The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP016972	Mycobacterium tuberculosis H37Ra chromosome, complete genome	4426109	890431	949004	4426109	tRNA,transposase,bacteriocin,protease	Burkholderia_virus(16.67%)	54	NA	NA
WP_087902221.1|890431_891692_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935676.1|891747_892842_+|transposase	IS110-like element IS1547 family transposase	transposase	NA	NA	NA	NA
WP_003404092.1|892831_893629_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_003404098.1|893625_894633_-	Dyp-type peroxidase	NA	NA	NA	NA	NA
WP_003916725.1|894677_895979_+	M18 family aminopeptidase	NA	NA	NA	NA	NA
WP_003898592.1|895990_896338_+	VOC family protein	NA	NA	NA	NA	NA
WP_003404111.1|896331_896988_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003404114.1|897179_899444_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	64.3	8.1e-274
WP_003404117.1|899440_900070_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003404120.1|900190_901147_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_003898594.1|901091_902690_-	exopolysaccharide phosphotransferase CpsY	NA	NA	NA	NA	NA
WP_003404127.1|902994_903384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404129.1|903470_905054_+	amidophosphoribosyltransferase	NA	A0A1B1ISH6	uncultured_Mediterranean_phage	30.6	2.6e-45
WP_003404132.1|905084_906179_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	37.3	2.3e-56
WP_003404135.1|906264_906447_-	DUF3073 domain-containing protein	NA	NA	NA	NA	NA
WP_003404137.1|906593_907700_-	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003916726.1|907782_908652_+	aminodeoxychorismate lyase	NA	NA	NA	NA	NA
WP_003898596.1|908697_909378_-	FABP family protein	NA	NA	NA	NA	NA
WP_003404278.1|909540_909843_-	DUF1416 domain-containing protein	NA	NA	NA	NA	NA
WP_003404293.1|909844_910678_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003898598.1|910970_911393_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_003404298.1|911389_912202_-	DUF2993 domain-containing protein	NA	NA	NA	NA	NA
WP_003898599.1|912331_913099_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	31.5	3.1e-15
WP_003404307.1|913095_914043_+	mycothiol synthase	NA	NA	NA	NA	NA
WP_003404312.1|914085_914862_+	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.1	1.6e-16
WP_003404314.1|914917_915559_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_003898600.1|915616_917671_-	LCP family protein	NA	NA	NA	NA	NA
WP_003898601.1|917836_919006_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003404321.1|919093_920110_-	acyl-ACP desaturase	NA	NA	NA	NA	NA
WP_003404326.1|920271_920913_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003898602.1|920993_922049_+	DUF2236 domain-containing protein	NA	NA	NA	NA	NA
WP_003404335.1|922100_922493_-	Ni(II)/Co(II)-sensing metalloregulatory transcriptional repressor KmtR	NA	NA	NA	NA	NA
WP_003404336.1|922550_922973_-	nucleoside deaminase	NA	NA	NA	NA	NA
WP_003916729.1|922934_923225_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_003404349.1|923329_924235_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404352.1|924253_925069_-	TIGR04255 family protein	NA	NA	NA	NA	NA
WP_010886090.1|929196_931845_-	PE family protein	NA	NA	NA	NA	NA
WP_003404362.1|932312_932957_+	sensor domain-containing protein	NA	NA	NA	NA	NA
WP_003898607.1|932937_933489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003906455.1|933638_934292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003404368.1|934362_935391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003898609.1|936079_936850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404373.1|936936_937749_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003404376.1|937816_938677_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_003404379.1|938952_939195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003404382.1|939471_940764_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404384.1|940747_941752_+	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_003404388.1|941815_942466_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003898611.1|942549_943827_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003404392.1|944039_945554_-	multicopper oxidase MmcO	NA	NA	NA	NA	NA
WP_003901025.1|945702_946095_+	lipoprotein LpqS	NA	NA	NA	NA	NA
WP_009935595.1|946297_947416_+	PLP-dependent cysteine synthase family protein	NA	NA	NA	NA	NA
WP_003404402.1|947415_948675_+	MFS transporter	NA	NA	NA	NA	NA
WP_003404404.1|948671_949004_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP016972	Mycobacterium tuberculosis H37Ra chromosome, complete genome	4426109	1989536	2008510	4426109	transposase	Burkholderia_virus(83.33%)	13	NA	NA
WP_087902221.1|1989536_1990798_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_003899005.1|1992791_1993931_+	sulfite oxidase	NA	NA	NA	NA	NA
