA	A0A2R4A1R4	Microbacterium_phage	69.0	1.1e-103
WP_017375811.1|2116535_2117336_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_017375812.1|2117414_2118464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063478.1|2118639_2119920_+	inorganic phosphate transporter	NA	E5ESL8	Bathycoccus_sp._RCC1105_virus	34.7	4.6e-24
WP_027242634.1|2119965_2120643_+	TIGR00153 family protein	NA	NA	NA	NA	NA
WP_017375815.1|2120728_2121010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075275366.1|2121101_2121956_-	MFS transporter	NA	NA	NA	NA	NA
WP_026063480.1|2121895_2122294_-	MFS transporter	NA	S4TR35	Salmonella_phage	31.4	1.2e-07
WP_027242636.1|2122821_2123763_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017375821.1|2124481_2124703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420724.1|2124699_2125710_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	2178403	2214343	3187888	transposase	Staphylococcus_phage(16.67%)	31	NA	NA
WP_053856766.1|2178403_2179807_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420729.1|2179926_2180565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774259.1|2180912_2181887_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_027242659.1|2182195_2183221_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	76.9	2.0e-17
WP_087910663.1|2183328_2184531_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	26.6	1.7e-36
WP_017377360.1|2184768_2185182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377358.1|2185683_2186253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377357.1|2186255_2186594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377356.1|2186586_2187120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377355.1|2187138_2187429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242660.1|2187515_2189147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377353.1|2189699_2190203_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	41.2	1.9e-13
WP_017377352.1|2190165_2190873_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_017377351.1|2190937_2191798_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_017377350.1|2191778_2192552_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017377349.1|2192582_2193821_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_036773024.1|2193820_2194783_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_017377348.1|2194826_2195579_+	ComF family protein	NA	NA	NA	NA	NA
WP_017377345.1|2198107_2198344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420819.1|2198362_2198812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377343.1|2199032_2200457_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	M4QSA2	Synechococcus_phage	42.3	1.0e-16
WP_052106221.1|2200521_2201571_-	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_036818827.1|2201861_2202593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420730.1|2202623_2203514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377336.1|2204856_2207667_+	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_048875864.1|2207959_2208985_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_080963630.1|2209368_2210226_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_017377694.1|2210395_2211124_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_048876012.1|2211324_2212728_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376920.1|2212873_2213371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875863.1|2213440_2214343_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	2237551	2277767	3187888	tRNA,transposase,protease	Staphylococcus_phage(42.86%)	44	NA	NA
WP_069971662.1|2237551_2238526_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	9.5e-30
WP_027242664.1|2238809_2240012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929598.1|2240308_2240566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275367.1|2240523_2240964_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_053856769.1|2241069_2241636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875862.1|2241780_2242035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875861.1|2242179_2243049_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_026063584.1|2243570_2244530_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_017376953.1|2244526_2245174_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_017376954.1|2245202_2246054_-	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_017376955.1|2246068_2247346_-	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	39.0	2.8e-66
WP_017376956.1|2247386_2247902_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376957.1|2247979_2249041_-	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_036818645.1|2249062_2250151_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_017376959.1|2250195_2252031_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_016210381.1|2252073_2252544_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_016210374.1|2252580_2252916_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_080963574.1|2252928_2253645_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_036772771.1|2253581_2254622_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_017376963.1|2254594_2255074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376964.1|2255160_2257641_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	43.8	3.8e-192
WP_036772765.1|2257703_2258135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376966.1|2258335_2258626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242666.1|2258685_2260284_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.1	7.1e-06
WP_017376969.1|2260448_2260784_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_017376970.1|2260812_2262477_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	E5ERK4	Ostreococcus_lucimarinus_virus	28.8	6.4e-34
WP_027242667.1|2262476_2263118_-	lipoprotein	NA	NA	NA	NA	NA
WP_017376972.1|2263117_2263861_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_017376973.1|2263919_2264156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376974.1|2264306_2265674_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	29.9	1.6e-43
WP_017376975.1|2265684_2266236_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_065653729.1|2266316_2267420_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_017376977.1|2267421_2269179_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062312189.1|2269401_2270025_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_016210574.1|2270079_2270499_-	prokaryotic dksA/traR C4-type zinc finger family protein	NA	NA	NA	NA	NA
WP_047927116.1|2270639_2271254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242668.1|2271311_2272097_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_017376980.1|2272728_2273745_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_144420820.1|2273747_2274260_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_017376982.1|2274301_2274775_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_048875860.1|2274830_2275616_-	DUF21 domain-containing protein	NA	NA	NA	NA	NA
WP_036771653.1|2275659_2276400_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	1.9e-09
WP_017376985.1|2276489_2276738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087910654.1|2277113_2277767_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	2365164	2477226	3187888	tRNA,transposase,protease	Staphylococcus_phage(12.5%)	103	NA	NA
WP_017378106.1|2365164_2366109_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_017378107.1|2366108_2366462_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_017378108.1|2366510_2369186_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.1	1.3e-25
WP_017378109.1|2369202_2370720_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_016209273.1|2370796_2371249_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_017378110.1|2371467_2372907_-	NADH-quinone oxidoreductase subunit NuoN	NA	NA	NA	NA	NA
WP_017378111.1|2372906_2374445_-	NADH-quinone oxidoreductase subunit M	NA	NA	NA	NA	NA
WP_017378112.1|2374459_2376430_-	NADH-quinone oxidoreductase subunit L	NA	NA	NA	NA	NA
WP_016209309.1|2376433_2376739_-	NADH-quinone oxidoreductase subunit NuoK	NA	NA	NA	NA	NA
WP_017378113.1|2376762_2377386_-	NADH-quinone oxidoreductase subunit J	NA	NA	NA	NA	NA
WP_017378114.1|2377405_2377894_-	NADH-quinone oxidoreductase subunit NuoI	NA	NA	NA	NA	NA
WP_027242679.1|2377907_2378933_-	NADH-quinone oxidoreductase subunit NuoH	NA	NA	NA	NA	NA
WP_017378117.1|2378937_2381331_-	NADH-quinone oxidoreductase subunit G	NA	NA	NA	NA	NA
WP_016209307.1|2381380_2382670_-	NADH-quinone oxidoreductase subunit NuoF	NA	NA	NA	NA	NA
WP_017378118.1|2382676_2383177_-	NAD(P)H-dependent oxidoreductase subunit E	NA	NA	NA	NA	NA
WP_017378119.1|2383176_2384430_-	NADH-quinone oxidoreductase subunit D	NA	NA	NA	NA	NA
WP_017378120.1|2384431_2385109_-	NADH-quinone oxidoreductase subunit C	NA	NA	NA	NA	NA
WP_016209262.1|2385126_2385612_-	NADH-quinone oxidoreductase subunit B	NA	NA	NA	NA	NA
WP_016209283.1|2385602_2385971_-	NADH-ubiquinone/plastoquinone oxidoreductase chain 3	NA	NA	NA	NA	NA
WP_017378122.1|2386649_2387012_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_017378123.1|2387025_2387787_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_017378124.1|2388088_2389435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771461.1|2389531_2390074_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	NA	NA	NA	NA
