The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018933	Bacillus cereus strain ISSFR-9F chromosome, complete genome	5243376	203728	211678	5243376		uncultured_virus(33.33%)	6	NA	NA
WP_000917306.1|203728_204013_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
WP_001029999.1|204051_205686_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000743900.1|206093_207632_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_075396322.1|208016_209342_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	9.2e-44
WP_000929888.1|209487_210189_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_075396323.1|210172_211678_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	9.2e-32
>prophage 2
NZ_CP018933	Bacillus cereus strain ISSFR-9F chromosome, complete genome	5243376	256739	265112	5243376		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625683.1|256739_258047_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
WP_001170540.1|258135_258855_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000278820.1|258847_259102_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666779.1|259098_259782_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_075396330.1|259765_261985_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	7.4e-163
WP_000879025.1|261969_263385_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262445.1|263487_264528_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	3.2e-68
WP_075396331.1|264524_265112_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	7.7e-27
>prophage 3
NZ_CP018933	Bacillus cereus strain ISSFR-9F chromosome, complete genome	5243376	763353	773898	5243376	holin	Bacillus_phage(62.5%)	9	NA	NA
WP_139316730.1|763353_764670_-	SH3 domain-containing protein	NA	J9PQW7	Bacillus_phage	72.8	9.2e-36
WP_000402993.1|765831_766185_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SDF8	Paenibacillus_phage	36.5	1.0e-05
WP_075396506.1|766555_766939_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	43.8	2.1e-17
WP_000930102.1|767705_768131_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	72.1	1.1e-46
WP_075396507.1|768135_769119_+	N-acetylmuramoyl-L-alanine amidase	NA	A9QTG1	Bacillus_phage	74.6	5.9e-88
WP_075396508.1|769222_770506_+	C40 family peptidase	NA	A0A2I7SDE4	Paenibacillus_phage	30.7	2.6e-19
WP_075396509.1|770709_771933_+	hypothetical protein	NA	A0A173GB44	Bacillus_phage	44.1	5.9e-21
WP_075396510.1|772045_773221_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_000609128.1|773223_773898_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.1e-36
>prophage 4
NZ_CP018933	Bacillus cereus strain ISSFR-9F chromosome, complete genome	5243376	1802259	1810994	5243376		Bacillus_phage(71.43%)	9	NA	NA
WP_000755546.1|1802259_1803522_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
WP_001194297.1|1803620_1804385_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000453764.1|1804625_1806386_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.5	8.2e-266
WP_128294964.1|1806465_1807152_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.4	8.5e-118
WP_001231492.1|1807148_1808222_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.2	2.7e-171
WP_000823559.1|1808246_1808834_-	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_000818985.1|1809029_1809749_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_003158174.1|1809865_1809979_+	hypothetical protein	NA	W8CYT3	Bacillus_phage	95.8	1.6e-05
WP_075395549.1|1810121_1810994_+	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.9	1.1e-66
>prophage 5
NZ_CP018933	Bacillus cereus strain ISSFR-9F chromosome, complete genome	5243376	2120426	2126644	5243376		Bacillus_phage(71.43%)	10	NA	NA
WP_075395672.1|2120426_2120780_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	29.6	8.2e-08
WP_075395671.1|2120950_2121547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075395670.1|2121663_2122635_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_075395669.1|2122726_2123179_-	SHOCT domain-containing protein	NA	B8R671	Lactobacillus_phage	36.2	3.6e-08
WP_075395668.1|2123307_2123892_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_080496853.1|2123888_2124107_-	helix-turn-helix transcriptional regulator	NA	A0A0S2SXU5	Bacillus_phage	52.3	2.9e-11
WP_075395667.1|2124291_2124594_+	hypothetical protein	NA	H0USY0	Bacillus_phage	54.6	2.4e-24
WP_075395666.1|2124590_2124773_+	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	76.7	9.1e-19
WP_075395665.1|2124891_2126082_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	65.2	2.9e-145
WP_139316659.1|2126059_2126644_+	hypothetical protein	NA	A0A288WFQ7	Bacillus_phage	77.5	2.9e-82
>prophage 6
NZ_CP018933	Bacillus cereus strain ISSFR-9F chromosome, complete genome	5243376	2408470	2450770	5243376	tail,bacteriocin,protease,capsid,portal,integrase,head,terminase,holin	Bacillus_phage(83.78%)	52	2424838:2424854	2442145:2442161
WP_080496862.1|2408470_2408680_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_042332081.1|2409066_2409552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000413152.1|2409861_2410533_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_075396017.1|2410601_2411711_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.1	5.2e-149
WP_075666805.1|2412010_2412490_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_075396016.1|2413130_2414282_+	hypothetical protein	NA	A0A1B0T6A5	Bacillus_phage	32.8	2.1e-52
WP_075396015.1|2414319_2414466_+	complement C1q protein	NA	NA	NA	NA	NA
