The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	57712	111017	2176678	transposase,protease	Streptococcus_phage(28.57%)	48	NA	NA
WP_023467187.1|57712_57970_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_075667007.1|58347_59772_-	glutamate synthase subunit beta	NA	NA	NA	NA	NA
WP_075667008.1|59788_64261_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_123799361.1|66022_66292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667010.1|66244_66550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015638871.1|67361_67883_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_023467222.1|67895_68744_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012391143.1|68833_68977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003681833.1|69276_69816_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_003685094.1|69990_70671_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_023467225.1|70671_71283_+	cadmium resistance transporter	NA	NA	NA	NA	NA
WP_075667011.1|71620_72871_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_075667012.1|72949_73402_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	52.3	9.5e-33
WP_012391137.1|73692_74865_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_023466734.1|75798_76362_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_075667013.1|76354_77389_+	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	25.7	5.4e-07
WP_023466738.1|77445_77931_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075667014.1|78340_79399_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.9	3.4e-41
WP_023465756.1|79398_80007_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	39.1	1.4e-26
WP_046025761.1|79993_81187_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	1.9e-96
WP_021349417.1|81179_81650_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	42.9	6.8e-26
WP_003685116.1|82082_82538_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003681857.1|82575_84327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012391124.1|84466_85642_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	41.2	8.4e-89
WP_023465761.1|85653_86727_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.9	2.6e-89
WP_162621133.1|86985_88008_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003681864.1|88099_88723_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_023465763.1|88758_89262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003685127.1|89774_91607_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	26.1	2.5e-23
WP_003681872.1|91674_92760_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	23.5	7.6e-12
WP_023465764.1|92772_93093_-	phosphoribosyl-ATP diphosphatase	NA	NA	NA	NA	NA
WP_003681876.1|93094_93412_-	phosphoribosyl-AMP cyclohydrolase	NA	NA	NA	NA	NA
WP_023465765.1|93381_94167_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_023465766.1|94156_94882_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_012391116.1|94878_95487_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_023465767.1|95486_96071_-	imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_023465768.1|96072_97356_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_003685142.1|97357_97972_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003685146.1|99442_100282_-	histidinol-phosphatase HisJ	NA	NA	NA	NA	NA
WP_023465770.1|101268_101817_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_042513914.1|102197_103484_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_075667015.1|103701_104847_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	27.1	1.8e-19
WP_048340322.1|104958_106815_-	molecular chaperone DnaK	NA	A0A2P1EIW2	Megavirus	45.7	6.5e-136
WP_075667016.1|106851_107439_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_031274283.1|107449_108496_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_015638832.1|108621_108987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667017.1|109827_110706_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	9.8e-42
WP_054173465.1|110729_111017_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	117238	182291	2176678	transposase,tRNA,protease	unidentified_phage(18.18%)	53	NA	NA
WP_075667019.1|117238_118201_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	31.5	2.7e-29
WP_014562320.1|118383_119556_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_075667020.1|119708_120026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035426273.1|120006_121299_-	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	38.8	7.1e-81
WP_015638823.1|121454_122441_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_075667021.1|122598_124293_+	alpha-glucosidase	NA	NA	NA	NA	NA
WP_023466312.1|124301_125639_+	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_075667022.1|126870_127569_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	30.4	7.6e-21
WP_075667023.1|127687_129076_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_003685190.1|129190_130156_-	riboflavin biosynthesis protein RibF	NA	NA	NA	NA	NA
WP_003685192.1|130166_131063_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_003685195.1|131132_131495_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_075667024.1|131507_133823_-	translation initiation factor IF-2	NA	A0A2H4UTS4	Bodo_saltans_virus	24.6	4.3e-20
WP_003681928.1|133827_134151_-	YlxQ-related RNA-binding protein	NA	NA	NA	NA	NA
WP_075667025.1|134143_134446_-	YlxR family protein	NA	NA	NA	NA	NA
WP_003685200.1|134482_135709_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_003681934.1|135728_136208_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_075667026.1|136360_139450_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_003685204.1|139442_140513_-	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_031274905.1|140757_141783_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_075667027.1|141809_143012_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_023467501.1|143021_143768_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_023467499.1|143780_144932_+	acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	3.6e-20
WP_075667028.1|145054_149398_-	PolC-type DNA polymerase III	NA	A0A0K2SUJ2	Clostridium_phage	35.3	1.7e-14
WP_003685216.1|149537_151259_-|tRNA	proline--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	25.3	1.8e-07
WP_023467494.1|151292_152564_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_003681950.1|152585_153374_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_024271689.1|153390_154158_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	34.6	1.1e-17
WP_003685219.1|154290_154851_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003681955.1|155655_156534_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_003681957.1|156624_157404_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_023467491.1|157557_157848_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_012391089.1|157840_158593_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_003685229.1|158688_159321_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_003685231.1|159387_159615_-	YneF family protein	NA	NA	NA	NA	NA
WP_012391088.1|159691_159943_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003685235.1|160098_160725_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	52.9	6.6e-16
WP_023467488.1|160954_162124_-	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_003685238.1|162375_163182_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_003685240.1|163182_164700_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_075667029.1|164692_165427_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_075667030.1|165794_166805_-	mucin-binding protein	NA	NA	NA	NA	NA
WP_187337503.1|166840_169759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667031.1|169830_170139_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_003681984.1|170611_170926_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_003681986.1|170922_171810_-	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_075667032.1|171810_172491_-	serine dehydratase	NA	NA	NA	NA	NA
WP_081378703.1|173262_173586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667036.1|175604_176429_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_075667037.1|176569_178336_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_075667038.1|179598_180477_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	1.2e-42
WP_075667039.1|180500_180788_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075667040.1|181367_182291_+|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	30.0	1.1e-27
>prophage 3
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	192870	296146	2176678	head,protease,transposase,tRNA,tail,capsid,portal,holin,terminase,integrase	Lactobacillus_phage(48.21%)	115	194276:194297	230581:230602