WP_017378126.1|2390189_2391023_+	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_027242680.1|2391044_2391638_+	thymidine kinase	NA	A0A0B7MRR0	Enterobacteria_phage	53.6	6.4e-53
WP_048875856.1|2391813_2392833_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017375571.1|2393103_2393505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378129.1|2393515_2393839_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_065653735.1|2393862_2394873_-	lipase	NA	NA	NA	NA	NA
WP_017378132.1|2394939_2395788_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
WP_026063707.1|2395904_2396816_-	Nudix family hydrolase	NA	NA	NA	NA	NA
WP_036772169.1|2397582_2398458_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063708.1|2398516_2398897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063709.1|2399043_2399280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378135.1|2399576_2400047_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_017378136.1|2400101_2400956_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_017378137.1|2401427_2401646_+	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_017378138.1|2401748_2402999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242681.1|2403054_2403537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242682.1|2403773_2404202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2404537_2405512_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_017378141.1|2405570_2406623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378142.1|2406941_2407907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378143.1|2408209_2409034_-	phenylalanine 4-monooxygenase	NA	NA	NA	NA	NA
WP_017378144.1|2409235_2410312_+	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_017378145.1|2410396_2411383_+	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_017378146.1|2411401_2412046_+	maleylacetoacetate isomerase	NA	NA	NA	NA	NA
WP_027242684.1|2412057_2413167_+	histidinol-phosphate transaminase	NA	A0A142C026	Faustovirus	23.5	1.6e-17
WP_027242685.1|2413233_2413896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242686.1|2414155_2416039_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_017378149.1|2416352_2417852_+	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_017378150.1|2417942_2418725_+	exodeoxyribonuclease III	NA	E3T4M6	Cafeteria_roenbergensis_virus	33.0	1.8e-31
WP_017378151.1|2418852_2419773_+	SPFH/Band 7/PHB domain protein	NA	J3IZE5	Acanthamoeba_polyphaga_lentillevirus	27.5	2.2e-20
WP_017378152.1|2419796_2420255_+	NfeD family protein	NA	NA	NA	NA	NA
WP_048875854.1|2420376_2421252_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378154.1|2421285_2422551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772169.1|2422738_2423614_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_048875853.1|2423812_2424004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875852.1|2424208_2425504_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2425823_2426042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375941.1|2426078_2427458_-	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	30.9	3.0e-53
WP_017375942.1|2427485_2427944_-	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	68.0	3.5e-51
WP_036773720.1|2427921_2429139_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	34.3	6.3e-39
WP_017375944.1|2429331_2429568_+	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_016210730.1|2429581_2429737_+	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_017375945.1|2429817_2430780_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_017375947.1|2430939_2432256_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_017375948.1|2432265_2432934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375949.1|2433344_2435159_+	translational GTPase TypA	NA	A0A1S5SF82	Streptococcus_phage	45.1	3.8e-24
WP_144420736.1|2435874_2436060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375951.1|2436241_2436700_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081078121.1|2437418_2438219_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377787.1|2438250_2438478_-|transposase	transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_144420737.1|2439758_2440157_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_081000012.1|2440160_2440403_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375794.1|2441292_2443044_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_017375795.1|2443054_2443855_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	39.1	3.4e-33
WP_017375796.1|2443957_2444446_-	dihydrofolate reductase	NA	A0A1B2IDT7	Erwinia_phage	43.1	4.5e-28
WP_047927156.1|2444945_2445869_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_017375799.1|2445965_2446310_+	DMT family protein	NA	NA	NA	NA	NA
WP_017377528.1|2452004_2452967_-	hypothetical protein	NA	M1HUT5	Acanthocystis_turfacea_Chlorella_virus	28.1	7.0e-17
WP_036772663.1|2453005_2453881_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_026063646.1|2454140_2455400_-	transcription termination factor Rho	NA	NA	NA	NA	NA
WP_016210045.1|2455622_2455949_-	thioredoxin TrxA	NA	A0A1J0GW78	Streptomyces_phage	46.2	1.5e-16
WP_048875850.1|2456143_2457094_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242725.1|2457151_2459218_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_017377534.1|2459223_2460219_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_027242724.1|2460958_2462539_+	APC family permease	NA	NA	NA	NA	NA
WP_016210041.1|2462686_2464096_-	glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_017377536.1|2464155_2465289_-	cation transporter	NA	NA	NA	NA	NA
WP_017377537.1|2465427_2466252_-	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_027242723.1|2466479_2466779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377539.1|2466775_2466988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046561.1|2467001_2467139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377540.1|2467276_2467510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210044.1|2468561_2468933_-	isochorismatase	NA	NA	NA	NA	NA
WP_017377542.1|2469243_2469531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377543.1|2469682_2470531_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_048875849.1|2470653_2471625_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_017377545.1|2471727_2472768_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_017377550.1|2475306_2475597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377551.1|2475864_2476125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2476251_2477226_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 27
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	2510220	2570857	3187888	tRNA,transposase	Acinetobacter_phage(33.33%)	57	NA	NA
WP_053093682.1|2510220_2510964_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017377392.1|2512130_2512727_+	biotin/lipoyl-binding protein	NA	NA	NA	NA	NA
WP_017377391.1|2512997_2513576_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017377386.1|2518098_2519604_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_017377385.1|2519631_2519913_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_016209709.1|2520061_2520403_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_017377384.1|2520523_2522428_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_047927397.1|2522560_2524132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929687.1|2524149_2525349_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_017377379.1|2525470_2526469_-	3-deoxy-7-phosphoheptulonate synthase	NA	NA	NA	NA	NA
WP_144420826.1|2526472_2527231_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_017377377.1|2527232_2528432_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_036771983.1|2528415_2529087_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_017377375.1|2529108_2529885_-	indole-3-glycerol-phosphate synthase	NA	A0A0P0IR83	Acinetobacter_phage	31.1	2.0e-22
WP_017377374.1|2529888_2530887_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	32.4	2.7e-40
WP_017377373.1|2530888_2531467_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	44.5	1.1e-44
WP_017377372.1|2531463_2532933_-	anthranilate synthase component I family protein	NA	NA	NA	NA	NA
WP_016209719.1|2532976_2533264_-	trp operon repressor	NA	NA	NA	NA	NA
WP_026063627.1|2533464_2534385_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017377369.1|2534500_2535055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377368.1|2535170_2535596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771981.1|2535866_2536217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242711.1|2536410_2536950_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_017377365.1|2537034_2537571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242710.1|2538230_2538533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242709.1|2538981_2539551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242708.1|2539619_2539964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376171.1|2540142_2541117_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_155046560.1|2541383_2541557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048875961.1|2541662_2543066_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875844.1|2543070_2544090_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_075275373.1|2544706_2545036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378398.1|2545261_2545660_-	DUF3135 domain-containing protein	NA	NA	NA	NA	NA
