The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP009249	Corynebacterium phocae strain M408/89/1 chromosome, complete genome	2779609	37968	99911	2779609	protease,transposase	Enterobacteria_phage(10.0%)	53	NA	NA
WP_150385822.1|37968_38334_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_084559600.1|38393_38753_+|transposase	transposase	transposase	Q6H9S3	Enterobacteria_phage	50.6	1.2e-14
WP_150385831.1|39020_39158_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075732203.1|39218_39578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084559602.1|39911_40349_+|transposase	IS3 family transposase	transposase	A0A1B3AZE5	Gordonia_phage	37.4	3.9e-15
WP_084559603.1|40338_40515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084559604.1|40474_40702_+|transposase	transposase	transposase	Q8W6R2	Burkholderia_virus	45.8	1.3e-06
WP_084559605.1|40786_42874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150385824.1|42928_46759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732207.1|46814_47195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732213.1|48019_48397_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_075732215.1|48417_48714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732217.1|48982_49963_+	biotin synthase BioB	NA	NA	NA	NA	NA
WP_075732219.1|49962_50223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732221.1|50233_51151_+	NAD-dependent protein deacetylase	NA	S5M4R0	Bacillus_phage	23.8	1.5e-08
WP_084559607.1|51147_52119_-	triacylglycerol lipase	NA	NA	NA	NA	NA
WP_075732223.1|52519_53914_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_075732225.1|53964_54480_+	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_075732227.1|54645_55293_+	biliverdin-producing heme oxygenase	NA	M4PNB9	Cyanophage	34.0	1.6e-28
WP_075732229.1|55481_55967_+	ferritin	NA	NA	NA	NA	NA
WP_075732231.1|56278_57328_-	ROK family transcriptional regulator	NA	NA	NA	NA	NA
WP_075732233.1|57395_58100_-	NAD-dependent deacylase	NA	A0A2I7QWN6	Vibrio_phage	32.2	3.7e-15
WP_075732235.1|58120_58690_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	34.5	1.9e-17
WP_075732237.1|58700_60344_+	DUF885 domain-containing protein	NA	NA	NA	NA	NA
WP_075732239.1|60390_61428_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_150385825.1|61506_62169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732243.1|62229_63498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150385826.1|64010_65585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732246.1|65676_67434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732250.1|70069_70825_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_075732252.1|70821_73053_-	ATP-dependent RNA helicase	NA	A0A1V0SH94	Hokovirus	25.8	1.4e-23
WP_150385827.1|73246_73585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732255.1|73608_74874_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_169833281.1|76719_78675_+	AAA domain-containing protein	NA	NA	NA	NA	NA
WP_169833282.1|78736_79828_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_075732261.1|81000_81399_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075732263.1|81642_82461_+	DUF3039 domain-containing protein	NA	NA	NA	NA	NA
WP_084559792.1|84341_84587_-	DUF1998 domain-containing protein	NA	NA	NA	NA	NA
WP_075732265.1|84629_85295_+	alpha-ketoglutarate-dependent dioxygenase AlkB	NA	NA	NA	NA	NA
WP_075732267.1|85291_85996_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_075732269.1|86491_86821_+	YbjQ family protein	NA	M4STD1	Rhodobacter_phage	40.0	2.7e-13
WP_075732271.1|86869_87163_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_075732273.1|87282_88611_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075732275.1|88614_89391_-	3-oxoacyl-ACP reductase	NA	NA	NA	NA	NA
WP_157105744.1|89989_90154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732277.1|90171_90474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732279.1|90905_91751_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_075732281.1|91747_92362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084559793.1|92467_93499_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075732285.1|93564_94719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075732287.1|94859_97544_-	fibronectin type III domain-containing protein	NA	NA	NA	NA	NA
WP_150385690.1|97677_98406_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	30.1	5.6e-19
