The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018900	Campylobacter coli strain YH502 chromosome, complete genome	1718974	1199436	1279587	1718974	tail,integrase,transposase,tRNA,terminase,plate	Campylobacter_phage(37.5%)	98	1197523:1197546	1220737:1220760
1197523:1197546	attL	ACGATCAAAAAATGATTTTTAAAG	NA	NA	NA	NA
WP_002777597.1|1199436_1200462_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002777599.1|1200464_1201418_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_002777607.1|1201414_1201879_-	acetolactate synthase small subunit	NA	NA	NA	NA	NA
WP_002777609.1|1201875_1203576_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	30.3	2.4e-60
WP_002777611.1|1203653_1204097_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	37.3	9.7e-14
WP_002777613.1|1204113_1205133_-	bifunctional 3,4-dihydroxy-2-butanone 4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	36.7	1.4e-60
WP_075395223.1|1205618_1206218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075395224.1|1206224_1206893_-	hypothetical protein	NA	X2KRC9	Campylobacter_phage	42.4	6.5e-46
WP_075395225.1|1207030_1207231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075395226.1|1207231_1209304_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002806833.1|1209474_1210398_+	AAA family ATPase	NA	A0A2H4JAW1	uncultured_Caudovirales_phage	24.5	3.9e-09
WP_002795448.1|1210400_1210592_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002824157.1|1210588_1210774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791419.1|1210906_1211248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002806832.1|1211354_1211840_+	host-nuclease inhibitor protein Gam	NA	A0A2K9VGT9	Faecalibacterium_phage	34.0	3.2e-18
WP_002903050.1|1211836_1212049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002873717.1|1212114_1212387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791413.1|1212383_1212770_+	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	56.4	2.7e-36
WP_002793909.1|1212878_1213841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|1213837_1214107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002793908.1|1214106_1214799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002793907.1|1214795_1215245_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_075395227.1|1216321_1216606_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_002784521.1|1216602_1217580_-|tail	tail protein	tail	A0A219Y9Y2	Aeromonas_phage	25.3	1.1e-12
WP_002834648.1|1217573_1217765_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002784519.1|1217757_1218132_-|tail	tail protein	tail	NA	NA	NA	NA
WP_057036859.1|1218257_1219493_-	hypothetical protein	NA	Q6QIB9	Burkholderia_phage	34.7	1.2e-29
WP_075395228.1|1219495_1220866_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	25.5	7.6e-17
1220737:1220760	attR	CTTTAAAAATCATTTTTTGATCGT	NA	NA	NA	NA
WP_002794188.1|1220875_1222546_-|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	41.2	1.1e-91
WP_002784511.1|1222545_1223028_-	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002784509.1|1223020_1223479_-	DUF1320 domain-containing protein	NA	NA	NA	NA	NA
WP_002872711.1|1223594_1224572_-	hypothetical protein	NA	R9TRN2	Rhizobium_phage	23.4	4.3e-06
WP_002784505.1|1224574_1225102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827123.1|1225104_1225920_-	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002784501.1|1225921_1226356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784499.1|1226503_1226893_+	DUF882 domain-containing protein	NA	A0A1X9Q0V8	Human_gokushovirus	46.3	1.1e-21
WP_002791390.1|1226903_1227245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784496.1|1227241_1227490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784492.1|1227601_1227916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_039332519.1|1227915_1228548_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	35.5	7.1e-10
WP_002795238.1|1228556_1228748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002795239.1|1228744_1229035_+|plate	baseplate assembly protein	plate	Q8H9N4	Vibrio_phage	40.8	2.7e-09
WP_075395229.1|1229031_1230198_+|plate	baseplate assembly protein	plate	Q8H9N3	Vibrio_phage	24.6	1.8e-14
WP_075395230.1|1230194_1230815_+|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	94.0	2.2e-56
WP_075395231.1|1230814_1231849_+|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	88.8	2.6e-78
WP_002784668.1|1231858_1232494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784666.1|1232493_1234251_+	radical SAM protein	NA	NA	NA	NA	NA
WP_002789987.1|1234243_1234630_+	DUF1353 domain-containing protein	NA	A7YGM3	Campylobacter_phage	88.4	9.2e-61