WP_017378399.1|2546527_2547478_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_017378400.1|2547477_2549556_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_017378401.1|2549697_2550213_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_017378402.1|2550221_2550785_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_017378403.1|2550765_2551512_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_017378404.1|2551650_2552103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927132.1|2552238_2553075_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_027242707.1|2553071_2553968_+	DMT family transporter	NA	NA	NA	NA	NA
WP_017378407.1|2554000_2555068_+	4-oxalomesaconate tautomerase	NA	NA	NA	NA	NA
WP_016210352.1|2555086_2555455_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_080963575.1|2555480_2556932_-	potassium transporter	NA	NA	NA	NA	NA
WP_017378410.1|2556938_2558318_-	Trk system potassium transporter TrkA	NA	NA	NA	NA	NA
WP_036773239.1|2558358_2559672_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_026063734.1|2559661_2560636_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	1.3e-10
WP_017378413.1|2560729_2561233_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	5.4e-13
WP_017378414.1|2561367_2562519_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_016210342.1|2562515_2562995_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_027242705.1|2563141_2565463_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	35.9	7.9e-99
WP_080963576.1|2565407_2566034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378416.1|2566038_2566938_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_036773242.1|2567118_2567673_+	DUF4823 domain-containing protein	NA	NA	NA	NA	NA
WP_036771330.1|2567712_2568687_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_069971663.1|2568905_2569148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|2569882_2570857_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
>prophage 28
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	2637249	2752766	3187888	tRNA,transposase,protease	Escherichia_phage(19.05%)	105	NA	NA
WP_017378478.1|2637249_2638629_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_017378479.1|2638743_2640636_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_017378480.1|2640683_2641310_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_017378481.1|2641329_2642214_+	ParA family protein	NA	Q8JL10	Natrialba_phage	28.4	5.8e-18
WP_027242747.1|2642246_2643137_+	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	31.8	6.7e-14
WP_017378483.1|2643251_2643650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378484.1|2643654_2644470_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_016209328.1|2644521_2644926_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_017378485.1|2644980_2645451_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_017378486.1|2645462_2645990_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_017378487.1|2646006_2647548_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_027242748.1|2647573_2648434_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_016209339.1|2648464_2649856_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_017378489.1|2649880_2650309_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_027242749.1|2650402_2651767_+	UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	40.9	3.9e-37
WP_027242750.1|2651823_2653659_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.7	5.8e-121
WP_036773290.1|2653772_2654501_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.2	2.3e-44
WP_027242751.1|2655027_2656569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378498.1|2656835_2657492_-	2OG-Fe dioxygenase family protein	NA	NA	NA	NA	NA
WP_048876081.1|2658189_2658849_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_017376300.1|2658993_2659251_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075275376.1|2659363_2660116_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_017376303.1|2660174_2660888_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	36.0	2.2e-28
WP_027242752.1|2661079_2661712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2663446_2664850_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376720.1|2664846_2665107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771332.1|2665150_2666125_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	7.3e-30
WP_036815787.1|2666144_2666462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376724.1|2666539_2666752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026063559.1|2666998_2667418_+	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_036816796.1|2667515_2667962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242563.1|2668306_2669305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051929590.1|2669337_2669691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929591.1|2669735_2670008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376728.1|2670404_2671823_-	MFS transporter	NA	NA	NA	NA	NA
WP_017376729.1|2672049_2672991_+	ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_026063560.1|2673025_2675005_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_027242562.1|2675001_2675607_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_016211294.1|2675608_2675950_+	prokaryotic cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_027242561.1|2675950_2676787_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_080963573.1|2676952_2677270_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_027242560.1|2677347_2678769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376735.1|2678765_2679461_-	TVP38/TMEM64 family protein	NA	NA	NA	NA	NA
WP_144420744.1|2680647_2681493_+	proline iminopeptidase-family hydrolase	NA	NA	NA	NA	NA
WP_017376738.1|2681502_2681841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876080.1|2682409_2683813_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420590.1|2683845_2684790_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046627.1|2684994_2685168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876079.1|2685775_2686825_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075275379.1|2686979_2687198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876031.1|2687517_2688921_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048876179.1|2688931_2689489_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036772663.1|2689485_2690361_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017376269.1|2690585_2690876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772645.1|2693499_2694273_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027243066.1|2694691_2695048_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_144420745.1|2695079_2695532_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_027243065.1|2695684_2698747_-	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	22.3	1.0e-61
WP_017376261.1|2698743_2699808_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_017376260.1|2700171_2701125_-	glutathione synthase	NA	NA	NA	NA	NA
WP_017376259.1|2701157_2702321_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_017376258.1|2702326_2702926_-	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_017376257.1|2703113_2703614_+	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	42.5	1.2e-20
WP_017376256.1|2703631_2704720_+	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_017376255.1|2704858_2706103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376254.1|2706099_2706942_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_017376253.1|2706921_2707731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420746.1|2707917_2708133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376251.1|2708133_2709096_+	TonB family protein	NA	NA	NA	NA	NA
WP_017376250.1|2709151_2709703_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_017376249.1|2709832_2710255_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_017376248.1|2710247_2711009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376247.1|2711063_2711762_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_026063518.1|2711748_2712597_+	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	35.5	4.3e-26
WP_017376244.1|2713214_2713739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376243.1|2713871_2715086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017376242.1|2715400_2716462_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_017376241.1|2716475_2718203_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_027243064.1|2718236_2718968_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_027243063.1|2718967_2719756_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_027243062.1|2719860_2720484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376237.1|2721815_2722568_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_027242703.1|2728247_2728871_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_017376193.1|2728910_2729396_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_017376192.1|2729442_2730588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065653742.1|2730589_2732860_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_036771610.1|2732861_2733722_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.1	1.3e-67
