The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018809	Lactobacillus jensenii strain SNUV360 chromosome, complete genome	1672949	118711	124267	1672949		Staphylococcus_phage(66.67%)	6	NA	NA
WP_006585402.1|118711_119770_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	34.6	1.5e-41
WP_006585401.1|119762_120368_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.9	5.3e-31
WP_006585400.1|120370_121546_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	46.1	1.6e-95
WP_006588303.1|121563_122028_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.9	2.8e-24
WP_006585399.1|122195_123197_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	35.0	3.2e-49
WP_006588304.1|123547_124267_+	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.9	8.3e-23
>prophage 2
NZ_CP018809	Lactobacillus jensenii strain SNUV360 chromosome, complete genome	1672949	448071	455481	1672949		Streptococcus_phage(33.33%)	11	NA	NA
WP_006585146.1|448071_448623_+	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	46.4	1.1e-27
WP_006585145.1|448619_449018_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1B3AYM0	Gordonia_phage	46.2	3.9e-06
WP_006588116.1|449289_449889_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_006588115.1|449899_450430_+	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	42.9	1.2e-07
WP_006588114.1|450588_452370_+	DNA polymerase III subunit gamma/tau	NA	E7DN81	Pneumococcus_phage	41.2	4.9e-48
WP_006585142.1|452410_452740_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_006585141.1|452739_453339_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_006585140.1|453335_453575_+	YaaL family protein	NA	NA	NA	NA	NA
WP_006585139.1|453665_454313_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	54.8	2.7e-57
WP_006585138.1|454312_454633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006585136.1|454632_455481_+	DNA polymerase III subunit delta	NA	M1NSC1	Streptococcus_phage	28.3	7.3e-18
>prophage 3
NZ_CP018809	Lactobacillus jensenii strain SNUV360 chromosome, complete genome	1672949	656197	665044	1672949		Streptococcus_phage(33.33%)	7	NA	NA
WP_075362447.1|656197_659047_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.0	8.9e-302
WP_006584988.1|659134_660010_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.6	2.0e-07
WP_006584987.1|660019_661057_+	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	51.1	1.1e-89
WP_006587943.1|661049_661988_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	35.1	3.1e-46
WP_006587942.1|662127_663342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350558.1|663408_664401_+	D-2-hydroxyacid dehydrogenase	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	34.6	5.7e-46
WP_006584983.1|664462_665044_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.2	3.6e-53
>prophage 4
NZ_CP018809	Lactobacillus jensenii strain SNUV360 chromosome, complete genome	1672949	931510	1011068	1672949	terminase,plate,transposase,head,portal,holin,tail,capsid,protease,tRNA,integrase	Lactobacillus_phage(75.0%)	88	969115:969139	1008056:1008080
WP_006584480.1|931510_932689_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_006584770.1|933560_934466_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	36.9	6.3e-52
WP_006584769.1|934551_935742_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	34.7	1.6e-50
WP_143739499.1|935886_935952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006587784.1|936006_936672_-	hemolysin III family protein	NA	NA	NA	NA	NA
WP_006584768.1|936819_937662_+	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	23.6	3.7e-06
WP_006584767.1|937769_937994_+	YozE family protein	NA	NA	NA	NA	NA
WP_006588582.1|938040_939636_+	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_006584764.1|939756_940599_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_075362460.1|940595_941354_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	40.5	7.7e-27
WP_006584762.1|941402_941831_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_006584761.1|942339_943269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006584760.1|943340_944183_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	36.8	1.3e-27
WP_006588265.1|944345_946433_+	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	37.1	3.9e-97
WP_006588266.1|946532_947852_+|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_006584758.1|947844_948753_+	tyrosine recombinase XerC	NA	A0A1P8DJJ6	Virus_Rctr41k	29.1	3.2e-19