WP_075667045.1|192870_194091_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	45.7	7.6e-93
194276:194297	attL	AAAAAAGGAGAGTACAGGATTT	NA	NA	NA	NA
WP_075667046.1|194565_195480_-	hypothetical protein	NA	A7J2B7	Streptococcus_phage	32.2	3.5e-10
WP_075667047.1|195460_195895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667048.1|196227_197175_-	glycoside hydrolase family 25	NA	U3PJ04	Lactobacillus_phage	29.3	4.8e-26
WP_075667049.1|197149_197626_-|holin	phage holin family protein	holin	A0A097BY69	Enterococcus_phage	35.1	9.1e-10
WP_003686576.1|197691_197940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337505.1|197939_198101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667050.1|198090_202410_-|tail	phage tail protein	tail	A0A0A1ELH9	Lactobacillus_phage	37.7	1.3e-219
WP_035424041.1|202406_203192_-|tail	phage tail family protein	tail	A0A0A1EN95	Lactobacillus_phage	46.0	9.6e-65
WP_075667051.1|203204_206309_-|tail	phage tail tape measure protein	tail	A0A0A1ENQ9	Lactobacillus_phage	87.9	4.1e-167
WP_075667722.1|206292_206649_-	hypothetical protein	NA	A0A0A1EKY4	Lactobacillus_phage	50.4	5.0e-21
WP_023465668.1|206738_207071_-|tail	tail assembly chaperone	tail	A0A0A1ER95	Lactobacillus_phage	76.1	3.8e-39
WP_023465669.1|207085_207676_-|tail	phage tail protein	tail	A0A0A1ELH3	Lactobacillus_phage	82.4	6.9e-84
WP_003686593.1|207691_208090_-	DUF3168 domain-containing protein	NA	A0A0A1EN91	Lactobacillus_phage	64.9	2.1e-44
WP_075667052.1|208086_208455_-	hypothetical protein	NA	A0A0A1ENQ3	Lactobacillus_phage	80.5	1.4e-45
WP_075667053.1|208432_208750_-	hypothetical protein	NA	A0A0A1EKX8	Lactobacillus_phage	52.4	1.9e-24
WP_003686598.1|208733_209129_-|head,tail	phage head-tail connector protein	head,tail	A0A0A1ER91	Lactobacillus_phage	79.7	1.8e-48
WP_075667054.1|209285_210149_-	hypothetical protein	NA	A0A0A1ELG8	Lactobacillus_phage	77.1	5.7e-119
WP_003686602.1|210161_210764_-	DUF4355 domain-containing protein	NA	A0A0A1EN85	Lactobacillus_phage	69.2	5.1e-66
WP_075667055.1|210854_211037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667056.1|211069_212077_-|capsid	minor capsid protein	capsid	A0A0A1EKX3	Lactobacillus_phage	75.2	1.3e-138
WP_075667057.1|212051_213437_-|portal	phage portal protein	portal	A0A0A1ER87	Lactobacillus_phage	76.8	3.9e-210
WP_155772715.1|214700_214856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667058.1|214842_215277_-|terminase	terminase small subunit	terminase	A7J290	Streptococcus_phage	49.0	1.0e-28
WP_075667059.1|215408_216041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667060.1|216048_216234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021349255.1|216628_216835_+	CsbD family protein	NA	NA	NA	NA	NA
WP_075667061.1|216992_217583_-	hypothetical protein	NA	D2IYV7	Enterococcus_phage	33.0	8.1e-24
WP_075667063.1|217800_218286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667064.1|218459_218912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667065.1|218940_219144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667066.1|219167_219650_-	DUF1064 domain-containing protein	NA	A0A1I9KKZ1	Lactobacillus_phage	40.6	3.2e-26
WP_023467091.1|219652_219850_-	helix-turn-helix transcriptional regulator	NA	Q6SE98	Lactobacillus_prophage	41.3	1.6e-05
WP_155772716.1|220459_220606_-	hypothetical protein	NA	A0A0A1ELK7	Lactobacillus_phage	87.2	3.2e-14
WP_075667067.1|220617_220812_-	hypothetical protein	NA	E9LUM9	Lactobacillus_phage	73.3	1.6e-05
WP_187337507.1|220811_220970_-	hypothetical protein	NA	D2KRE6	Lactobacillus_phage	88.5	8.4e-21
WP_075667068.1|220972_221764_-	ATP-binding protein	NA	E9LUM7	Lactobacillus_phage	63.0	2.1e-96
WP_081378667.1|221772_222507_-	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	45.1	6.2e-50
WP_075667070.1|222563_222917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667072.1|223210_223651_-	single-stranded DNA-binding protein	NA	E9LUM5	Lactobacillus_phage	83.6	2.0e-64
WP_075667073.1|223651_224500_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	96.5	2.6e-164
WP_075667074.1|224492_225503_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	91.4	1.0e-159
WP_021349134.1|225748_225937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667076.1|226098_226356_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_021349132.1|226565_226775_-	DUF739 family protein	NA	A0A141E1D4	Streptococcus_phage	67.2	9.4e-20
WP_031284114.1|226919_227357_+	helix-turn-helix domain-containing protein	NA	Q6SEF6	Lactobacillus_prophage	48.5	1.0e-28
WP_075667077.1|227361_227760_+	ImmA/IrrE family metallo-endopeptidase	NA	E9LUL3	Lactobacillus_phage	48.9	1.9e-29
WP_075667078.1|227945_228257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_127429615.1|228228_228846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667080.1|228867_229212_+	hypothetical protein	NA	Q6SEG3	Lactobacillus_prophage	70.1	6.5e-26
WP_075667081.1|229372_230461_+|integrase	tyrosine-type recombinase/integrase	integrase	E9LUK6	Lactobacillus_phage	49.2	2.4e-82
WP_003681998.1|230721_231342_-	hypothetical protein	NA	NA	NA	NA	NA
230581:230602	attR	AAAAAAGGAGAGTACAGGATTT	NA	NA	NA	NA
WP_023466432.1|231442_231889_+	nucleoside 2-deoxyribosyltransferase	NA	A0A1D3SPR3	Enterococcus_phage	36.7	1.4e-20
WP_075667082.1|231910_232900_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_075667083.1|232910_233351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046026069.1|233692_234880_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.6e-37
WP_075667084.1|235706_237296_+	asparagine synthase B	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	40.3	8.9e-102
WP_075667085.1|237493_238633_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	6.7e-43
WP_075667087.1|239493_240354_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_075667088.1|240559_240739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682024.1|240997_242089_+	glycerol dehydrogenase	NA	NA	NA	NA	NA
WP_035426260.1|242239_242587_+	helix-turn-helix transcriptional regulator	NA	E9LUL4	Lactobacillus_phage	42.9	7.8e-11
WP_003682029.1|243289_243598_+	membrane protein	NA	NA	NA	NA	NA
WP_003682030.1|243945_244275_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003682032.1|244274_244556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070447552.1|244566_245103_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075667089.1|245278_246529_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.5e-56
WP_046026072.1|246607_247060_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	51.5	1.2e-32
WP_024500799.1|247349_248159_-	2-keto-4-pentenoate hydratase	NA	NA	NA	NA	NA
WP_003682040.1|248661_249660_+	D-2-hydroxyacid dehydrogenase	NA	M1H502	Paramecium_bursaria_Chlorella_virus	36.3	7.7e-51
WP_003682041.1|249739_250117_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_024500798.1|250448_250970_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.0	2.3e-30
WP_023466447.1|250989_253287_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	2.6e-70
WP_171029993.1|253359_254193_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003682045.1|254219_255152_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_075667090.1|255178_256486_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_003682047.1|256550_258362_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_173031742.1|258639_259371_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-28
WP_012391021.1|259573_259720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003682052.1|259986_260286_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A1S7FYY8	Listeria_phage	51.5	6.9e-24
WP_012391020.1|260285_260879_-	YihA family ribosome biogenesis GTP-binding protein	NA	NA	NA	NA	NA
WP_003682055.1|260892_262143_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	57.1	3.7e-135
WP_003682058.1|262293_263601_-	trigger factor	NA	NA	NA	NA	NA
WP_014562272.1|263771_264962_-	elongation factor Tu	NA	A0A1V0SGC3	Hokovirus	28.2	3.9e-33
WP_003682061.1|265142_266039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015638746.1|266129_267929_-	ribonuclease J	NA	NA	NA	NA	NA
WP_075667091.1|268099_269470_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_003682069.1|269626_269896_-	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_003682071.1|270158_270413_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_075667092.1|270651_271680_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_075667093.1|271697_273935_-	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	31.0	1.6e-27
WP_003682078.1|273935_274415_-	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	56.7	4.1e-34