WP_017376188.1|2733718_2734591_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.7	1.6e-92
WP_017376187.1|2734587_2735595_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	49.7	3.0e-79
WP_017376186.1|2735614_2736022_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.4	1.3e-28
WP_065653741.1|2736050_2737439_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_027242702.1|2737435_2738608_+	glycerophosphotransferase	NA	NA	NA	NA	NA
WP_017376183.1|2738639_2739491_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_027242701.1|2739500_2740664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242700.1|2740660_2741668_+	glycosyltransferase family 4 protein	NA	B6EFC4	Stygiolobus_rod-shaped_virus	35.1	3.4e-06
WP_027242699.1|2741664_2742801_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017376177.1|2742797_2743724_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2K9L4U8	Tupanvirus	44.2	3.0e-57
WP_017376176.1|2743818_2745219_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.1	4.0e-53
WP_144420747.1|2745506_2746895_+	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_036771589.1|2746976_2747804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771607.1|2748022_2749027_+	OmpA family protein	NA	NA	NA	NA	NA
WP_016209597.1|2749080_2749311_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	40.7	1.0e-06
WP_036771588.1|2749318_2750197_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	40.9	2.0e-39
WP_017376171.1|2750333_2751308_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_017376170.1|2751665_2752766_+|protease	trypsin-like serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.3	1.4e-21
>prophage 29
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	2825759	2956871	3187888	transposase,tRNA,tail,protease	Acinetobacter_phage(11.11%)	112	NA	NA
WP_017377604.1|2825759_2827742_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G9E4U6	Ostreococcus_lucimarinus_virus	41.1	1.0e-115
WP_017377605.1|2827951_2829295_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_017377606.1|2829561_2832231_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_017377607.1|2832254_2834171_+	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_026063653.1|2834340_2835762_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.1	3.1e-45
WP_017377609.1|2835906_2836881_+	phospholipase A	NA	NA	NA	NA	NA
WP_027242692.1|2836890_2837190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377612.1|2837307_2837529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377613.1|2837692_2839354_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	64.5	7.7e-181
WP_016209850.1|2839426_2839717_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	42.6	3.3e-15
WP_017377614.1|2839943_2840399_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_017377615.1|2840463_2840928_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_027242691.1|2841019_2842366_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_017377618.1|2842365_2843271_+	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_017377619.1|2843332_2844319_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_016209851.1|2844311_2844554_+	Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_017377620.1|2844672_2846217_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.9	1.6e-63
WP_017377621.1|2846263_2847550_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_017377622.1|2847592_2848996_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_144420750.1|2849000_2851538_-	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_144420593.1|2851934_2852183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963589.1|2852114_2852576_-	purine-binding chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_017377624.1|2853070_2853766_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_080963590.1|2853867_2855430_-	APC family permease	NA	NA	NA	NA	NA
WP_017377626.1|2855757_2857551_+	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	41.0	2.2e-117
WP_017377627.1|2857637_2857910_+	DUF615 domain-containing protein	NA	NA	NA	NA	NA
WP_017377628.1|2857915_2858542_+	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_017377629.1|2858528_2859959_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_017377630.1|2860280_2861336_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	34.7	5.1e-29
WP_017377631.1|2861304_2861982_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_017377632.1|2861971_2862820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210080.1|2862965_2863259_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_036772063.1|2863370_2864183_-	trfA family protein	NA	NA	NA	NA	NA
WP_017377635.1|2864481_2865336_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_017377636.1|2865489_2866539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377637.1|2866584_2867241_-	DedA family protein	NA	NA	NA	NA	NA
WP_017377638.1|2867258_2868539_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_017377639.1|2868812_2870174_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_036772069.1|2870234_2870786_+	paraquat-inducible protein A	NA	NA	NA	NA	NA
WP_017376225.1|2876216_2877488_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_017376226.1|2877544_2878528_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_027243088.1|2878524_2879310_+	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_017376227.1|2879617_2880067_-	DUF1499 domain-containing protein	NA	NA	NA	NA	NA
WP_048876031.1|2880160_2881564_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376228.1|2882001_2883483_+	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	5.3e-48
WP_017376229.1|2883538_2884648_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.8	1.7e-35
WP_017376234.1|2886220_2886433_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_027243087.1|2886473_2887169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155763433.1|2887432_2888605_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_017376236.1|2890149_2890716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243085.1|2890873_2891434_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_053856766.1|2891553_2892957_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_048875886.1|2892953_2893310_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_017376838.1|2893565_2894390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243084.1|2895087_2895612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2895897_2896872_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_027243083.1|2896971_2897523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999961.1|2897635_2898289_-	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_144420594.1|2898540_2899998_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420595.1|2900111_2900591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376842.1|2900828_2901434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376843.1|2901713_2902829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963586.1|2902767_2903454_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_027243079.1|2903447_2904425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376846.1|2904459_2905623_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_027243078.1|2905962_2906187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016210632.1|2906569_2906857_-	DUF3579 domain-containing protein	NA	NA	NA	NA	NA
WP_017376847.1|2907031_2907787_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_036774056.1|2907819_2908251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376849.1|2908226_2908703_+	ribosomal-protein-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_017376850.1|2908709_2910287_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	31.4	3.6e-10
WP_017376851.1|2910289_2911054_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_017376852.1|2911107_2911644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376853.1|2911640_2912372_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_027243077.1|2912596_2913358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875887.1|2913683_2914559_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_017378284.1|2915961_2916117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963635.1|2916310_2918020_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017375924.1|2918673_2918982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420596.1|2918999_2921192_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	44.9	3.5e-141
WP_069971668.1|2921999_2922248_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	56.1	2.9e-07
WP_017375921.1|2922360_2922594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375920.1|2922828_2923359_+	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_017375919.1|2923363_2924077_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_144420751.1|2924704_2925430_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_048875888.1|2925438_2927502_+	serine/threonine protein kinase	NA	A0A2H4UVE2	Bodo_saltans_virus	28.0	3.9e-17