WP_003916884.1|1994131_1996969_+	RND family transporter	NA	NA	NA	NA	NA
WP_003915976.1|1997094_1997478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|1997482_1998744_-|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009934708.1|1998779_1999304_+	cutinase family protein	NA	NA	NA	NA	NA
WP_010886129.1|2002891_2004400_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_003899008.1|2004409_2004793_-	DUF5073 domain-containing protein	NA	NA	NA	NA	NA
WP_003899009.1|2004792_2005581_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003899493.1|2005890_2006217_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	46.1	4.4e-16
WP_127519098.1|2006267_2007227_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	56.7	2.3e-60
WP_087902221.1|2007001_2008262_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_012054182.1|2008129_2008510_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	58.5	5.7e-15
>prophage 3
NZ_CP016972	Mycobacterium tuberculosis H37Ra chromosome, complete genome	4426109	2954352	2989718	4426109	tRNA,head,protease,integrase,transposase,terminase,capsid	Tupanvirus(11.11%)	41	2983153:2983180	2994135:2994162
WP_003413486.1|2954352_2956431_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	2.5e-104
WP_003413487.1|2956539_2956767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009938541.1|2956763_2958149_-	PE family protein	NA	NA	NA	NA	NA
WP_003413569.1|2958493_2958994_+	DUF1990 family protein	NA	NA	NA	NA	NA
WP_003413574.1|2959010_2959451_-	DoxX family membrane protein	NA	NA	NA	NA	NA
WP_003901437.1|2959597_2960275_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003413583.1|2960259_2960613_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_003413586.1|2960625_2961051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003413588.1|2961047_2961722_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003413589.1|2961799_2962621_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_003413592.1|2962756_2963650_+	universal stress protein	NA	NA	NA	NA	NA
WP_003413594.1|2963652_2964471_-	universal stress protein	NA	NA	NA	NA	NA
WP_003899401.1|2964485_2965667_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_003413598.1|2965725_2966157_-	CBS domain-containing protein	NA	A0A2I6B2H4	Macacine_betaherpesvirus	100.0	1.9e-75
WP_003899402.1|2966670_2967912_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003899403.1|2968221_2968584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413610.1|2968930_2970055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413614.1|2970056_2970596_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003413616.1|2970735_2972034_+	RNA-splicing ligase RtcB	NA	A2RQD0	Archaeal_BJ1_virus	43.3	3.8e-90
WP_003413619.1|2972072_2972354_-	DUF1876 domain-containing protein	NA	NA	NA	NA	NA
WP_003413625.1|2972498_2972984_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_003902325.1|2973010_2973268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009938544.1|2973268_2975605_-	PE family protein	NA	NA	NA	NA	NA
WP_003899405.1|2975633_2975876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003899406.1|2975876_2976554_+	membrane protein	NA	NA	NA	NA	NA
WP_003413654.1|2976749_2977406_+	DedA family protein	NA	NA	NA	NA	NA
WP_003413657.1|2977568_2978015_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_003413663.1|2978189_2978522_-	YnfA family protein	NA	NA	NA	NA	NA
WP_003413665.1|2978641_2979001_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413675.1|2979102_2979561_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_003899407.1|2979696_2980077_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003413686.1|2980073_2981570_+	ACR3 family arsenite efflux transporter	NA	A0A2H4PQT9	Staphylococcus_phage	39.7	5.1e-14
WP_085972563.1|2981759_2981996_+	antitoxin MazE family protein	NA	NA	NA	NA	NA
WP_077365235.1|2982068_2982242_+	hypothetical protein	NA	NA	NA	NA	NA
2983153:2983180	attL	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
WP_003899409.1|2983286_2983718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003900538.1|2983714_2984713_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	47.8	7.4e-62
WP_003900539.1|2984726_2985191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087902221.1|2985323_2986584_+|transposase	IS3-like element IS987 family transposase	transposase	Q8W6R2	Burkholderia_virus	59.1	9.6e-83
WP_009935349.1|2986958_2988398_-|capsid	phage major capsid protein	capsid	A0A1B3AYS4	Gordonia_phage	40.6	1.4e-66
WP_003899412.1|2988405_2988939_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	32.9	3.1e-06
WP_003899413.1|2989091_2989718_-|terminase	phage terminase small subunit P27 family	terminase	V9H0V4	Actinophage	47.2	1.6e-17
2994135:2994162	attR	ACTGGTTCAATCCCAGTATCGCGCACCA	NA	NA	NA	NA