WP_187337509.1|274469_275138_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012391013.1|275209_276259_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_003686377.1|276242_276764_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	38.0	1.1e-24
WP_003682085.1|276768_277329_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_081378669.1|277331_277628_-	YlbG family protein	NA	NA	NA	NA	NA
WP_023466454.1|277614_278814_-	FtsW/RodA/SpoVE family cell cycle protein	NA	NA	NA	NA	NA
WP_003682090.1|278916_280764_-	translational GTPase TypA	NA	NA	NA	NA	NA
WP_021815875.1|280841_281606_-	inositol monophosphatase family protein	NA	NA	NA	NA	NA
WP_024500785.1|281609_281891_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_003686366.1|282024_282594_+	peptide deformylase	NA	A0A2I7S809	Vibrio_phage	41.3	5.8e-11
WP_046948124.1|282685_283573_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	7.6e-34
WP_046025442.1|283569_284106_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_015638740.1|284199_284646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003682101.1|284772_284988_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_003682102.1|285247_286222_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_003686362.1|286445_286874_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_075667095.1|286906_287893_-	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	33.9	8.1e-37
WP_075667096.1|287963_290510_-	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	29.1	2.4e-32
WP_003682106.1|290510_291200_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003682107.1|291214_291871_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_012391006.1|292079_293012_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_031274672.1|293119_294715_-	amidohydrolase	NA	NA	NA	NA	NA
WP_075667097.1|295012_296146_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	318151	382698	2176678	plate,tRNA,tail,capsid,portal,terminase	Lactobacillus_phage(78.05%)	83	NA	NA
WP_003686320.1|318151_318658_-|tRNA	tRNA (cytidine(34)-2'-O)-methyltransferase	tRNA	NA	NA	NA	NA
WP_070955464.1|318829_319684_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_023466468.1|319795_320824_+	lactonase family protein	NA	NA	NA	NA	NA
WP_075667103.1|320880_321771_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003686313.1|321770_322580_-	NAD kinase	NA	NA	NA	NA	NA
WP_003682160.1|322594_323275_-	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_021815849.1|323437_324064_+	DsbA family protein	NA	NA	NA	NA	NA
WP_003682162.1|324394_325417_-	competence protein	NA	NA	NA	NA	NA
WP_012390991.1|325469_326183_-	adaptor protein MecA	NA	NA	NA	NA	NA
WP_003686304.1|326319_326724_-	transcriptional regulator Spx	NA	NA	NA	NA	NA
WP_021349239.1|327050_327545_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_012390990.1|334852_335503_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_023465611.1|335443_336124_-	TIGR01906 family membrane protein	NA	NA	NA	NA	NA
WP_075667104.1|336104_336887_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_003686077.1|336886_337423_-	YutD family protein	NA	NA	NA	NA	NA
WP_003682876.1|337449_338073_-	metallophosphoesterase family protein	NA	L0LAH5	Bacillus_phage	39.0	6.1e-30
WP_057195275.1|338129_339326_-	acetate kinase	NA	NA	NA	NA	NA
WP_075667105.1|339339_340209_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_031274063.1|340635_341079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023465609.1|341075_341372_-	type II secretion system protein	NA	NA	NA	NA	NA
WP_012390987.1|341331_341817_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_075667106.1|341794_342073_-	competence protein ComGC	NA	NA	NA	NA	NA
WP_075667107.1|342092_342623_-	hypothetical protein	NA	M4SQJ2	Pseudoalteromonas_phage	40.7	5.8e-05
WP_075667108.1|342635_342947_-	hypothetical protein	NA	D2KRD1	Lactobacillus_phage	82.5	8.5e-41
WP_075667109.1|342952_343357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667110.1|343685_344807_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	54.0	3.2e-21
WP_075667724.1|344806_345250_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	45.8	8.7e-23
WP_075667111.1|345249_345573_-	hypothetical protein	NA	D2KRC5	Lactobacillus_phage	74.8	7.0e-38
WP_075667112.1|345591_346287_-	hypothetical protein	NA	E9LUK0	Lactobacillus_phage	65.3	6.1e-63
WP_075667113.1|346300_347422_-|plate	BppU family phage baseplate upper protein	plate	E9LUJ9	Lactobacillus_phage	76.1	4.6e-153
WP_075667114.1|347434_348508_-	SGNH/GDSL hydrolase family protein	NA	E9LUJ8	Lactobacillus_phage	80.1	3.1e-167
WP_075667115.1|348519_348771_-	hypothetical protein	NA	E9LUJ7	Lactobacillus_phage	66.3	5.8e-24
WP_075667116.1|348773_348953_-	hypothetical protein	NA	E9LUJ6	Lactobacillus_phage	87.9	4.0e-19
WP_155772731.1|348945_350757_-	hypothetical protein	NA	E9LUJ5	Lactobacillus_phage	81.0	3.1e-175
WP_075667117.1|350728_352327_-|tail	phage tail protein	tail	D2KRB9	Lactobacillus_phage	77.5	7.3e-245
WP_075667118.1|352338_353154_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	76.0	9.2e-119
WP_075667119.1|353153_356651_-	tape measure protein	NA	D2KRB7	Lactobacillus_phage	84.3	9.0e-256
WP_075667120.1|356664_357261_-	hypothetical protein	NA	O03936	Lactobacillus_phage	49.3	7.8e-43
WP_075667121.1|357265_357703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667122.1|357774_358380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667123.1|358396_358792_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667124.1|358778_359144_-	hypothetical protein	NA	O03933	Lactobacillus_phage	48.6	6.3e-19
WP_075667125.1|359143_359491_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	48.3	3.3e-25
WP_075667126.1|359490_359874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667127.1|359887_360736_-|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	57.7	6.0e-81
WP_075667128.1|360748_361375_-	phage scaffolding protein	NA	I1TLE1	Bacillus_phage	37.7	1.1e-15
WP_075667129.1|361471_362629_-	hypothetical protein	NA	O03929	Lactobacillus_phage	46.1	8.5e-78
WP_081378671.1|362631_364134_-|portal	phage portal protein	portal	U3PCP8	Lactobacillus_phage	56.6	1.1e-154
WP_049184042.1|364195_365527_-|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	67.1	1.7e-175
WP_075667131.1|366054_366597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667132.1|366593_367235_-	DUF4417 domain-containing protein	NA	A0A1S5SDI7	Streptococcus_phage	43.8	1.4e-50
WP_049184034.1|367473_367950_-	hypothetical protein	NA	A0A0A1EL23	Lactobacillus_phage	58.3	3.1e-42
WP_075667133.1|368083_368392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667134.1|368436_368625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667135.1|368614_368968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667136.1|369155_369617_-	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	54.2	2.4e-47
WP_075667137.1|369613_369892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667138.1|369888_370140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667139.1|370152_370632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667140.1|370631_370961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667141.1|370945_371377_-	RusA family crossover junction endodeoxyribonuclease	NA	E9LUN0	Lactobacillus_phage	76.5	1.3e-36
WP_075667142.1|371399_371588_-	hypothetical protein	NA	A0A0A1ERC6	Lactobacillus_phage	82.3	1.3e-20
WP_155772719.1|371574_371733_-	hypothetical protein	NA	A0A0A1ELK7	Lactobacillus_phage	80.8	7.4e-17
WP_075667143.1|372019_372214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337511.1|372335_372494_-	hypothetical protein	NA	D2KRE6	Lactobacillus_phage	82.7	1.6e-19
WP_075667144.1|372495_373299_-	ATP-binding protein	NA	D2KRE5	Lactobacillus_phage	85.0	2.1e-128
WP_075667145.1|373309_374104_-	conserved phage C-terminal domain-containing protein	NA	A0A2H4JEZ8	uncultured_Caudovirales_phage	52.4	1.4e-58
WP_155772720.1|374323_374500_-	hypothetical protein	NA	E9LUM5	Lactobacillus_phage	97.6	3.4e-15
WP_075667146.1|374500_375349_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	96.5	2.0e-164
WP_075667147.1|375341_376340_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	94.6	2.9e-167
WP_075667148.1|376342_376552_-	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	91.3	1.9e-28
WP_187337513.1|376599_376767_-	hypothetical protein	NA	E9LUM1	Lactobacillus_phage	88.7	1.9e-15
WP_075667149.1|376880_377063_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667150.1|377097_377280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667151.1|377338_377566_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_075667152.1|377562_377745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667153.1|377757_378534_-	Rha family transcriptional regulator	NA	E9LUL6	Lactobacillus_phage	67.3	2.5e-97