WP_075732289.1|98402_99911_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP009249	Corynebacterium phocae strain M408/89/1 chromosome, complete genome	2779609	131269	198338	2779609	protease,holin,transposase,tRNA	Escherichia_phage(28.57%)	54	NA	NA
WP_075732322.1|131269_132118_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_075732324.1|132114_132726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075732326.1|132758_134675_+	peptidase M13	NA	A0A1V0SHG2	Klosneuvirus	34.7	3.2e-69
WP_084559795.1|134680_135613_-	restriction endonuclease	NA	A0A096XEP0	Escherichia_phage	39.1	2.7e-66
WP_075732330.1|135631_137101_-	N-6 DNA methylase	NA	A0A2L1IV91	Escherichia_phage	35.9	1.7e-62
WP_075732332.1|137216_138062_+	alpha/beta hydrolase fold domain-containing protein	NA	NA	NA	NA	NA
WP_075732334.1|138042_138450_-	GtrA family protein	NA	NA	NA	NA	NA
WP_075732336.1|138464_139328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075732338.1|139404_139683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732340.1|139742_141158_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_075732342.1|141178_141937_+	decaprenylphospho-beta-D-erythro-pentofuranosid- 2-ulose 2-reductase	NA	NA	NA	NA	NA
WP_084559611.1|142061_144092_+	arabinofuranosyltransferase	NA	NA	NA	NA	NA
WP_084559612.1|144391_145402_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_075736302.1|145622_148892_+	arabinosyltransferase	NA	NA	NA	NA	NA
WP_075732346.1|149155_153991_+	putative Ig domain-containing protein	NA	NA	NA	NA	NA
WP_075732348.1|154006_156484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732350.1|156666_157572_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_075732352.1|157632_158043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075732353.1|158185_158533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075732355.1|158723_159533_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.2	1.3e-08
WP_075736304.1|159542_160391_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075732357.1|160515_161757_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_075732361.1|162652_163609_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_075732362.1|164059_165007_+	Abi family protein	NA	A3QSC6	Clostridium_virus	33.8	1.8e-25
WP_075732364.1|165448_165796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732366.1|165876_166341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732368.1|166508_167012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732370.1|167554_167989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150385640.1|168732_169173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075732372.1|169458_170490_-	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_075732374.1|170458_170866_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_084559796.1|170855_171308_-	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_075732378.1|171319_172468_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_075732380.1|172508_172766_+	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_075732382.1|172879_173272_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_075732384.1|173268_174285_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_075732386.1|174576_175572_+	serine hydrolase	NA	NA	NA	NA	NA
WP_075732390.1|175976_177026_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_075732392.1|177476_179054_+	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_075732394.1|179541_181161_-	transporter	NA	NA	NA	NA	NA
WP_075732396.1|181464_182481_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_075732398.1|182519_183005_+|tRNA	tRNA adenosine deaminase-associated protein	tRNA	NA	NA	NA	NA
WP_075732400.1|183030_183462_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_075736306.1|183472_183685_+	CsbD family protein	NA	NA	NA	NA	NA
WP_075732402.1|184075_186139_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_075732405.1|186519_188922_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_075732407.1|188902_190183_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	33.5	6.4e-58
WP_075732409.1|190409_190832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732411.1|191109_191439_-	carboxypeptidase regulatory-like domain-containing protein	NA	NA	NA	NA	NA
WP_169833283.1|191695_192927_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	44.4	2.6e-56