WP_027243033.1|2927681_2928161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062312049.1|2928653_2930021_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376531.1|2930412_2931210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243034.1|2931321_2932611_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_144420597.1|2932791_2933778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376534.1|2933894_2934074_+	rubredoxin	NA	NA	NA	NA	NA
WP_017376535.1|2934085_2934517_-	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_017376536.1|2934729_2935089_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	4.4e-25
WP_017376537.1|2935258_2936884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080999962.1|2937607_2939035_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376538.1|2939328_2940510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243035.1|2943112_2944411_-	MFS transporter	NA	NA	NA	NA	NA
WP_144420752.1|2944766_2945660_+	DNA polymerase III subunit delta'	NA	S5WKH4	Pseudomonas_phage	33.8	2.3e-14
WP_047927468.1|2945656_2945962_+	pilus assembly protein PilZ	NA	NA	NA	NA	NA
WP_017376543.1|2945987_2946767_+	TatD family hydrolase	NA	NA	NA	NA	NA
WP_144420598.1|2946796_2947027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210862.1|2947178_2947424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376547.1|2947610_2948402_+	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_017376548.1|2949101_2949824_+	putative N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_017376549.1|2949820_2950702_+	ROK family protein	NA	NA	NA	NA	NA
WP_027243038.1|2950725_2952216_+	sodium:solute symporter	NA	A0A219Y9P9	Aeromonas_phage	23.8	8.0e-20
WP_027243039.1|2952305_2953193_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_017376551.1|2953865_2954357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2954361_2954589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773116.1|2954681_2955656_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.6e-29
WP_069971669.1|2955632_2956871_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	2964837	3018251	3187888	transposase	Staphylococcus_phage(57.14%)	48	NA	NA
WP_053856767.1|2964837_2966241_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_144420600.1|2966346_2966532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053856766.1|2967230_2968634_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_080999963.1|2968724_2969228_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|2969267_2970242_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_017376774.1|2970238_2970808_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	40.3	4.5e-32
WP_017376776.1|2971294_2971987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420601.1|2972594_2973587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017376778.1|2973576_2975349_+	single-stranded-DNA-specific exonuclease RecJ	NA	NA	NA	NA	NA
WP_080963634.1|2975349_2975538_-	DUF4286 family protein	NA	NA	NA	NA	NA
WP_036774259.1|2975575_2976550_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036815640.1|2976608_2976803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375625.1|2976869_2977097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069971671.1|2977226_2978102_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_155046623.1|2978329_2978479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420602.1|2978470_2978737_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_144420603.1|2978881_2979781_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_155046619.1|2979867_2980125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243075.1|2980737_2981964_+	cysteine desulfurase-like protein	NA	NA	NA	NA	NA
WP_027243074.1|2982053_2982593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243073.1|2982714_2983353_-	MFS transporter	NA	NA	NA	NA	NA
WP_075275265.1|2983386_2983875_-	VUT family protein	NA	NA	NA	NA	NA
WP_144420604.1|2984121_2984424_-	VUT family protein	NA	NA	NA	NA	NA
WP_036772686.1|2984404_2984893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963628.1|2985463_2986762_-	MFS transporter	NA	NA	NA	NA	NA
WP_017378171.1|2986878_2987169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420605.1|2987207_2989862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243070.1|2990575_2990830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026063658.1|2991139_2991868_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	1.3e-44
WP_017377650.1|2992638_2993823_+	acyl-CoA desaturase	NA	NA	NA	NA	NA
WP_017377649.1|2993841_2994786_-	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_027243069.1|2995091_2995877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377647.1|2995990_2996359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377646.1|2996587_2998165_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_144420753.1|2998948_3003373_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_065653746.1|3003509_3005033_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_017377643.1|3005237_3005465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377642.1|3005609_3005867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772743.1|3006434_3007406_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_144420754.1|3007330_3007639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|3008043_3009018_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	3.6e-29
WP_036771744.1|3009071_3010043_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771639.1|3010122_3011097_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.2	5.6e-30
WP_027242739.1|3011457_3014127_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	24.5	5.5e-19
WP_036774478.1|3014297_3015179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017378307.1|3015189_3015846_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_017378308.1|3015912_3016617_-	CoA transferase subunit A	NA	NA	NA	NA	NA
WP_048876031.1|3016847_3018251_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP013811	Piscirickettsia salmonis strain AY3864B, complete genome	3187888	3075260	3131253	3187888	tRNA,transposase	Acinetobacter_phage(20.0%)	47	NA	NA
WP_048875895.1|3075260_3076424_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	32.0	3.8e-25
WP_144420756.1|3076477_3077479_-	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_017378362.1|3077560_3078130_+	elongation factor P	NA	NA	NA	NA	NA
WP_144420608.1|3078343_3079315_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A1V0SAC0	Catovirus	25.9	7.3e-22
WP_017378364.1|3079326_3080922_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036772406.1|3080942_3081974_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_017378367.1|3082305_3083409_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_017378368.1|3083520_3084705_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_017378369.1|3084782_3086771_+	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_144420609.1|3087930_3089304_+	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378374.1|3089321_3090308_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	K7Y9E1	Megavirus	34.2	2.2e-42
WP_080963622.1|3090310_3091465_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	28.2	2.3e-14
WP_017378376.1|3091461_3092157_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	32.3	8.6e-09
WP_017378377.1|3092299_3093790_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_017378378.1|3093810_3094860_+	pseudaminic acid synthase	NA	NA	NA	NA	NA
WP_027242727.1|3094926_3096321_-	capsule biosynthesis protein	NA	NA	NA	NA	NA
WP_017378381.1|3097253_3099185_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	36.0	3.1e-117
WP_075273353.1|3099189_3099720_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.9	4.7e-15
WP_017378382.1|3099754_3099949_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_016210495.1|3099991_3100351_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_017378383.1|3100482_3101478_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	36.5	3.2e-33
WP_017378384.1|3101490_3103872_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_016211707.1|3103877_3104165_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	33.7	3.0e-08
WP_080963621.1|3104431_3104638_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_017378388.1|3106246_3107020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378389.1|3107021_3107963_-	hypothetical protein	NA	A0A068C8G6	Acinetobacter_phage	26.5	1.7e-20
WP_017378390.1|3108096_3109674_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_036816949.1|3109867_3110266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017378393.1|3111266_3111473_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048875897.1|3112277_3112922_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.2	2.7e-09
WP_069971672.1|3112989_3114246_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_017376600.1|3114501_3114681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927402.1|3114903_3115131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377704.1|3116406_3117165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420757.1|3117382_3117946_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_017377702.1|3118049_3118598_+	DUF2058 family protein	NA	NA	NA	NA	NA