WP_049183997.1|378546_378777_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_049183995.1|378963_379305_+	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	54.2	2.0e-19
WP_155772721.1|379666_380134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667156.1|380136_380517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081378672.1|380601_381156_+	hypothetical protein	NA	D2KRD4	Lactobacillus_phage	70.7	8.1e-34
WP_075667157.1|381270_382698_+	recombinase family protein	NA	D2KRD2	Lactobacillus_phage	93.2	3.5e-222
>prophage 5
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	406516	476773	2176678	plate,tRNA,tail,capsid,portal,terminase	Lactobacillus_phage(42.86%)	63	NA	NA
WP_003682827.1|406516_409165_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L3D8	Tupanvirus	31.5	3.2e-64
WP_012390972.1|409417_410800_-	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	31.1	1.1e-47
WP_003686029.1|410799_411759_-	bifunctional oligoribonuclease/PAP phosphatase NrnA	NA	NA	NA	NA	NA
WP_003682821.1|411984_412395_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_075667163.1|412477_413407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667164.1|413408_414428_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	29.9	3.1e-07
WP_021349801.1|414438_415041_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_075667165.1|415094_417038_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.5	7.6e-63
WP_075667166.1|417054_419697_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	25.0	2.4e-35
WP_012390969.1|419790_421350_-	ribonuclease Y	NA	NA	NA	NA	NA
WP_024500762.1|421744_422806_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	63.4	8.0e-123
WP_075667167.1|422899_424144_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_003682805.1|424220_424805_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_075667168.1|424820_425825_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075667169.1|425921_427223_-	insulinase family protein	NA	NA	NA	NA	NA
WP_023465918.1|427209_428484_-	insulinase family protein	NA	NA	NA	NA	NA
WP_023465919.1|428739_429597_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012390966.1|429612_430257_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.8	6.7e-32
WP_003686002.1|430271_430919_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003682797.1|431395_431929_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003682795.1|431944_432796_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003682794.1|432914_433925_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_003682793.1|434087_434714_-	JAB domain-containing protein	NA	NA	NA	NA	NA
WP_003682792.1|434766_436089_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_023465654.1|436439_439094_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.4	7.8e-159
WP_003685994.1|439398_439893_-	thiol peroxidase	NA	NA	NA	NA	NA
WP_075667170.1|440815_441220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081378673.1|441334_441943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015638700.1|441978_442410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023465659.1|444151_445294_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	36.8	3.8e-38
WP_003682782.1|445306_446602_-	GntP family permease	NA	NA	NA	NA	NA
WP_003682780.1|446990_448211_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_075667171.1|448223_449372_-	cysteine desulfurase	NA	A0A1X6WFP1	Pacmanvirus	30.5	7.0e-32
WP_023465660.1|449552_451262_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_003682773.1|451591_452197_+	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_075667172.1|453146_453653_-	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	30.1	1.9e-05
WP_021816827.1|453642_453876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337515.1|454016_455129_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A075KJD2	Lactobacillus_phage	38.7	5.8e-39
WP_075667174.1|455130_455565_-	hypothetical protein	NA	A0A0A1ELI5	Lactobacillus_phage	38.8	2.8e-13
WP_155772722.1|455561_455882_-	hypothetical protein	NA	D2KRC5	Lactobacillus_phage	53.8	4.7e-26
WP_021350267.1|456032_456176_-	XkdX family protein	NA	NA	NA	NA	NA
WP_075667176.1|456178_456544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667177.1|456558_456981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667178.1|457085_457958_-|plate	BppU family phage baseplate upper protein	plate	NA	NA	NA	NA
WP_075667179.1|457970_458402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081378676.1|458958_459852_-	collagen-like protein	NA	A0A059PAH9	Leuconostoc_phage	47.3	6.7e-06
WP_075667181.1|459742_460768_-	hypothetical protein	NA	D2KRC0	Lactobacillus_phage	85.3	2.7e-144
WP_075667182.1|460764_462348_-|tail	phage tail protein	tail	D2KRB9	Lactobacillus_phage	63.7	2.0e-202
WP_075667183.1|462359_463166_-|tail	phage tail family protein	tail	D2KRB8	Lactobacillus_phage	53.5	1.2e-78
WP_075667184.1|463165_467494_-	tape measure protein	NA	O03937	Lactobacillus_phage	45.4	1.7e-123
WP_187337517.1|467508_468051_-	hypothetical protein	NA	O03936	Lactobacillus_phage	43.6	9.3e-35
WP_075667186.1|468104_468554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667187.1|468605_469115_-|capsid	capsid protein	capsid	NA	NA	NA	NA
WP_075667188.1|469131_469530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667189.1|469519_469915_-	hypothetical protein	NA	O03933	Lactobacillus_phage	45.2	4.4e-18
WP_081378705.1|469914_470262_-|capsid	capsid protein	capsid	O03932	Lactobacillus_phage	47.9	1.1e-25
WP_075667190.1|470267_470645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667191.1|470659_471520_-|capsid	N4-gp56 family major capsid protein	capsid	A8ASJ6	Listeria_phage	55.6	3.8e-75
WP_075667192.1|471519_472149_-	phage scaffolding protein	NA	A8ASJ5	Listeria_phage	33.0	6.8e-13
WP_075667193.1|472262_473432_-	hypothetical protein	NA	O03929	Lactobacillus_phage	48.6	2.6e-82
WP_075667194.1|473434_474979_-|portal	phage portal protein	portal	Q38341	Lactococcus_phage	54.8	4.2e-157
WP_075667195.1|474996_476301_-|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	64.8	1.7e-167
WP_075667196.1|476287_476773_-	hypothetical protein	NA	L0P6X1	Lactobacillus_phage	35.4	2.2e-11
>prophage 6
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	479869	492422	2176678	transposase,integrase	Lactobacillus_phage(46.67%)	19	473459:473472	495447:495460
473459:473472	attL	GCCGCTATTGCCCT	NA	NA	NA	NA
WP_007123229.1|479869_481090_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	1.4e-94
WP_075667200.1|481577_482273_-	hypothetical protein	NA	Q8SDH3	Lactococcus_phage	35.9	6.2e-15
WP_075667201.1|482284_482866_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	53.5	4.8e-29
WP_075667202.1|482865_483717_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	E9LUM4	Lactobacillus_phage	82.3	4.7e-142
WP_075667203.1|483709_484705_-	recombinase RecT	NA	E9LUM3	Lactobacillus_phage	80.1	7.0e-113
WP_075667204.1|484707_484917_-	hypothetical protein	NA	E9LUM2	Lactobacillus_phage	79.7	3.3e-25
WP_187337519.1|484955_485123_-	hypothetical protein	NA	E9LUM1	Lactobacillus_phage	76.4	3.7e-11
WP_075667205.1|485265_485586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667727.1|485598_486372_-	phage antirepressor KilAC domain-containing protein	NA	A0A1X9I5P1	Streptococcus_phage	52.4	1.6e-51
WP_075667206.1|486438_486669_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I6D3	Streptococcus_phage	41.3	3.8e-06
WP_075667207.1|486823_487162_+	helix-turn-helix transcriptional regulator	NA	X2CXD8	Lactobacillus_phage	45.4	2.4e-17
WP_075667208.1|487164_487563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667209.1|487576_488401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155772723.1|488401_488557_-	hypothetical protein	NA	A0A0A1ELK7	Lactobacillus_phage	63.4	6.8e-07
WP_075667210.1|488681_489239_+	PH domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	40.3	1.3e-31
WP_075667211.1|489299_490421_+|integrase	site-specific integrase	integrase	E9LUK6	Lactobacillus_phage	45.6	1.2e-84
WP_021350214.1|490494_490662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_101888719.1|490774_490957_-	hypothetical protein	NA	A0A1P8BMG7	Lactococcus_phage	47.4	1.9e-08
WP_070955444.1|491576_492422_+	YitT family protein	NA	M1Q1P6	Streptococcus_phage	27.9	2.9e-14
495447:495460	attR	AGGGCAATAGCGGC	NA	NA	NA	NA
>prophage 7
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	838603	887806	2176678	transposase,integrase	Lactobacillus_phage(17.65%)	39	870324:870338	897780:897794
WP_075667261.1|838603_839854_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.8e-57
WP_015638507.1|839927_840383_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.7	9.5e-33
WP_003682515.1|846049_846526_+	nucleoside 2-deoxyribosyltransferase	NA	A0A2P0ZL88	Lactobacillus_phage	35.2	7.7e-17