WP_084559613.1|192930_193341_-|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_075732423.1|196564_196888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150385643.1|197623_198121_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_150385644.1|198173_198338_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP009249	Corynebacterium phocae strain M408/89/1 chromosome, complete genome	2779609	387727	448198	2779609	integrase,transposase,tRNA	Acidithiobacillus_phage(33.33%)	51	438600:438623	448438:448461
WP_075732650.1|387727_389128_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_075732652.1|389140_390022_+	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_075736366.1|390128_391838_+	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_075732654.1|391839_392826_+	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_075732656.1|392835_393528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732658.1|393524_393995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732660.1|394004_395024_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_075732662.1|395024_396377_+	protoporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_075732664.1|398027_399104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732665.1|399222_400059_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075732667.1|400072_400345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150385664.1|400812_402135_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_075732669.1|402136_402745_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_075732671.1|402734_403304_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_075732673.1|403304_404084_+	cytochrome c biogenesis protein CcdA	NA	NA	NA	NA	NA
WP_075732675.1|404098_405727_+	cytochrome c biogenesis protein ResB	NA	NA	NA	NA	NA
WP_075732677.1|405866_406784_+	c-type cytochrome biogenesis protein CcsB	NA	NA	NA	NA	NA
WP_075732679.1|406787_407096_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075732681.1|407052_407265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084559635.1|407919_408228_+	DUF4229 domain-containing protein	NA	NA	NA	NA	NA
WP_150385665.1|408229_409108_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_075732687.1|409112_409913_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_075732689.1|409909_410764_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_075732691.1|410760_411435_-	metal ABC transporter ATP-binding protein	NA	R4TX06	Phaeocystis_globosa_virus	26.9	2.1e-12
WP_075732693.1|411436_412381_-	zinc ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075732697.1|412851_413511_+	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_075732699.1|413503_414643_-	o-succinylbenzoate--CoA ligase	NA	A0A1V0SBX8	Catovirus	23.7	3.9e-06
WP_169833289.1|414632_414788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075732701.1|414798_415722_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_075732703.1|415747_416758_+	o-succinylbenzoate synthase	NA	NA	NA	NA	NA
WP_075732705.1|416947_417484_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_075732707.1|417629_418277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732709.1|418481_420137_+	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_075736370.1|420198_420618_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_169833290.1|420772_422077_+	glycosyltransferase family 1 protein	NA	NA	NA	NA	NA
WP_075736372.1|422163_422808_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_075732711.1|423331_424552_-	geranylgeranyl reductase family protein	NA	NA	NA	NA	NA
WP_075732713.1|424712_425708_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_075732714.1|426462_428271_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_150385666.1|428423_429386_+	class C sortase	NA	NA	NA	NA	NA
WP_150385667.1|429376_430714_+	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_150385668.1|430718_437102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075732720.1|437297_437606_+|transposase	transposase	transposase	NA	NA	NA	NA
438600:438623	attL	TTCACGAACAATGTCATAGCTCTT	NA	NA	NA	NA
WP_075732721.1|438906_440127_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_075732600.1|440096_441440_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	28.3	5.2e-34
WP_084559636.1|441828_443337_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_157105748.1|443333_444062_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	30.1	2.5e-19
WP_075732723.1|444268_444586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157105749.1|444582_445311_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	30.1	2.5e-19
WP_169833291.1|445764_446996_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	44.4	2.6e-56