WP_087910634.1|3119194_3120347_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.5	2.3e-59
WP_017377698.1|3120692_3120989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420758.1|3121248_3122160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377696.1|3122394_3122934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046620.1|3124096_3124234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|3124480_3125209_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A077SL39	Escherichia_phage	42.7	7.8e-45
WP_017377686.1|3125255_3125864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016210764.1|3127138_3127399_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_017377283.1|3127572_3129111_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_017377282.1|3129289_3130216_+	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SJE1	Klosneuvirus	34.5	1.6e-10
WP_048875900.1|3130320_3131253_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.8	9.4e-27
>prophage 1
NZ_CP013812	Piscirickettsia salmonis strain AY3864B plasmid p1PS11, complete sequence	60086	0	5335	60086		Pseudomonas_phage(20.0%)	6	NA	NA
WP_069971677.1|892_1075_-	hypothetical protein	NA	A0A0A1IUH0	Pseudomonas_phage	62.7	3.2e-08
WP_069971678.1|1167_1662_-	hypothetical protein	NA	A0A0S1WEX5	Vibrio_phage	43.2	3.1e-13
WP_144420830.1|1767_2073_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_027242583.1|2429_2741_+	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	38.7	2.3e-14
WP_027242582.1|2737_3139_+	helix-turn-helix domain-containing protein	NA	A0A222YXG1	Escherichia_phage	47.9	6.0e-23
WP_027242581.1|3148_5335_-	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	30.3	1.1e-73
>prophage 2
NZ_CP013812	Piscirickettsia salmonis strain AY3864B plasmid p1PS11, complete sequence	60086	25809	58933	60086	transposase,integrase	unidentified_phage(14.29%)	35	50736:50766	55058:55088
WP_069971648.1|25809_26784_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	2.9e-26
WP_069971679.1|26842_28648_-	type-F conjugative transfer system mating-pair stabilization protein TraN	NA	NA	NA	NA	NA
WP_036773372.1|28653_29319_-	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_036773373.1|29327_30317_-	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_080963562.1|30421_31108_-	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_155074374.1|31031_31409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774456.1|31365_33945_-	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_065653727.1|33957_34404_-	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_051929537.1|34406_35876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051929536.1|35885_36590_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_062365791.1|36582_37092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876012.1|37124_38528_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_036775000.1|38708_38999_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_052106244.1|39014_39332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420828.1|39529_39784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036774994.1|39989_40268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927058.1|40346_40703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053063426.1|40822_41608_+	class I SAM-dependent methyltransferase	NA	R4ZE30	Choristoneura_rosaceana_entomopoxvirus	27.9	2.1e-19
WP_047927059.1|41583_42285_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036775038.1|42270_43011_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242605.1|43305_44601_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	26.2	1.8e-12
WP_036774869.1|45044_45893_-	ParB/RepB/Spo0J family partition protein	NA	Q331U1	Clostridium_botulinum_C_phage	25.7	7.1e-05
WP_047927060.1|45889_46750_-	ParA family protein	NA	A0A0K2FLP4	Brevibacillus_phage	25.3	9.3e-13
WP_053856777.1|46739_46961_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_047927062.1|47477_47804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047927063.1|47803_48928_+	hypothetical protein	NA	NA	NA	NA	NA
50736:50766	attL	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_048876031.1|51024_52428_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_027242600.1|52455_53046_-|integrase	site-specific integrase	integrase	K4K327	Caulobacter_virus	32.3	3.9e-18
WP_032126795.1|53318_53579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016211910.1|53582_53855_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_155046644.1|54180_54399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080963647.1|55428_55599_-	hypothetical protein	NA	NA	NA	NA	NA
55058:55088	attR	TTCAATATTGAAGAATTTGAAAGTTTCAGCC	NA	NA	NA	NA
WP_036774631.1|55937_56402_-	hypothetical protein	NA	H6WFS7	Cyanophage	38.2	2.9e-21
WP_098082828.1|57668_57926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036774189.1|57925_58933_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP013813	Piscirickettsia salmonis strain AY3864B plasmid p2PS11, complete sequence	33556	4509	20532	33556	capsid,head,integrase,terminase,tail,transposase	unidentified_phage(38.46%)	20	3839:3898	18012:18303
3839:3898	attL	CAAACGCTGCGAGCCATGGAGTGCTAAGCACGGGGTGAGTAGGCCGAGGTAGGTTCGGGT	NA	NA	NA	NA
WP_036771330.1|4509_5484_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_016212329.1|6019_6610_-|integrase	site-specific integrase	integrase	K4K6A1	Caulobacter_phage	35.3	3.2e-20
WP_027242955.1|6840_7101_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016211078.1|7093_7447_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	34.8	6.5e-13
WP_069971681.1|7623_8598_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	1.7e-26
WP_027242954.1|9130_9496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242953.1|9640_9895_+	addiction module toxin, HicA family	NA	NA	NA	NA	NA
WP_080963620.1|9878_10235_+	type II toxin-antitoxin system HicB family antitoxin	NA	K7PJX6	Enterobacterial_phage	36.4	1.7e-16
WP_036771330.1|10332_11307_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027242951.1|11932_12799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242950.1|13011_13395_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	46.3	4.3e-26
WP_027242949.1|13481_13964_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	34.0	3.6e-14
WP_027242948.1|13966_14152_+	hypothetical protein	NA	A0A1J0GUY5	Halomonas_phage	47.3	9.0e-06
WP_036771330.1|14171_15146_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_075275490.1|15242_15635_+|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	45.0	7.0e-24
WP_027242946.1|15670_16252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|16632_17607_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_144420855.1|17680_17896_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_027242945.1|18699_19215_-	hypothetical protein	NA	NA	NA	NA	NA
18012:18303	attR	ACCCGAACCTACCTCGGCCTACTCACCCCGTGCTTAGCACTCCATGGCTCGCAGCGTTTGCATTGATCCTACTCAGCTTATTGATACGCCGACCGGTACGATACTGATACATTCTCACCCTGATGGCACGGTTGAGCCGTCACTCGCGGATATGGTGGGTCAACGCGATACTGGATTATTATGGGGGATTGTTGCACTCAATCAACACGCTGTGACGGATGCCATTGTTTTTGGTGAGCAGTTATTCACCCAGCAATTACTCGAGCGGCCGTTTTTGCATGGTATTTTTGAT	NA	NA	NA	NA
WP_027242943.1|20115_20532_+	hypothetical protein	NA	A0A2R3UA88	Siphoviridae_environmental_samples	41.7	2.2e-20
>prophage 1
NZ_CP013814	Piscirickettsia salmonis strain AY3864B plasmid p3PS11, complete sequence	45767	0	25688	45767	integrase,transposase	Escherichia_phage(27.27%)	31	4548:4563	30340:30355
WP_021461774.1|406_688_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_069971687.1|759_1971_-	Tet(A)/Tet(B)/Tet(C) family tetracycline efflux MFS transporter	NA	NA	NA	NA	NA
WP_021461772.1|2063_2693_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004235553.1|2990_3923_-|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_011751353.1|4124_4766_+	type A-2 chloramphenicol O-acetyltransferase CatII	NA	G3CFL0	Escherichia_phage	45.9	6.6e-56
4548:4563	attL	TCATCATTACCCTGGG	NA	NA	NA	NA
WP_004235553.1|5439_6372_+|transposase	IS5-like element ISKpn13 family transposase	transposase	Q38213	Escherichia_phage	55.7	5.2e-94
WP_155763435.1|6497_6653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|6713_7211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|7286_8075_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|8132_8657_-	streptothricin N-acetyltransferase Sat2	NA	NA	NA	NA	NA
WP_000071896.1|8979_9516_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|9630_9957_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_001353740.1|10144_10384_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_081329474.1|10829_11276_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_012850379.1|11336_12554_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_012850378.1|12553_13306_-	ParA family protein	NA	H7BUL8	unidentified_phage	29.4	9.6e-14
WP_069971684.1|13309_13624_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_041692625.1|13824_14019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850375.1|14392_15388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041692624.1|15497_15920_-	antirestriction protein	NA	A0A1S5R3R9	Pseudomonas_phage	33.0	1.6e-05