WP_003686557.1|846570_847005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667275.1|847116_849048_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.6	2.7e-92
WP_003686555.1|849047_849356_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_003686553.1|849369_849741_-	cupredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_075667276.1|849987_850992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003686549.1|851104_852283_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_003682507.1|852406_853102_-	2,3-diphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_075667277.1|853341_854595_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_015638505.1|854868_856404_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	46.2	7.6e-74
WP_023466051.1|856405_856987_-	phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_012390753.1|856995_858033_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	M4QRQ6	Synechococcus_phage	39.8	9.4e-60
WP_054194046.1|858032_859496_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	4.1e-61
WP_023466049.1|859471_861697_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.6	6.3e-146
WP_003682494.1|861700_862381_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012390750.1|862381_862624_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_046025600.1|862626_863349_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SPE1	Cyanophage	36.4	1.2e-34
WP_075667278.1|863836_864127_+	glycosyl hydrolase family 3	NA	NA	NA	NA	NA
WP_075667279.1|864303_865854_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_075667280.1|865865_866906_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_003682477.1|867120_868416_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.7	8.2e-21
WP_075667281.1|868434_869574_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_021815546.1|869557_870043_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.2	2.4e-21
870324:870338	attL	TTTACTAAAATAACC	NA	NA	NA	NA
WP_075667282.1|870327_871989_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_075667283.1|872076_873117_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_187337522.1|875214_875631_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	54.0	2.9e-28
WP_075667285.1|875701_876952_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	3.6e-58
WP_075667286.1|877164_878352_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075667287.1|878626_879172_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_031284834.1|879355_879763_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_075667288.1|879774_880650_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_075667289.1|880865_882161_-	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_015638486.1|882160_883303_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.0	8.5e-30
WP_075667730.1|883500_884190_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.6	1.8e-35
WP_075667290.1|884386_884893_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_155772725.1|885131_885704_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	32.2	7.1e-09
WP_075667291.1|886666_887806_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.3	3.9e-43
897780:897794	attR	TTTACTAAAATAACC	NA	NA	NA	NA
>prophage 8
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	965277	1036385	2176678	tRNA,protease,transposase	Streptococcus_phage(15.0%)	58	NA	NA
WP_075667327.1|965277_967371_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	H6X3M6	Enterobacteria_phage	40.4	8.7e-121
WP_075667328.1|967465_967696_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_075667329.1|968044_969229_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_023465693.1|969244_970237_+	D-2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	32.7	3.7e-37
WP_003682326.1|971529_972507_+	choloylglycine hydrolase family protein	NA	M1H9I8	Acanthocystis_turfacea_Chlorella_virus	25.4	3.3e-14
WP_003682323.1|973304_973973_-	beta-phosphoglucomutase	NA	NA	NA	NA	NA
WP_048339886.1|974119_976366_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_057727351.1|976378_977722_-	SLC45 family MFS transporter	NA	NA	NA	NA	NA
WP_075667330.1|978100_979036_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003685648.1|979041_979467_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_003682318.1|979681_980161_-	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_003682316.1|980668_981940_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	5.8e-19
WP_081378683.1|982014_982830_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.2	5.3e-34
WP_075667331.1|982844_983645_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_075667332.1|983646_984945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015638411.1|984928_986788_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	35.6	1.7e-35
WP_075667333.1|986799_987507_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.8	1.0e-41
WP_075667334.1|988192_988525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667335.1|988536_989712_-	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	28.7	1.7e-44
WP_046025651.1|989795_991199_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	47.3	1.1e-103
WP_003685631.1|991243_991696_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_070955303.1|991695_993729_-	DHH family phosphoesterase	NA	NA	NA	NA	NA
WP_003682305.1|993853_994090_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_075667336.1|994128_994854_-	single-stranded DNA-binding protein	NA	A0A2D1GPB7	Lactobacillus_phage	66.4	5.6e-35
WP_003682303.1|994894_995188_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_075667337.1|995394_997905_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	37.3	2.0e-111
WP_075667338.1|997930_999880_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	45.7	5.7e-143
WP_023465960.1|999879_1001001_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_003682299.1|1001010_1001229_-	S4 domain-containing protein YaaA	NA	NA	NA	NA	NA
WP_003685624.1|1001450_1002590_-	DNA polymerase III subunit beta	NA	D0R7I4	Paenibacillus_phage	30.6	6.1e-12
WP_003682297.1|1002754_1004071_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_003682291.1|1004589_1004724_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_075667340.1|1004839_1005184_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_012391813.1|1005199_1006033_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_081378684.1|1006063_1006924_+	Jag N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003685618.1|1007069_1008458_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_023465962.1|1008472_1010377_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_046948065.1|1010750_1012001_-|transposase	transposase	transposase	A0A286QQE5	Streptococcus_phage	37.0	2.6e-56
WP_075667012.1|1012079_1012532_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	52.3	9.5e-33
WP_015639643.1|1012641_1013019_+	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_051358726.1|1013130_1014552_-	amino acid permease	NA	NA	NA	NA	NA
WP_012391812.1|1014858_1016769_+	asparagine synthase (glutamine-hydrolyzing)	NA	NA	NA	NA	NA
WP_012391811.1|1016768_1018304_+	UDP-N-acetylmuramyl-tripeptide synthetase	NA	NA	NA	NA	NA
WP_023466423.1|1018308_1019865_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_003685605.1|1019939_1020551_+	signal peptidase I	NA	NA	NA	NA	NA
WP_012390893.1|1020613_1021501_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	42.3	7.6e-34
WP_075667342.1|1022507_1023740_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	36.3	1.7e-55
WP_048339876.1|1024064_1024943_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_075667343.1|1024948_1025563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639633.1|1025707_1027513_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	33.8	6.4e-88
WP_075667344.1|1027828_1028575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_181987558.1|1028949_1030530_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_003685594.1|1030807_1031818_+	zinc-dependent alcohol dehydrogenase family protein	NA	A0A2K9L7I1	Tupanvirus	27.7	6.2e-08
WP_003685592.1|1031974_1032577_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_031273931.1|1032500_1033562_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003685589.1|1033574_1034267_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	3.8e-33
WP_003685587.1|1034428_1034887_+	arginine repressor	NA	NA	NA	NA	NA
WP_042513914.1|1035098_1036385_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	1045571	1054659	2176678		Bacillus_phage(16.67%)	9	NA	NA
WP_015639618.1|1045571_1046714_+	AAA family ATPase	NA	A0A141HRX4	Bacillus_phage	31.1	1.7e-22