WP_169833292.1|447259_448198_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
448438:448461	attR	AAGAGCTATGACATTGTTCGTGAA	NA	NA	NA	NA
>prophage 4
NZ_CP009249	Corynebacterium phocae strain M408/89/1 chromosome, complete genome	2779609	747646	755881	2779609		Streptococcus_phage(33.33%)	7	NA	NA
WP_075733182.1|747646_748771_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.4	7.3e-58
WP_075733184.1|748795_749731_+	hypothetical protein	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	33.6	1.2e-08
WP_075733186.1|749734_750640_+	hypothetical protein	NA	M1HFV8	Paramecium_bursaria_Chlorella_virus	28.7	2.9e-12
WP_075733188.1|750783_751947_+	DNA cytosine methyltransferase	NA	I6NLI4	Burkholderia_phage	36.0	2.0e-50
WP_075733190.1|751939_752740_+	GIY-YIG nuclease family protein	NA	I6NP88	Burkholderia_phage	31.7	2.4e-10
WP_075733192.1|752797_754261_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_075733194.1|754576_755881_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	45.7	5.8e-83
>prophage 5
NZ_CP009249	Corynebacterium phocae strain M408/89/1 chromosome, complete genome	2779609	1560843	1616836	2779609	portal,tRNA,capsid,head,terminase,integrase,protease,holin,transposase	Corynebacterium_phage(45.45%)	62	1600868:1600884	1619168:1619184
WP_075734367.1|1560843_1562343_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_084559710.1|1562512_1563166_+	chorismate-binding protein	NA	NA	NA	NA	NA
WP_075732289.1|1563406_1564915_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_150385690.1|1564911_1565640_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	30.1	5.6e-19
WP_150385729.1|1566484_1567279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734371.1|1567921_1569121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084559711.1|1569400_1569919_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_150385733.1|1570026_1570827_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_075734377.1|1570855_1571467_-	DNA polymerase III subunit epsilon	NA	NA	NA	NA	NA
WP_075734379.1|1571466_1573320_-	cyclic nucleotide-binding/CBS domain-containing protein	NA	NA	NA	NA	NA
WP_075734381.1|1573331_1574852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734383.1|1574881_1575901_-	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_075734385.1|1576019_1577606_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	31.2	1.2e-34
WP_150385730.1|1577692_1578643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734387.1|1578593_1580378_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_157105763.1|1580660_1580834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734389.1|1581077_1581317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075734391.1|1581450_1581669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075734393.1|1581754_1582261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075734395.1|1582382_1582631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075734397.1|1582669_1582882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075734399.1|1582963_1583797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075734401.1|1583848_1584268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734405.1|1584667_1584907_-|holin	holin	holin	A0A1P8D5V5	Corynebacterium_phage	45.5	1.7e-09
WP_075734407.1|1584907_1585756_-	N-acetylmuramoyl-L-alanine amidase	NA	D4P733	Rhodococcus_phage	39.5	1.5e-26
WP_075734409.1|1585770_1586868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734411.1|1586864_1587896_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734413.1|1587938_1589918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734415.1|1589914_1590220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150385731.1|1590209_1590818_-	hypothetical protein	NA	A0A1L6BZF8	Pasteurella_phage	47.2	7.5e-41
WP_075734419.1|1590837_1592505_-	hypothetical protein	NA	A0A1L6BZG4	Pasteurella_phage	49.8	1.9e-158
WP_075734421.1|1592511_1593369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734423.1|1593368_1597505_-	hypothetical protein	NA	Q9MBI9	Corynebacterium_phage	47.8	1.3e-120
WP_157105764.1|1597520_1597661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734425.1|1597873_1598272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734427.1|1598359_1599031_-	hypothetical protein	NA	A0A2H4PIX5	Corynebacterium_phage	52.3	6.7e-59
WP_150385732.1|1599052_1599442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734433.1|1599697_1600060_-	hypothetical protein	NA	Q9MBJ6	Corynebacterium_phage	45.3	2.0e-17