WP_006584757.1|948755_949286_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_006584756.1|949286_950669_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.8	2.6e-41
WP_006588267.1|950682_951567_+	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_006588268.1|951633_952254_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_006588269.1|952338_954282_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.7	1.5e-114
WP_006584754.1|954294_956775_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.0	2.9e-91
WP_006584753.1|956841_957777_+	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_006584752.1|957861_958446_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	42.8	3.2e-25
WP_006587990.1|958502_960203_-	fibronectin/fibrinogen-binding protein	NA	M1HQM6	Paramecium_bursaria_Chlorella_virus	45.7	1.7e-10
WP_006584751.1|960489_960903_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006584750.1|960976_961858_+	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	29.0	6.6e-06
WP_006587991.1|961957_962203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006584748.1|962280_962748_+	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_006584747.1|962946_963612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006584746.1|963757_965260_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_006584745.1|965294_965663_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006584480.1|965811_966990_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_006584744.1|967262_968318_-	tyrosine recombinase XerS	NA	NA	NA	NA	NA
969115:969139	attL	ATTGTGCCAAAATTGTGCCAACTTT	NA	NA	NA	NA
WP_075362461.1|969324_969741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048597999.1|969870_970275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362462.1|970279_970477_-	hypothetical protein	NA	B8R668	Lactobacillus_phage	91.5	4.3e-22
WP_075362463.1|970488_970920_-	hypothetical protein	NA	B8R667	Lactobacillus_phage	97.2	2.1e-77
WP_081377440.1|971164_971392_-	hypothetical protein	NA	B8R666	Lactobacillus_phage	95.9	9.9e-31
WP_155772335.1|971541_971691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362465.1|971880_973005_-	glycosyl hydrolase family 25	NA	B8R665	Lactobacillus_phage	92.8	1.0e-208
WP_048587925.1|973020_973413_-|holin	holin	holin	B8R664	Lactobacillus_phage	93.1	4.8e-57
WP_075362466.1|973402_973585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006588840.1|973590_973824_-	hypothetical protein	NA	B8R663	Lactobacillus_phage	100.0	2.4e-32
WP_006588841.1|973842_974235_-	hypothetical protein	NA	B8R662	Lactobacillus_phage	100.0	2.4e-69
WP_006588842.1|974200_974386_-	XkdX family protein	NA	NA	NA	NA	NA
WP_006588843.1|974385_974850_-	hypothetical protein	NA	B8R661	Lactobacillus_phage	100.0	4.0e-79
WP_048598118.1|974873_976787_-|plate	BppU family phage baseplate upper protein	plate	B8R660	Lactobacillus_phage	99.4	7.2e-239
WP_048598115.1|976740_976974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015995099.1|976958_979742_-|tail	fiber tail protein	tail	B8R659	Lactobacillus_phage	100.0	0.0e+00
WP_075362467.1|979738_980479_-|tail	phage tail protein	tail	B8R658	Lactobacillus_phage	99.5	1.0e-116
WP_075362468.1|980465_985148_-	tape measure protein	NA	B8R657	Lactobacillus_phage	91.0	0.0e+00
WP_048587919.1|985321_985936_-|tail	tail protein	tail	B8R656	Lactobacillus_phage	87.3	4.5e-94
WP_048587918.1|986021_986651_-|tail	tail protein	tail	B8R655	Lactobacillus_phage	94.7	3.0e-109
WP_048598139.1|986650_987040_-	DUF806 family protein	NA	B8R654	Lactobacillus_phage	92.1	1.2e-60
WP_034535677.1|987026_987485_-	hypothetical protein	NA	B8R653	Lactobacillus_phage	90.1	1.0e-74
WP_006588853.1|987477_987849_-|head	phage head closure protein	head	B8R652	Lactobacillus_phage	96.7	3.6e-62
WP_048587916.1|987832_988132_-	hypothetical protein	NA	A0A0M7RDR5	Lactobacillus_phage	39.6	2.3e-11
WP_075362469.1|988151_990005_-|capsid	phage major capsid protein	capsid	B8R651	Lactobacillus_phage	96.9	1.6e-304
WP_006588856.1|990101_991271_-|portal	phage portal protein	portal	B8R650	Lactobacillus_phage	98.4	9.5e-210
WP_075362470.1|991280_993185_-|terminase	terminase large subunit	terminase	B8R649	Lactobacillus_phage	99.1	0.0e+00
WP_006584719.1|993184_993643_-|terminase	phage terminase small subunit P27 family	terminase	B8R648	Lactobacillus_phage	98.0	6.1e-80
WP_048597960.1|993857_994322_-	hypothetical protein	NA	B8R694	Lactobacillus_phage	98.1	4.5e-86