WP_069775877.1|1046706_1047867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003685567.1|1047859_1048153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337524.1|1048258_1049560_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	33.7	1.8e-47
WP_075667348.1|1049696_1051601_+	peptidase M13	NA	E3T4I7	Cafeteria_roenbergensis_virus	29.8	3.4e-71
WP_046025667.1|1051609_1052119_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	50.0	2.5e-37
WP_003682221.1|1052225_1053020_-	nicotinamide mononucleotide transporter	NA	A0A0C5K6M3	Enterococcus_phage	33.1	5.8e-25
WP_075667349.1|1053236_1053719_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_015639613.1|1053720_1054659_-	hypothetical protein	NA	A0A2R8FDS8	Brazilian_cedratvirus	33.2	5.4e-30
>prophage 10
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	1175514	1224023	2176678	transposase	Enterococcus_phage(21.43%)	41	NA	NA
WP_075667398.1|1175514_1175952_+|transposase	IS200/IS605 family transposase	transposase	A0A1P8BMC0	Lactococcus_phage	71.0	3.1e-49
WP_003684331.1|1175948_1177112_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	Q5ULQ4	Lactobacillus_virus	71.7	1.8e-160
WP_075667399.1|1177464_1178385_+	ribokinase	NA	NA	NA	NA	NA
WP_075667400.1|1178434_1179721_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003685393.1|1179983_1180868_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003685391.1|1180851_1181835_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_015639535.1|1182006_1183359_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_075667735.1|1183378_1184254_+	ROK family protein	NA	NA	NA	NA	NA
WP_003685387.1|1184538_1185858_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_003685385.1|1186094_1187309_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	29.8	1.7e-28
WP_023465934.1|1187388_1187718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046025534.1|1187973_1188735_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	27.9	1.7e-10
WP_003685380.1|1188727_1189627_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_075667401.1|1189626_1190619_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075667402.1|1191178_1192723_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	24.2	5.7e-45
WP_014562678.1|1192812_1193886_+	phosphoesterase	NA	NA	NA	NA	NA
WP_023465938.1|1194104_1194248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015639530.1|1194240_1194840_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003681257.1|1195193_1195655_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_046025531.1|1195651_1197817_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	57.6	6.2e-239
WP_075667403.1|1197827_1198748_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A160DHK0	Gordonia_phage	30.9	3.9e-25
WP_003681260.1|1198757_1199708_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	52.7	2.9e-92
WP_075667404.1|1199935_1201672_-	DUF2325 domain-containing protein	NA	NA	NA	NA	NA
WP_075667405.1|1201990_1202629_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_024501211.1|1202650_1203562_-	proline-specific peptidase family protein	NA	NA	NA	NA	NA
WP_023465964.1|1203643_1206040_-	Xaa-Pro dipeptidyl-peptidase	NA	NA	NA	NA	NA
WP_023465965.1|1206526_1207915_-	amino acid permease	NA	NA	NA	NA	NA
WP_003685361.1|1208015_1208432_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_003681268.1|1208431_1209016_+	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	29.9	5.9e-11
WP_023465966.1|1209057_1209507_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_031274508.1|1209607_1210069_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021816561.1|1210080_1210998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023465968.1|1211250_1212294_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_031274511.1|1212519_1213056_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075667406.1|1213094_1215812_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_075667407.1|1216035_1217061_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	35.4	6.0e-43
WP_187337486.1|1219156_1219327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667408.1|1219319_1220777_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	31.2	1.8e-24
WP_075667409.1|1220840_1221830_+	D-2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	33.7	2.2e-42
WP_075667410.1|1222123_1223476_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	37.2	1.7e-61
WP_075667411.1|1223558_1224023_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	52.5	3.6e-35
>prophage 11
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	1433771	1519662	2176678	terminase,head,tRNA,transposase,tail,capsid,portal,holin,protease,integrase	Erysipelothrix_phage(46.88%)	82	1500377:1500394	1523846:1523863
WP_023465997.1|1433771_1434548_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_004562968.1|1434654_1435098_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004562969.1|1435111_1435507_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_075667465.1|1435601_1436705_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_003681624.1|1436998_1437772_+	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_003681625.1|1438166_1438781_+	glycoside hydrolase family 73 protein	NA	S5M633	Brevibacillus_phage	51.7	2.9e-32
WP_023465995.1|1438796_1439384_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_003681628.1|1439385_1440558_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_046025412.1|1440735_1443006_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	41.8	6.3e-133
WP_004562975.1|1443007_1445047_+	NAD-dependent DNA ligase LigA	NA	A0A1W6DX16	Sphingobium_phage	36.3	1.4e-99
WP_003681632.1|1445049_1446162_+	CamS family sex pheromone protein	NA	NA	NA	NA	NA
WP_004562976.1|1446336_1446657_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_023465992.1|1446656_1448120_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_003681638.1|1448133_1449558_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_014562608.1|1449570_1450584_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_075667466.1|1450692_1452069_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	51.7	3.3e-129
WP_046025408.1|1452452_1452872_-	YjdF family protein	NA	NA	NA	NA	NA
WP_052696658.1|1453054_1453678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667467.1|1453859_1454543_+	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	43.8	1.6e-44
WP_052696657.1|1454560_1454863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667468.1|1454886_1456464_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	50.3	3.0e-134
WP_075667469.1|1456456_1458118_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	39.0	3.2e-102
WP_075667470.1|1458153_1458384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667471.1|1458476_1459355_-	1,4-beta-N-acetylmuramidase	NA	A0A2K5B2A3	Erysipelothrix_phage	35.0	2.7e-39
WP_155772735.1|1459351_1459765_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	61.0	3.3e-40
WP_075667473.1|1459751_1460132_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_075667474.1|1460132_1460411_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_075667475.1|1460427_1461606_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	57.0	7.5e-122
WP_075667476.1|1461627_1462299_-|protease	Clp protease ClpP	protease	E4ZFM4	Streptococcus_phage	52.6	5.7e-58
WP_187337488.1|1462295_1463570_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	62.3	2.9e-151
WP_075667477.1|1465265_1465472_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_075667478.1|1465474_1466095_-	hypothetical protein	NA	A0A2K5B280	Erysipelothrix_phage	39.9	1.3e-35
WP_075667479.1|1466218_1466470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667480.1|1466649_1467900_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	63.6	7.1e-155
WP_075667481.1|1467899_1468442_-|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	57.7	6.2e-55
WP_007123229.1|1468526_1469747_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	1.4e-94
WP_003671980.1|1469900_1470278_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	57.3	4.6e-33
WP_075667482.1|1470426_1470894_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_075667483.1|1470890_1472246_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	64.5	3.6e-152
WP_075667484.1|1472226_1472508_-	VRR-NUC domain-containing protein	NA	A0A1B0RXC4	Streptococcus_phage	54.4	1.2e-20
WP_075667485.1|1472721_1474977_-	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	49.3	1.1e-214
WP_048687308.1|1474979_1475384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667486.1|1475450_1477385_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	57.4	4.6e-225
WP_075667487.1|1477440_1478016_-	DUF2815 family protein	NA	A0A2K5B2A9	Erysipelothrix_phage	73.9	2.8e-74