WP_150385734.1|1600056_1600563_-	hypothetical protein	NA	A0A1W6JRD8	Corynebacterium_phage	45.2	1.9e-26
WP_075734435.1|1600617_1600812_-	hypothetical protein	NA	NA	NA	NA	NA
1600868:1600884	attL	ATCAGGCCCAGGCGCTC	NA	NA	NA	NA
WP_075732596.1|1601128_1602607_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075734437.1|1602688_1603774_-|capsid	phage major capsid protein	capsid	A0A1W6JRF1	Corynebacterium_phage	47.0	9.1e-82
WP_150385735.1|1603760_1604909_-|head,protease	HK97 family phage prohead protease	head,protease	Q9MBK0	Corynebacterium_phage	54.1	5.5e-93
WP_075734441.1|1604905_1605259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084559714.1|1605255_1606506_-|portal	phage portal protein	portal	A0A1W6JRE1	Corynebacterium_phage	55.1	1.2e-117
WP_157105765.1|1606521_1608159_-	hypothetical protein	NA	Q9MBK3	Corynebacterium_phage	50.9	3.0e-145
WP_075734445.1|1608196_1608517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734447.1|1608520_1608907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084559715.1|1608893_1609724_-	site-specific DNA-methyltransferase	NA	A0A1B3B1U1	Gordonia_phage	46.6	4.9e-51
WP_075734451.1|1609653_1610286_-	ParB N-terminal domain-containing protein	NA	A0A142F2D0	Mycobacterium_phage	65.3	9.5e-39
WP_075734453.1|1610282_1610561_-|terminase	P27 family phage terminase small subunit	terminase	A0A0U4JXM6	Arthrobacter_phage	53.4	1.8e-21
WP_150385736.1|1610544_1611219_-	hypothetical protein	NA	A0A142KC03	Gordonia_phage	33.5	4.7e-28
WP_075734457.1|1611577_1611868_-	HNH endonuclease	NA	A0A1W6JRD4	Corynebacterium_phage	59.8	4.7e-25
WP_075734459.1|1612001_1612595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169833309.1|1612605_1613031_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A1U9WS25	Gordonia_phage	49.2	1.9e-22
WP_075734463.1|1613020_1613365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734465.1|1613364_1613709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_150385737.1|1613724_1614117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734471.1|1614869_1615088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734473.1|1615102_1615603_-	single-stranded DNA-binding protein	NA	A0A0A8WIG9	Clostridium_phage	30.2	1.2e-07
WP_075734475.1|1615602_1615908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075734477.1|1615894_1616836_-	recombinase RecT	NA	A0A160DCX2	Gordonia_phage	37.5	1.6e-37
1619168:1619184	attR	ATCAGGCCCAGGCGCTC	NA	NA	NA	NA
>prophage 6
NZ_CP009249	Corynebacterium phocae strain M408/89/1 chromosome, complete genome	2779609	1883586	1890719	2779609	integrase	Corynebacterium_phage(50.0%)	9	1883383:1883395	1890259:1890271
1883383:1883395	attL	CTTTTTCGCGCCG	NA	NA	NA	NA
WP_075734936.1|1883586_1884375_-	antA/AntB antirepressor family protein	NA	A0A2H4IZX7	uncultured_Caudovirales_phage	42.0	4.5e-30
WP_075734938.1|1884438_1884693_-	hypothetical protein	NA	A0A1L6BZI5	Pasteurella_phage	53.9	2.1e-13
WP_075734940.1|1884878_1885370_+	hypothetical protein	NA	A0A1P8D5Q1	Corynebacterium_phage	38.9	6.7e-16
WP_075734942.1|1885362_1885737_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A1W6JQ88	Corynebacterium_phage	68.1	5.8e-44
WP_150385754.1|1885761_1886286_+	excalibur calcium-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075734944.1|1886332_1886803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075734946.1|1886891_1888001_+|integrase	site-specific integrase	integrase	A0A1W6JQG4	Corynebacterium_phage	47.9	1.8e-93
WP_075734948.1|1888498_1889125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075734950.1|1889309_1890719_-	deoxyribodipyrimidine photo-lyase	NA	A0A1V0CPD8	Kaumoebavirus	28.8	5.0e-40
1890259:1890271	attR	CGGCGCGAAAAAG	NA	NA	NA	NA
>prophage 7
NZ_CP009249	Corynebacterium phocae strain M408/89/1 chromosome, complete genome	2779609	1983109	2056129	2779609	protease,transposase	Moraxella_phage(12.5%)	59	NA	NA
WP_169833316.1|1983109_1983343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075735091.1|1983721_1984834_-	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	24.6	3.2e-13
WP_075735093.1|1986782_1987997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169833317.1|1988124_1989356_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	44.4	4.4e-56
WP_075735097.1|1989548_1989830_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_169833317.1|1989930_1991162_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	44.4	4.4e-56