WP_012850373.1|16456_17821_-	hypothetical protein	NA	A0A1B1P892	Bacillus_phage	25.8	1.2e-09
WP_012850372.1|18005_18317_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_012850370.1|18722_19463_+	hypothetical protein	NA	A0A1D6ZIU7	Xanthomonas_phage	33.7	1.6e-05
WP_012850369.1|19462_20110_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012850368.1|20110_21175_-	phosphoribosyltransferase	NA	A0A0R6PHM5	Moraxella_phage	34.9	4.1e-34
WP_012850367.1|21184_21508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850366.1|21614_21752_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850365.1|21799_22057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012850364.1|22482_22971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012850363.1|22980_23721_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_012850362.1|23717_25688_+	type I DNA topoisomerase	NA	A0A0G2YA05	Acanthamoeba_polyphaga_mimivirus	34.2	1.2e-76
30340:30355	attR	TCATCATTACCCTGGG	NA	NA	NA	NA
>prophage 2
NZ_CP013814	Piscirickettsia salmonis strain AY3864B plasmid p3PS11, complete sequence	45767	37244	41957	45767		Bdellovibrio_phage(50.0%)	3	NA	NA
WP_012850393.1|37244_40292_+	hypothetical protein	NA	H9C0J7	Bdellovibrio_phage	30.6	5.4e-23
WP_012850392.1|40281_40425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012850391.1|40427_41957_+	DUF1738 domain-containing protein	NA	A0A1B1IRD0	uncultured_Mediterranean_phage	33.9	6.9e-35
>prophage 1
NZ_CP013815	Piscirickettsia salmonis strain AY3864B plasmid p4PS11, complete sequence	188300	0	60056	188300	portal,integrase,capsid,tail,transposase,head	Streptococcus_phage(16.67%)	56	1010:1069	72735:73470
WP_036772541.1|214_943_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_048876211.1|954_1659_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.7	7.9e-10
1010:1069	attL	GTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTC	NA	NA	NA	NA
WP_144420840.1|2041_2473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876212.1|2503_3382_-	ParB/RepB/Spo0J family partition protein	NA	NA	NA	NA	NA
WP_027243191.1|3335_4043_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	40.0	1.2e-34
WP_075275473.1|4159_4336_-	carbon storage regulator	NA	A0A2I7RT00	Vibrio_phage	46.0	1.7e-06
WP_048876213.1|5574_6465_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_069971688.1|6773_7880_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_155763436.1|7864_10057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|10789_11767_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771353.1|11848_12568_+	ParA family protein	NA	NA	NA	NA	NA
WP_036771355.1|12584_14021_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036771347.1|14492_15470_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_017375652.1|15497_15926_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_027242568.1|15984_18675_-	host specificity protein J	NA	A0A0R6PIC9	Moraxella_phage	32.9	6.1e-111
WP_017375789.1|18671_19229_-|tail	tail assembly protein	tail	K7PM97	Enterobacterial_phage	35.6	2.7e-21
WP_144420832.1|19218_20004_-	hypothetical protein	NA	A0A0R6PHF9	Moraxella_phage	41.1	5.1e-42
WP_017375787.1|19933_20605_-|tail	phage minor tail protein L	tail	W6EC15	Rhizobium_phage	33.6	1.4e-27
WP_017375786.1|20601_20943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771950.1|20935_23014_-|tail	phage tail tape measure protein	tail	A0A1J0GWA6	Alteromonas_phage	31.2	1.6e-50
WP_017375784.1|23017_23284_-	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_017375783.1|23340_23664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375782.1|23665_24088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375781.1|24087_24438_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017375780.1|24434_24830_-	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	39.6	4.3e-05
WP_017375779.1|25007_25433_-|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	37.9	3.9e-12
WP_017375778.1|25429_25741_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	30.8	5.6e-08
WP_027242598.1|26125_26710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075275454.1|26723_27263_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	44.2	9.3e-35
WP_036771639.1|27312_28287_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	30.9	4.9e-26
WP_036771953.1|28749_31029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242588.1|31045_31399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036771330.1|31737_32712_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_036773107.1|32999_33317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375691.1|33300_34002_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	37.6	9.6e-32
WP_017375692.1|34025_34259_-	hypothetical protein	NA	Q7Y5W4	Haemophilus_phage	42.6	1.3e-06
WP_036773116.1|34402_35377_+|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.2	3.7e-26
WP_027243195.1|35742_36789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048876259.1|37114_38131_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_047927763.1|38621_38885_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_036816769.1|38881_39280_+	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_036815609.1|39523_39979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377666.1|41879_42137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377667.1|42281_42452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420839.1|43121_44048_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_017375910.1|44243_44972_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420838.1|46120_46741_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|46796_47525_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_069971691.1|48392_48650_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_017377511.1|48652_49381_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_144420837.1|49410_50343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036773695.1|51239_53312_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_016212398.1|55373_55835_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876221.1|55929_56385_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	34.8	4.3e-17
WP_081000017.1|58742_58994_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_081329475.1|59258_60056_-|transposase	transposase	transposase	NA	NA	NA	NA
72735:73470	attR	GTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGTTGTTCAATACCAACGCGATTAGGTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCCGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTATAAGTTCTTGACTGATAACATCGGGGGATGTATGAGTGCTTAACCGCTGATGAATCAACATTTTTTCCTCTTCTGAAATTTGTTGAAAAGCTTGTCCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCGCAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAAGTGCTCTAGCAATTGATCTGAGCGAGTCTCCCTCTGATAACCGTTGTTCGATATAAAAACGATCTTTTTCATTTAAGTGCCGATAAATCATCTCTACCCTCATAAGGCAAACTAGAGAGTTTATCTGTATGGATATGAACTCTCTACTCGGTGTTGCACTTCAGATGACGGAGGGCG	NA	NA	NA	NA
>prophage 2
NZ_CP013815	Piscirickettsia salmonis strain AY3864B plasmid p4PS11, complete sequence	188300	64837	129246	188300	transposase,portal,integrase	Streptococcus_phage(48.15%)	60	72373:72432	112015:112935
WP_027243203.1|64837_65632_-	DNA/RNA non-specific endonuclease	NA	A0A2H4N7Z3	Lake_Baikal_phage	35.9	2.5e-36
WP_017375836.1|65725_65929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017375632.1|66123_66459_-|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	51.5	2.3e-23
WP_036771296.1|67158_69054_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036772437.1|69409_71308_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|71603_71870_+|transposase	transposase	transposase	NA	NA	NA	NA
72373:72432	attL	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTA	NA	NA	NA	NA
WP_036771330.1|72409_73384_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	31.8	1.7e-26
WP_027243200.1|73690_74095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_047927488.1|74095_74842_-	AAA family ATPase	NA	A0A222YXS3	Escherichia_phage	29.9	4.9e-18
WP_081377439.1|75350_76412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080963627.1|77391_77610_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036772541.1|77628_78357_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_087910667.1|78508_79192_+	cell filamentation protein Fic	NA	NA	NA	NA	NA
WP_027243197.1|79196_79766_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.1	2.2e-26
WP_036772541.1|79936_80665_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_036815648.1|81148_81877_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_144420834.1|81929_82325_-|transposase	IS30 family transposase	transposase	H7BWC8	unidentified_phage	46.2	4.9e-09
WP_036772541.1|82618_83347_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	5.4e-38
WP_051929623.1|83504_86846_-	DEAD/DEAH box helicase	NA	C3VNU0	Bombyx_mandarina_nucleopolyhedrovirus	28.7	2.6e-50
WP_027243201.1|86909_87149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|87314_88043_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_027243202.1|88317_89253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876188.1|89966_90740_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.6	3.9e-10