WP_075395232.1|1234626_1235640_+	hypothetical protein	NA	A7YGH6	Campylobacter_phage	95.8	8.3e-186
WP_002784660.1|1235650_1236844_+|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	99.5	8.2e-201
WP_002794205.1|1236867_1237377_+|tail	tail protein	tail	A7YGZ4	Campylobacter_phage	99.4	5.6e-90
WP_002791367.1|1237480_1237720_+|tail	phage tail assembly protein	tail	A7YG75	Campylobacter_phage	89.9	1.5e-08
WP_002791365.1|1237831_1238137_-	hypothetical protein	NA	A7YG88	Campylobacter_phage	90.1	1.9e-32
WP_002791362.1|1238178_1240512_+|tail	phage tail tape measure protein	tail	A7YGE8	Campylobacter_phage	89.8	0.0e+00
WP_075395233.1|1240515_1241004_+	virion morphogenesis protein	NA	A7YGE7	Campylobacter_phage	98.1	3.8e-88
WP_075395274.1|1241205_1242021_+	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	94.5	5.7e-145
WP_002784648.1|1242414_1242609_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	96.9	1.1e-27
WP_002784647.1|1242618_1242939_-	hypothetical protein	NA	A7YG71	Campylobacter_phage	97.2	1.6e-50
WP_002784646.1|1243019_1243649_-	S24 family peptidase	NA	A7YG70	Campylobacter_phage	98.2	4.8e-59
WP_075395234.1|1244595_1245939_+	potassium transporter	NA	NA	NA	NA	NA
WP_002777618.1|1245951_1246602_+	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002777619.1|1246602_1247274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002777621.1|1247279_1247906_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002782010.1|1247902_1249138_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_002777625.1|1249137_1250529_-|tRNA	glutamate--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	27.1	3.4e-12
WP_002777626.1|1250593_1251409_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002777627.1|1251436_1252768_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_002777628.1|1252769_1253225_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_002788404.1|1253382_1253943_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	60.6	9.6e-59
WP_002777630.1|1253992_1254997_+	UDP-N-acetylglucosamine 4,6-dehydratase (inverting)	NA	A0A2P1ELS8	Moumouvirus	39.6	1.4e-44
WP_002788406.1|1254998_1256129_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine transaminase	NA	A0A2D2W2B8	Stenotrophomonas_phage	31.0	6.3e-17
WP_002800910.1|1256097_1257438_+	DUF4910 domain-containing protein	NA	NA	NA	NA	NA
WP_002786088.1|1257420_1258164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002781997.1|1258254_1258485_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002791675.1|1258481_1259375_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002791673.1|1259367_1259784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_057993178.1|1259780_1261343_+	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_002777640.1|1261332_1262394_+	beta-ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_002777644.1|1262393_1262615_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_075395235.1|1262628_1263843_-	DUF2920 family protein	NA	NA	NA	NA	NA
WP_024266024.1|1263855_1264431_-	DUF2920 family protein	NA	NA	NA	NA	NA
WP_154021639.1|1264451_1265069_-	DUF2920 family protein	NA	NA	NA	NA	NA
WP_154021644.1|1265081_1265669_-	DUF2920 family protein	NA	NA	NA	NA	NA
WP_075395237.1|1265701_1266310_-	DUF2920 family protein	NA	NA	NA	NA	NA
WP_002801024.1|1266370_1267879_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	29.4	3.5e-39
WP_002790437.1|1267871_1268597_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002777655.1|1268596_1269316_+	formyl transferase	NA	NA	NA	NA	NA
WP_002777686.1|1269317_1269545_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002805054.1|1272042_1272615_-	DUF2920 family protein	NA	NA	NA	NA	NA
WP_148562720.1|1272635_1273253_-	DUF2920 family protein	NA	NA	NA	NA	NA
WP_002777693.1|1273332_1274031_+	pseudaminic acid cytidylyltransferase	NA	A0A1B1IVD3	uncultured_Mediterranean_phage	28.2	1.4e-06
WP_002784879.1|1274014_1274839_+	UDP-2,4-diacetamido-2,4, 6-trideoxy-beta-L-altropyranose hydrolase	NA	NA	NA	NA	NA
WP_002781802.1|1274835_1275309_+	UDP-4-amino-4, 6-dideoxy-N-acetyl-beta-L-altrosamine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002781801.1|1275273_1276020_-	imidazole glycerol phosphate synthase subunit HisF	NA	A0A1V0SIZ6	Klosneuvirus	23.5	1.9e-06
WP_154021640.1|1276020_1276626_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_058001906.1|1276622_1277759_-	pseudaminic acid biosynthesis protein PseA	NA	NA	NA	NA	NA
WP_002781047.1|1277897_1279097_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1S5RG77	Helicobacter_phage	54.7	4.6e-111
WP_002781049.1|1279158_1279587_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RG71	Helicobacter_phage	76.8	2.3e-57