WP_075667488.1|1477993_1479133_-	DUF2800 domain-containing protein	NA	A0A2K5B2A8	Erysipelothrix_phage	51.9	1.0e-107
WP_075667489.1|1479129_1479447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667490.1|1479430_1479631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_187337490.1|1479724_1480261_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_075667492.1|1480619_1481840_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081378689.1|1481808_1482057_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667494.1|1482040_1483696_+	ATPase	NA	NA	NA	NA	NA
WP_011678941.1|1483676_1483925_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	60.0	4.9e-15
WP_075667495.1|1483928_1485944_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.7	1.0e-73
WP_075667496.1|1485947_1488923_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	30.5	1.6e-91
WP_075667497.1|1488924_1490217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667498.1|1490197_1492090_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_075667499.1|1492105_1492441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023465991.1|1493173_1493677_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004562981.1|1494114_1494729_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075667500.1|1494999_1495968_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SDF8	Paenibacillus_phage	39.3	4.7e-05
WP_081378690.1|1496027_1496744_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_004562984.1|1496745_1497102_+	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_004562986.1|1497977_1498637_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	43.3	8.1e-41
WP_023465989.1|1498740_1499553_+	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_003684069.1|1499714_1499969_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_023465988.1|1499965_1500229_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
1500377:1500394	attL	GTTGGGTCGCACTTCCAT	NA	NA	NA	NA
WP_081378691.1|1500638_1501760_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_155772736.1|1507223_1507631_+	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_075667503.1|1508303_1508840_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q8W6R2	Burkholderia_virus	33.9	4.6e-10
WP_155772727.1|1508863_1509343_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075667504.1|1509399_1510278_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.4	2.6e-42
WP_054173465.1|1510301_1510589_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_021815645.1|1511027_1511642_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	38.0	9.6e-28
WP_023465817.1|1512029_1513427_-	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_021350113.1|1513814_1514597_-	dimethylargininase	NA	NA	NA	NA	NA
WP_003684080.1|1514672_1515179_+|tRNA	prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_004562998.1|1515242_1516781_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_075667505.1|1516922_1517366_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_075667506.1|1517368_1517941_+	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_075667507.1|1518103_1518793_+	class I SAM-dependent methyltransferase	NA	A0A097BYE1	Leuconostoc_phage	41.6	9.1e-35
WP_004563006.1|1518830_1519052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667508.1|1519068_1519662_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1523846:1523863	attR	ATGGAAGTGCGACCCAAC	NA	NA	NA	NA
>prophage 12
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	1557888	1620764	2176678	transposase,protease	Streptococcus_phage(15.79%)	54	NA	NA
WP_075667522.1|1557888_1558812_-|transposase	IS30 family transposase	transposase	H7BVY4	unidentified_phage	33.0	1.3e-33
WP_187337494.1|1558915_1560751_+	KxYKxGKxW signal peptide domain-containing protein	NA	A0A059PAX1	Leuconostoc_phage	44.0	2.0e-20
WP_075667524.1|1561043_1562765_+	C40 family peptidase	NA	A0A1J0GW44	Streptomyces_phage	43.0	2.3e-10
WP_075667525.1|1562907_1563471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021350368.1|1563560_1564493_+	glycosyltransferase family 2 protein	NA	V5USA4	Oenococcus_phage	50.0	5.8e-77
WP_075667526.1|1564492_1565611_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_075667527.1|1565616_1567275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667528.1|1567494_1568460_+	glycosyltransferase family 2 protein	NA	A8CG95	Salmonella_phage	34.5	2.2e-47
WP_187337496.1|1569218_1570931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048340525.1|1570890_1572501_+	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	27.3	2.6e-32
WP_075667529.1|1572511_1574263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667530.1|1574290_1575280_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_075667531.1|1575309_1576956_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667532.1|1576976_1577900_+	dTDP-glucose 4,6-dehydratase	NA	M1I1Z9	Acanthocystis_turfacea_Chlorella_virus	39.4	1.9e-56
WP_003688751.1|1577972_1578260_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_041812692.1|1578283_1579162_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	36.8	5.2e-43
WP_075667533.1|1579340_1579718_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075667534.1|1579704_1580565_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	1.6e-17
WP_004563052.1|1580577_1581276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012391525.1|1581466_1581610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667535.1|1581918_1583163_-	carboxylate--amine ligase	NA	NA	NA	NA	NA
WP_075667536.1|1583241_1584126_-	DMT family transporter	NA	NA	NA	NA	NA
WP_075667537.1|1584115_1584904_-	pyrroline-5-carboxylate reductase	NA	A0A1X9I6T5	Streptococcus_phage	34.1	1.3e-24
WP_075667538.1|1584914_1585634_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_075667539.1|1585789_1586383_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_075667540.1|1586669_1588097_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	44.7	8.6e-96
WP_023466066.1|1588089_1588665_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_023466065.1|1588791_1589499_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_012391520.1|1589751_1591998_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	1.7e-122
WP_004563060.1|1592171_1592414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004563061.1|1592543_1592810_+	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_075667541.1|1592811_1594542_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_075667542.1|1594757_1595975_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003684207.1|1595967_1596993_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_075667543.1|1596994_1598014_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_003684211.1|1598347_1598596_+	DUF1797 family protein	NA	NA	NA	NA	NA
WP_003683584.1|1605054_1605435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021350189.1|1605451_1605601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023467376.1|1605748_1606069_+	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_024501083.1|1606333_1607155_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003683592.1|1607177_1607861_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_031274637.1|1608227_1610444_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	58.8	1.3e-247
WP_003686107.1|1610388_1610970_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A0C5K925	Enterococcus_phage	59.7	4.8e-53
WP_003686109.1|1610978_1611851_+	SufD family Fe-S cluster assembly protein	NA	NA	NA	NA	NA
WP_075667544.1|1612002_1613340_+	purine/pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	28.9	6.5e-21
WP_075667545.1|1613548_1614619_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	25.8	1.1e-05
WP_075667547.1|1615027_1615912_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A249XZV3	Enterococcus_phage	69.8	2.6e-18
WP_012391509.1|1616065_1616569_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_024501077.1|1616782_1617214_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_075667548.1|1617342_1618029_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075667549.1|1618287_1618539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012391505.1|1618561_1618804_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075667550.1|1618984_1620235_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.0	1.4e-57
WP_075667551.1|1620308_1620764_+|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	2.1e-32
>prophage 13
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	1782458	1832485	2176678	transposase,tRNA	Streptococcus_phage(23.08%)	43	NA	NA
WP_049184344.1|1782458_1782914_-|transposase	IS200/IS605 family transposase	transposase	A0A0P0IQC6	Lactobacillus_phage	50.0	2.8e-32