WP_036774373.1|90913_91642_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_036774376.1|91951_92380_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_036774316.1|92376_92676_+	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036774378.1|92718_93288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420833.1|93492_93684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774385.1|93697_94738_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_027242592.1|94804_95134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036774388.1|95157_96120_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_017377694.1|97497_98226_+|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_017375663.1|98472_98622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377694.1|98633_99362_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_081000015.1|99391_99778_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_048876191.1|99713_100142_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_082300723.1|101693_101921_+|transposase	IS3 family transposase	transposase	A4JX31	Burkholderia_virus	47.0	8.1e-09
WP_155046637.1|102653_103145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017375910.1|103226_103955_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_146619416.1|104298_104445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027243206.1|104750_106616_+	AAA family ATPase	NA	V5K3E8	Pseudomonas_phage	32.7	7.9e-57
WP_080963664.1|106688_106955_-|portal	phage portal protein	portal	G0ZT36	Aeromonas_phage	46.7	2.5e-09
WP_080963665.1|107135_107477_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	54.3	4.3e-22
WP_048876194.1|107657_108191_-|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	33.3	1.1e-19
WP_036774350.1|109430_110159_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	43.1	6.4e-39
WP_027243215.1|110641_111664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036772450.1|113477_114605_+	hypothetical protein	NA	NA	NA	NA	NA
112015:112935	attR	ACGCCCTCCGTCATCTGAAGTGCAACACTACTCTATACTAAGCCGCCATCAAATACTCTAAAAAAACATGATTAGGTGAGCGATAATTCAAACTCGCTCTTCTTCTGGTGTTCAATGTATGCTCTATTTTTGCTATTTCTTTGTCACTAACTTCATTAAAATCCGTCCCTTTAGGTAGAAAACGCCTTATCAAACCATTTGTGTGTTCATTTAGACCTCTATCACAAGAACGATAAGGTCTAGCAAAGTAAAAGTCTGCTTCAGTGATCTTTGAAATGGCCTCATGACCGGCAAACTCTGTTCCGTTGTCAGAAGTGATGGTTTTAAAATCAAAGAAAGTTGAGCCAACCACATTCATGAATGTATTGATAACAGTCTTGGCTTGTTTGTTAGGCATTTTCCTTATACAACACATTTTATTCGCCTTATCGACCAGTGTTAATAAATAAGATTGGTGGTCACGACCCACAACCGTATCAATTTCAAAATGACCAAACTCTGTCTTTTCATCAGCAATAGCAGGCCGTTGTTCAATACCAACGCGATTAGGTATTTTTGTTTGATCACCACGACTCACCTTCTTCTTATAAGGTTTTCCTGAATGAGGCAGGTTTTTGTAAAGCTCTCCGCCCCGCTCTCTATCATCATAAATATAACGGTAAATCGTGCTCTCACTCACCTGAATATTATGCTCACGTATAAGTTCTTGACTGATAACATCGGGGGATGTATGAGTGCTTAACCGCTGATGAATCAACATTTTTTCCTCTTCTGAAATTTGTTGAAAAGCTTGTCCTTGCTTAGCGTTAGCTCGTTTTTCTTGTGCGCAGCGAGAAGTAAGCCGGTGACAATAAAGACCTTTAAAATCGATTGGGGTGTGCCGTTTAATCTCACGGCTAATCGTGCTAGGAGAAAAGCCAA	NA	NA	NA	NA
WP_051929764.1|115276_115768_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.1	6.9e-21
WP_032126795.1|117126_117387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036772441.1|117390_117663_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_017375910.1|117738_118467_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
WP_048876229.1|119036_120008_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_048876208.1|120872_121700_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.1	1.2e-17
WP_036771289.1|122553_123024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046633.1|123917_124061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_027242940.1|125267_125867_-	DUF1353 domain-containing protein	NA	NA	NA	NA	NA
WP_017375850.1|126220_126997_-	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_036771279.1|127357_128086_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_155046634.1|128155_128356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048876229.1|128274_129246_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP013815	Piscirickettsia salmonis strain AY3864B plasmid p4PS11, complete sequence	188300	135485	140256	188300		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_017375964.1|135485_135911_-	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	43.9	5.1e-12
WP_036817204.1|136181_137177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036817201.1|137480_137888_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_017375960.1|137995_139039_-	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L339	Tupanvirus	44.0	2.2e-77
WP_017375959.1|139340_139574_+	hypothetical protein	NA	A0A0M3LQB1	Mannheimia_phage	45.2	5.1e-06
WP_146619517.1|139711_139864_-	phosphatase	NA	NA	NA	NA	NA
WP_081078123.1|139893_140256_+	HigA family addiction module antidote protein	NA	A0A2I7RIN6	Vibrio_phage	46.6	3.5e-06
>prophage 4
NZ_CP013815	Piscirickettsia salmonis strain AY3864B plasmid p4PS11, complete sequence	188300	144392	188073	188300	transposase,portal,terminase	Streptococcus_phage(37.5%)	49	NA	NA
WP_027242929.1|144392_144776_+	HNH endonuclease	NA	A0A2D1GNP5	Pseudomonas_phage	45.5	9.5e-26
WP_075278733.1|144862_145345_+|terminase	P27 family phage terminase small subunit	terminase	Q9B019	Phage_GMSE-1	33.3	8.1e-14
WP_048876205.1|145347_146679_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	46.3	6.1e-112
WP_047927581.1|146883_147318_+	hypothetical protein	NA	E4ZFM0	Streptococcus_phage	45.8	1.3e-26
WP_087910668.1|147404_147791_+|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	50.0	2.1e-25
WP_036771649.1|147828_148563_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.9e-38
WP_048876202.1|148609_149323_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	31.2	3.2e-11
WP_144420848.1|150701_150887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243190.1|150890_154235_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_017377509.1|154415_155144_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	3.2e-38
WP_075275482.1|155237_156212_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.9	1.8e-28
WP_027242596.1|156525_156888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027242595.1|156927_157437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420849.1|157668_158649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069971702.1|159114_159987_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.3	3.8e-38
WP_036771347.1|160068_161046_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_155046636.1|161060_161222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243211.1|161439_161694_+	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	NA	NA	NA	NA
WP_027243212.1|161683_161971_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	9.6e-15
WP_155048088.1|162465_163296_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	35.8	4.9e-35
WP_036771347.1|163296_164274_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_069971704.1|164381_164873_-	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771347.1|164954_165932_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_036771359.1|166059_166788_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	3.5e-37
WP_017375754.1|166970_168257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155046630.1|168277_168442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144420842.1|168858_169017_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_017377694.1|169078_169807_-|transposase	IS6-like element ISPsa2 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	7.1e-38
WP_036772437.1|170228_172127_+	DUF1561 family protein	NA	NA	NA	NA	NA
WP_036771293.1|172422_172689_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_048876210.1|173234_173963_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	4.6e-37
WP_081000019.1|174003_174174_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036771347.1|174249_175227_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	35.9	3.9e-47
WP_051929558.1|175308_175992_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	33.3	5.1e-22
WP_155046629.1|176019_176172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016212146.1|176573_178313_+	PLD-like domain protein	NA	NA	NA	NA	NA
WP_082304501.1|178315_178678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017377658.1|179627_180314_-	Fic family protein	NA	NA	NA	NA	NA
WP_080963659.1|180659_181280_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_036772434.1|181258_181987_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.2	9.3e-38
WP_017377656.1|182074_182461_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_017377655.1|182457_182703_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075275474.1|183044_184157_-	replication initiation protein	NA	A0A218MNI2	uncultured_virus	29.8	2.1e-25
WP_017375840.1|185125_185344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052133264.1|185388_185793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_027243184.1|185806_186145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144420841.1|186137_186362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036815979.1|186733_187342_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	34.6	8.9e-10
WP_017375910.1|187344_188073_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	42.6	1.4e-38