WP_157105774.1|1991712_1992012_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075735099.1|1992594_1994673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084559746.1|1995098_1995398_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_084559747.1|1995455_1995938_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_075735105.1|1995964_1996915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075735107.1|1997041_1998442_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_075736649.1|2000222_2001260_+	3'-5' exonuclease	NA	A0A1S5SEW3	Streptococcus_phage	35.6	1.4e-18
WP_169833318.1|2001602_2001776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075735111.1|2002191_2003010_+	DUF3800 domain-containing protein	NA	A5X9G9	Aeromonas_virus	39.2	2.6e-41
WP_075735113.1|2003086_2007961_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_075735115.1|2007995_2008754_+	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_075735117.1|2008758_2009565_+	thymidylate synthase	NA	A0A1B3AY68	Gordonia_phage	67.9	1.0e-106
WP_075735119.1|2009564_2010101_+	dihydrofolate reductase	NA	A0A0A8JB64	Ralstonia_phage	37.7	1.7e-20
WP_075735121.1|2010102_2010378_+	NrdH-redoxin	NA	NA	NA	NA	NA
WP_157105775.1|2010396_2010555_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075735123.1|2010592_2010985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075735127.1|2011839_2012988_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_075735129.1|2013593_2014256_-	CAP domain-containing protein	NA	NA	NA	NA	NA
WP_075735131.1|2014351_2015107_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_075735133.1|2015225_2016068_+	DUF1206 domain-containing protein	NA	NA	NA	NA	NA
WP_075735135.1|2016025_2016967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075735137.1|2017021_2018680_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_075735139.1|2018683_2019028_-	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_075735141.1|2019295_2020153_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.0	5.6e-58
WP_075735143.1|2020343_2020700_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_075735145.1|2020842_2022135_-	citrate synthase	NA	NA	NA	NA	NA
WP_075735147.1|2022336_2023473_+	phosphoserine transaminase	NA	NA	NA	NA	NA
WP_075735149.1|2023565_2024564_+	DUF3071 domain-containing protein	NA	NA	NA	NA	NA
WP_075735151.1|2024646_2025516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150385772.1|2025512_2026310_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_075735155.1|2026313_2027717_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	26.9	2.1e-30
WP_075735157.1|2027797_2028445_-	DUF3027 domain-containing protein	NA	NA	NA	NA	NA
WP_075736653.1|2028497_2029334_+	glutaminyl-peptide cyclotransferase	NA	NA	NA	NA	NA
WP_075735159.1|2029340_2029907_+	DUF2771 domain-containing protein	NA	NA	NA	NA	NA
WP_075735161.1|2030121_2030502_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	41.3	4.4e-07
WP_075735164.1|2030957_2031641_+	DUF3235 domain-containing protein	NA	A0A1I9SA30	Rhodococcus_phage	66.4	1.3e-30
WP_075735166.1|2031821_2032007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075735168.1|2032074_2034132_+	helicase-associated domain-containing protein	NA	NA	NA	NA	NA
WP_075735170.1|2034137_2035769_+	DEAD/DEAH box helicase	NA	B2CRJ8	Acidianus_filamentous_virus	23.8	3.8e-15
WP_075735172.1|2035772_2036414_+	DUF3239 domain-containing protein	NA	NA	NA	NA	NA
WP_075735174.1|2036481_2037306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075735176.1|2043548_2044304_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.0	1.2e-16
WP_084559748.1|2044300_2045251_-	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_075735180.1|2045261_2046230_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	34.9	6.1e-53
WP_075735182.1|2046419_2047481_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075735184.1|2048153_2048657_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	48.4	2.5e-34
WP_075735186.1|2048705_2049608_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_075735188.1|2049609_2050299_-	cell division ATP-binding protein FtsE	NA	G9BWD6	Planktothrix_phage	36.3	7.4e-29
WP_075735190.1|2050398_2052009_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_075735192.1|2052034_2053174_-	peptide chain release factor 2	NA	NA	NA	NA	NA
WP_075735194.1|2053234_2054059_+	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_075735196.1|2054051_2054870_+	histidinol-phosphatase	NA	NA	NA	NA	NA
WP_075735198.1|2054977_2056129_-|protease	serine protease	protease	NA	NA	NA	NA