WP_075667597.1|1782987_1784238_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A286QQE5	Streptococcus_phage	37.3	1.1e-57
WP_023465785.1|1784433_1785192_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	31.8	1.4e-12
WP_003683262.1|1785349_1786435_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_023465784.1|1786490_1787600_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_003683264.1|1787619_1788609_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_075667598.1|1788610_1789546_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_075667599.1|1789775_1792616_+	3'-5' exoribonuclease	NA	A0A1X9I5C8	Streptococcus_phage	34.6	2.8e-61
WP_004563226.1|1792666_1793185_+	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_004563225.1|1793211_1794507_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	29.2	7.4e-54
WP_003683269.1|1794598_1795327_+	DnaD domain protein	NA	A0A0N7AE27	Bacillus_phage	37.1	3.5e-13
WP_075667600.1|1795426_1796434_+	DUF1002 domain-containing protein	NA	NA	NA	NA	NA
WP_075667601.1|1796750_1797770_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_004563221.1|1797892_1798804_+	EamA family transporter	NA	NA	NA	NA	NA
WP_075667602.1|1798910_1801175_-	transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_075667603.1|1801167_1801803_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	36.6	5.1e-24
WP_075667604.1|1801894_1802491_+	DUF1273 domain-containing protein	NA	NA	NA	NA	NA
WP_015639179.1|1802598_1802958_+	cell division regulator GpsB	NA	NA	NA	NA	NA
WP_075667605.1|1803610_1805545_+	GTP-binding protein	NA	D0R0F5	Streptococcus_phage	28.5	3.1e-64
WP_021349973.1|1805652_1806834_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_075667606.1|1806837_1807287_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_075667607.1|1807329_1808463_+	class I SAM-dependent RNA methyltransferase	NA	NA	NA	NA	NA
WP_075667608.1|1810042_1811560_-	YfcC family protein	NA	NA	NA	NA	NA
WP_075667609.1|1811710_1813198_-	amidase	NA	NA	NA	NA	NA
WP_031265479.1|1813808_1814096_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075667610.1|1815020_1816154_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	29.1	2.5e-37
WP_012391396.1|1816538_1817228_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003683304.1|1817441_1818305_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_003683306.1|1818528_1819131_+	nitroreductase family protein	NA	NA	NA	NA	NA
WP_003683308.1|1819285_1819687_-	ribonuclease HI family protein	NA	NA	NA	NA	NA
WP_023466054.1|1819699_1820134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003683312.1|1820133_1820571_+	signal peptidase II	NA	NA	NA	NA	NA
WP_075667745.1|1820611_1821487_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_003683316.1|1821516_1822599_+	carbamoyl phosphate synthase small subunit	NA	NA	NA	NA	NA
WP_004563206.1|1822600_1825105_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_075667611.1|1825297_1825933_-	carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_031274611.1|1826050_1826962_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051358724.1|1827180_1827513_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075667613.1|1827613_1828753_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	32.2	2.4e-40
WP_012391388.1|1829242_1829560_+	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	51.1	4.0e-22
WP_054194091.1|1829610_1830648_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_012391386.1|1830659_1831076_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	46.8	1.0e-25
WP_075667614.1|1831264_1832485_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.5	8.1e-95
>prophage 14
NZ_CP019030	Limosilactobacillus fermentum strain SNUV175 chromosome, complete genome	2176678	2037229	2102881	2176678	transposase,integrase	Paenibacillus_phage(11.11%)	57	2024436:2024454	2106249:2106267
2024436:2024454	attL	AGAAAACGTGGTCAATAAC	NA	NA	NA	NA
WP_075667677.1|2037229_2038450_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.2	6.2e-95
WP_046948096.1|2038541_2039516_+	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_075667678.1|2039655_2040903_+	threonine ammonia-lyase IlvA	NA	NA	NA	NA	NA
WP_075667679.1|2040915_2041707_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	9.5e-12
WP_080669127.1|2041757_2042216_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_046948095.1|2042288_2042675_+	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_023466506.1|2042762_2043680_+	ROK family protein	NA	NA	NA	NA	NA
WP_157787438.1|2045342_2045543_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_157787439.1|2045890_2046196_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_054194081.1|2046333_2047473_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	33.6	4.7e-44
WP_187337528.1|2047569_2049285_-	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_023466091.1|2049312_2049651_-	metal-sulfur cluster assembly factor	NA	NA	NA	NA	NA
WP_075667681.1|2049963_2050944_+	bile acid:sodium symporter family protein	NA	NA	NA	NA	NA
WP_075667682.1|2051301_2052642_+	MFS transporter	NA	NA	NA	NA	NA
WP_075667683.1|2052654_2053701_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_003684814.1|2053700_2055098_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_003684816.1|2055102_2055687_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_075667684.1|2055707_2056481_+	Sua5/YciO/YrdC/YwlC family protein	NA	NA	NA	NA	NA
WP_081378712.1|2057470_2057644_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_012391249.1|2057662_2057887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337499.1|2059370_2059532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_187337500.1|2059528_2060065_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003684822.1|2060245_2060446_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003683018.1|2063030_2063651_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	35.3	3.0e-21
WP_075667685.1|2064413_2065073_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_075667686.1|2065157_2065751_+	flavodoxin	NA	NA	NA	NA	NA
WP_075667687.1|2065828_2066365_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003683030.1|2066364_2066790_+	OsmC family protein	NA	NA	NA	NA	NA
WP_015638987.1|2066827_2067277_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_075667688.1|2067417_2068320_+	glycine/betaine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003683036.1|2068470_2069115_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_075667689.1|2069095_2069863_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.1	3.4e-22
WP_003684840.1|2069859_2070489_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_012391237.1|2070504_2071464_+	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_012391236.1|2071556_2072609_-	2,3-butanediol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	25.9	7.9e-14
WP_042513914.1|2073649_2074936_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_003683043.1|2075719_2076646_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_012391233.1|2076647_2077727_-	tyrosine recombinase XerS	NA	A0A0E3XA96	Gordonia_phage	30.0	1.6e-06
WP_035423515.1|2077956_2078871_+	AEC family transporter	NA	NA	NA	NA	NA
WP_075667690.1|2078880_2080134_+	NADP-dependent isocitrate dehydrogenase	NA	NA	NA	NA	NA
WP_003683053.1|2080291_2081122_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_015638975.1|2081137_2081623_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_012391229.1|2082651_2083578_-	YdcF family protein	NA	NA	NA	NA	NA
WP_012391228.1|2083925_2084450_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012391227.1|2084468_2085359_+	alpha/beta hydrolase	NA	Q854G2	Mycobacterium_phage	27.3	4.3e-13
WP_003683063.1|2086788_2086998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003683065.1|2087198_2087339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075667691.1|2087538_2088675_-	aminotransferase	NA	A0A1X6WGT4	Pacmanvirus	24.3	2.0e-10
WP_075667692.1|2089813_2091184_-	MFS transporter	NA	NA	NA	NA	NA
WP_003684874.1|2091528_2092086_+	adenine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_081378701.1|2092477_2092990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081378713.1|2093745_2094387_+	sugar O-acetyltransferase	NA	NA	NA	NA	NA
WP_003684880.1|2095024_2096056_+	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_081378702.1|2096213_2097692_+	amino acid permease	NA	NA	NA	NA	NA
WP_075667694.1|2097741_2098506_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_075667695.1|2098505_2099732_-	NAD/NADP octopine/nopaline dehydrogenase family protein	NA	NA	NA	NA	NA
WP_042513914.1|2101594_2102881_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
2106249:2106267	attR	GTTATTGACCACGTTTTCT	NA	NA	NA	NA