WP_075396014.1|2414789_2415143_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	92.2	3.2e-52
WP_044792376.1|2415359_2415551_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	2.4e-22
WP_075396013.1|2415607_2415874_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	76.5	1.4e-28
WP_139316691.1|2416250_2417126_+	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	96.2	3.7e-49
WP_075396010.1|2417094_2417898_+	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	5.6e-145
WP_075396009.1|2418116_2418290_+	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	98.2	4.7e-25
WP_075396008.1|2418304_2418559_+	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	91.7	3.2e-38
WP_075396007.1|2418571_2418991_+	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	43.0	4.8e-15
WP_075396037.1|2419006_2419501_+	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	50.5	3.1e-21
WP_075396006.1|2419681_2421679_-	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_075396005.1|2421958_2422228_+	hypothetical protein	NA	D2XR50	Bacillus_phage	84.3	1.4e-36
WP_075396004.1|2422261_2422537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075396003.1|2422539_2422767_+	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	97.3	6.0e-36
WP_075396002.1|2423342_2423549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075396001.1|2423820_2424015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075396000.1|2424503_2424806_+	hypothetical protein	NA	Q3HKX6	Bacillus_phage	72.0	1.3e-33
WP_000645586.1|2424829_2424952_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
2424838:2424854	attL	TTTGAAGAAAAGAAAAA	NA	NA	NA	NA
WP_075395998.1|2425256_2425739_+	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.4e-71
WP_075395997.1|2425738_2426281_+|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	2.5e-88
WP_075395996.1|2426488_2427391_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075395995.1|2427782_2428328_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075395993.1|2429046_2429373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155119909.1|2429542_2429698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075395992.1|2429694_2429907_+	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	98.6	1.0e-29
WP_001198484.1|2430040_2430295_+	hypothetical protein	NA	A0A2H4J3B1	uncultured_Caudovirales_phage	100.0	1.3e-44
WP_075395991.1|2430284_2430683_+	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	97.3	1.0e-59
WP_075396036.1|2430800_2431295_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	98.8	8.1e-86
WP_075395990.1|2431296_2432991_+|terminase	terminase large subunit	terminase	A0A2H4JB98	uncultured_Caudovirales_phage	99.3	6.2e-312
WP_075395989.1|2433179_2434433_+|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	98.6	6.1e-239
WP_075395988.1|2434419_2435130_+|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	96.2	7.5e-125
WP_075395987.1|2435167_2436340_+|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	93.1	1.7e-198
WP_000244595.1|2436360_2436639_+|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	95.6	9.9e-41
WP_001068017.1|2436635_2436959_+|head	phage head closure protein	head	H0USW8	Bacillus_phage	92.5	7.0e-54
WP_075395986.1|2436951_2437389_+	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	98.6	6.7e-76
WP_075395985.1|2437385_2437745_+	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.0	1.0e-58
WP_000896772.1|2437745_2438354_+|tail	tail protein	tail	A0A288WG55	Bacillus_phage	99.0	4.8e-104
WP_000779158.1|2438402_2438720_+	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	95.2	3.2e-51
WP_000344052.1|2438749_2438926_+	hypothetical protein	NA	A0A288WFY6	Bacillus_phage	100.0	3.4e-15
WP_075395984.1|2438940_2442792_+|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	97.7	0.0e+00
2442145:2442161	attR	TTTGAAGAAAAGAAAAA	NA	NA	NA	NA
WP_075395983.1|2442806_2444297_+|tail	phage tail protein	tail	A0A288WFS2	Bacillus_phage	98.4	1.2e-289
WP_075666806.1|2444293_2448160_+	peptidase S74	NA	Q2I8E8	Bacillus_phage	87.1	0.0e+00
WP_075666807.1|2448453_2449158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075666808.1|2449233_2449470_+	hypothetical protein	NA	A0A1B1P887	Bacillus_phage	80.3	2.5e-24
WP_075666809.1|2449469_2449709_+|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	91.1	1.0e-30
WP_075666810.1|2449705_2450770_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	91.5	3.6e-192
>prophage 1
NZ_CP018934	Bacillus cereus strain ISSFR-9F plasmid unnamed1, complete sequence	97634	48039	55000	97634	integrase	Bacillus_phage(33.33%)	9	44109:44132	61285:61308
44109:44132	attL	TTTGTGTAAATGTGTAAATGTGTA	NA	NA	NA	NA
WP_075395800.1|48039_49020_-|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.1e-38
WP_000023351.1|49037_49649_-	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.1	7.8e-14
WP_075395865.1|50217_51291_-	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	5.1e-77
WP_075395799.1|51584_51821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075666865.1|51956_52541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395798.1|52616_52862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075395864.1|52975_53350_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	9.0e-29
WP_075395797.1|53396_53738_-	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	40.3	1.9e-09
WP_075395863.1|53734_55000_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	6.4e-103
61285:61308	attR	TACACATTTACACATTTACACAAA	NA	NA	NA	NA