WP_048597951.1|994330_995458_-	SAM-dependent DNA methyltransferase	NA	B8R693	Lactobacillus_phage	98.1	2.7e-217
WP_015995128.1|996122_996527_-	hypothetical protein	NA	B8R691	Lactobacillus_phage	100.0	1.0e-70
WP_144798809.1|996432_996888_-	ArpU family transcriptional regulator	NA	B8R690	Lactobacillus_phage	99.3	9.4e-81
WP_075362472.1|997102_997345_-	hypothetical protein	NA	B8R688	Lactobacillus_phage	98.8	9.9e-37
WP_015995124.1|997334_998117_-	hypothetical protein	NA	B8R687	Lactobacillus_phage	100.0	9.4e-129
WP_015995123.1|998124_998436_-	hypothetical protein	NA	B8R686	Lactobacillus_phage	100.0	3.9e-54
WP_048597949.1|998432_998852_-	RusA family crossover junction endodeoxyribonuclease	NA	B8R685	Lactobacillus_phage	100.0	2.5e-48
WP_075362473.1|998841_999447_-	hypothetical protein	NA	B8R684	Lactobacillus_phage	95.5	1.9e-108
WP_075362520.1|999456_999912_-	single-stranded DNA-binding protein	NA	B8R683	Lactobacillus_phage	96.7	3.7e-77
WP_075362474.1|999926_1000733_-	ATP-binding protein	NA	B8R682	Lactobacillus_phage	88.5	4.5e-134
WP_075362521.1|1000716_1001151_-	hypothetical protein	NA	B8R681	Lactobacillus_phage	89.6	5.6e-75
WP_075362475.1|1001153_1001903_-	Rep protein	NA	B8R680	Lactobacillus_phage	91.6	7.2e-102
WP_075362476.1|1002011_1002221_-	hypothetical protein	NA	B8R679	Lactobacillus_phage	84.1	7.2e-28
WP_048597938.1|1002238_1002571_-	DUF771 domain-containing protein	NA	B8R678	Lactobacillus_phage	98.2	1.9e-59
WP_048597937.1|1002573_1003098_-	hypothetical protein	NA	B8R677	Lactobacillus_phage	92.0	4.9e-89
WP_048597935.1|1003090_1003417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048597933.1|1003598_1003811_+	hypothetical protein	NA	Q9T1I9	Lactobacillus_phage	44.1	1.2e-06
WP_048597931.1|1003848_1004103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075362477.1|1004290_1005130_-	phage repressor protein/antirepressor Ant	NA	B8R674	Lactobacillus_phage	84.6	5.9e-129
WP_006584696.1|1005131_1005377_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_006588012.1|1005539_1006217_+	helix-turn-helix domain-containing protein	NA	B8R672	Lactobacillus_phage	67.1	8.6e-62
WP_006584695.1|1006299_1006830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006588013.1|1006916_1008020_+|integrase	tyrosine-type recombinase/integrase	integrase	B8R670	Lactobacillus_phage	78.8	4.8e-163
WP_006588015.1|1008745_1009669_-	DUF4065 domain-containing protein	NA	Q9AZG0	Lactococcus_phage	35.0	1.2e-45
1008056:1008080	attR	ATTGTGCCAAAATTGTGCCAACTTT	NA	NA	NA	NA
WP_006584480.1|1009889_1011068_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP018809	Lactobacillus jensenii strain SNUV360 chromosome, complete genome	1672949	1035509	1107643	1672949	transposase,integrase	Lactobacillus_phage(25.0%)	58	1027233:1027249	1084499:1084515
1027233:1027249	attL	AATATTCCAATCCCAAT	NA	NA	NA	NA
WP_006584480.1|1035509_1036688_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_075362480.1|1037346_1038534_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006588596.1|1038577_1039501_+|integrase	site-specific integrase	integrase	A8ATM2	Listeria_phage	49.0	6.4e-84
WP_075362522.1|1039537_1040743_-	type I restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_006588599.1|1040837_1042490_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	50.1	2.1e-130
WP_075362481.1|1042508_1045730_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	22.3	5.4e-21
WP_006584667.1|1045935_1046145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006584666.1|1046172_1046412_+	DUF2922 domain-containing protein	NA	NA	NA	NA	NA
WP_006584665.1|1046760_1047123_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_006584664.1|1047270_1048416_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	34.4	2.0e-34
WP_006584663.1|1048530_1049499_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_006588059.1|1049514_1049667_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_006584661.1|1049937_1051749_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	Q76DQ7	Chlorella_virus	37.2	2.8e-91
WP_006584660.1|1052063_1052711_+	pyroglutamyl-peptidase I	NA	NA	NA	NA	NA
WP_006584659.1|1052795_1054538_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_006584658.1|1054704_1055595_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006588601.1|1055776_1057564_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	23.0	1.6e-06
WP_006588602.1|1057560_1058454_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075362482.1|1058675_1060484_+	FAD-binding protein	NA	A0A2P0ZL82	Lactobacillus_phage	39.7	7.2e-07
WP_006584655.1|1060497_1061913_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_006588056.1|1062342_1063044_-	aquaporin family protein	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	31.7	8.1e-31
WP_006584654.1|1063045_1063420_-	PTS-dependent dihydroxyacetone kinase phosphotransferase subunit DhaM	NA	NA	NA	NA	NA
WP_006584653.1|1063419_1064001_-	dihydroxyacetone kinase subunit L	NA	NA	NA	NA	NA
WP_006588055.1|1064014_1065010_-	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_006584652.1|1065114_1065651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006588054.1|1065684_1065897_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006588053.1|1065921_1066770_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_075362483.1|1066971_1072914_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_006584480.1|1073476_1074655_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_075362484.1|1074676_1075678_-	hydroxyacid dehydrogenase	NA	M1HBE3	Paramecium_bursaria_Chlorella_virus	25.8	7.3e-17
WP_006584648.1|1075695_1076550_-	nitrate reductase	NA	NA	NA	NA	NA
WP_006588181.1|1076564_1078064_-	YfcC family protein	NA	NA	NA	NA	NA
WP_006588180.1|1078089_1079028_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_006588179.1|1079156_1080803_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_006584644.1|1080849_1081830_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_006588178.1|1081831_1082698_-	anion permease	NA	NA	NA	NA	NA
WP_006584642.1|1082801_1084109_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_006588177.1|1084120_1085482_-	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	24.7	1.8e-26
1084499:1084515	attR	AATATTCCAATCCCAAT	NA	NA	NA	NA
WP_006584641.1|1085601_1086309_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006584480.1|1086377_1087556_-|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_006588365.1|1087780_1088767_-	D-ribose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006584639.1|1088785_1089742_-	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_006584638.1|1089743_1091222_-	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.0	7.0e-16
WP_006584637.1|1091243_1091639_-	D-ribose pyranase	NA	NA	NA	NA	NA
WP_006584636.1|1091638_1092565_-	ribokinase	NA	NA	NA	NA	NA
WP_006584635.1|1092764_1093778_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006584634.1|1093802_1094780_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_006588366.1|1094877_1096344_-	FAD-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	22.6	4.2e-13
WP_075362485.1|1096473_1096929_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006584632.1|1097398_1098853_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_006584631.1|1099291_1099471_-	CsbD family protein	NA	NA	NA	NA	NA
WP_075362486.1|1099572_1100451_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006588369.1|1100854_1102540_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_006588370.1|1102677_1103853_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_006584627.1|1104811_1105846_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_006584626.1|1105947_1106391_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006584625.1|1106551_1106779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006588034.1|1106803_1107643_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP018809	Lactobacillus jensenii strain SNUV360 chromosome, complete genome	1672949	1423985	1435807	1672949	tRNA	Klosneuvirus(14.29%)	9	NA	NA
WP_006585697.1|1423985_1426622_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	33.0	3.0e-62
WP_006588237.1|1426848_1428207_-	DEAD/DEAH box helicase	NA	A0A1B1IS59	uncultured_Mediterranean_phage	31.4	5.2e-50
WP_006585695.1|1428199_1429159_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	G3MA01	Bacillus_virus	26.3	1.5e-14
WP_006588817.1|1429218_1430334_-	DNA polymerase IV	NA	O64031	Bacillus_phage	23.8	7.1e-13
WP_075362507.1|1430333_1431782_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	31.7	3.6e-57
WP_006585692.1|1431872_1432247_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_006585691.1|1432315_1433329_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	30.8	6.2e-08
WP_006588236.1|1433357_1433939_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_075362508.1|1433941_1435807_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	33.1	6.9e-61
