The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018931	Bacillus cereus strain ISSFR-3F chromosome, complete genome	5242668	2808042	2850342	5242668	portal,tail,holin,bacteriocin,terminase,capsid,protease,head,integrase	Bacillus_phage(83.78%)	51	2834445:2834459	2855534:2855548
WP_075666810.1|2808042_2809107_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0A7AQV3	Bacillus_phage	91.5	3.6e-192
WP_075666809.1|2809103_2809343_-|holin	holin	holin	A0A2H4J378	uncultured_Caudovirales_phage	91.1	1.0e-30
WP_075666808.1|2809342_2809579_-	hypothetical protein	NA	A0A1B1P887	Bacillus_phage	80.3	2.5e-24
WP_075666807.1|2809654_2810359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075666806.1|2810652_2814519_-	peptidase S74	NA	Q2I8E8	Bacillus_phage	87.1	0.0e+00
WP_075395983.1|2814515_2816006_-|tail	phage tail protein	tail	A0A288WFS2	Bacillus_phage	98.4	1.2e-289
WP_075395984.1|2816020_2819872_-|tail	phage tail tape measure protein	tail	Q2I8F0	Bacillus_phage	97.7	0.0e+00
WP_000344052.1|2819886_2820063_-	hypothetical protein	NA	A0A288WFY6	Bacillus_phage	100.0	3.4e-15
WP_000779158.1|2820092_2820410_-	hypothetical protein	NA	A0A288WFU2	Bacillus_phage	95.2	3.2e-51
WP_000896772.1|2820458_2821067_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	99.0	4.8e-104
WP_075395985.1|2821067_2821427_-	DUF3168 domain-containing protein	NA	A0A0S2GLE3	Bacillus_phage	95.0	1.0e-58
WP_075395986.1|2821423_2821861_-	HK97 gp10 family phage protein	NA	A0A288WGM7	Bacillus_phage	98.6	6.7e-76
WP_001068017.1|2821853_2822177_-|head	phage head closure protein	head	H0USW8	Bacillus_phage	92.5	7.0e-54
WP_000244595.1|2822173_2822452_-|head,tail	phage gp6-like head-tail connector protein	head,tail	H0USW7	Bacillus_phage	95.6	9.9e-41
WP_075395987.1|2822472_2823645_-|capsid	phage major capsid protein	capsid	A0A2H4J387	uncultured_Caudovirales_phage	93.1	1.7e-198
WP_075395988.1|2823682_2824393_-|protease	Clp protease ClpP	protease	W8CYT5	Bacillus_phage	96.2	7.5e-125
WP_075395989.1|2824379_2825633_-|portal	phage portal protein	portal	A0A2H4J371	uncultured_Caudovirales_phage	98.6	6.1e-239
WP_075395990.1|2825821_2827516_-|terminase	terminase large subunit	terminase	A0A2H4JB98	uncultured_Caudovirales_phage	99.3	6.2e-312
WP_075396036.1|2827517_2828012_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4J8E3	uncultured_Caudovirales_phage	98.8	8.1e-86
WP_075395991.1|2828129_2828528_-	HNH endonuclease	NA	A0A0S2GLI5	Bacillus_phage	97.3	1.0e-59
WP_001198484.1|2828517_2828772_-	hypothetical protein	NA	A0A2H4J3B1	uncultured_Caudovirales_phage	100.0	1.3e-44
WP_075395992.1|2828905_2829118_-	hypothetical protein	NA	A0A1B1P8F3	Bacillus_phage	98.6	1.0e-29
WP_155119909.1|2829114_2829270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395993.1|2829439_2829766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395995.1|2830484_2831030_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075395996.1|2831421_2832324_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_075395997.1|2832531_2833074_-|integrase	site-specific integrase	integrase	W8CYP1	Bacillus_phage	91.1	2.5e-88
WP_075395998.1|2833073_2833556_-	ArpU family transcriptional regulator	NA	H0USV3	Bacillus_phage	82.5	1.4e-71
WP_000645586.1|2833860_2833983_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_075396000.1|2834006_2834309_-	hypothetical protein	NA	Q3HKX6	Bacillus_phage	72.0	1.3e-33
2834445:2834459	attL	TTTAATAATTTTATA	NA	NA	NA	NA
WP_075396001.1|2834797_2834992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075396002.1|2835263_2835470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075396003.1|2836045_2836273_-	hypothetical protein	NA	A0A288WFX6	Bacillus_phage	97.3	6.0e-36
WP_075396004.1|2836275_2836551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075396005.1|2836584_2836854_-	hypothetical protein	NA	D2XR50	Bacillus_phage	84.3	1.4e-36
WP_075396006.1|2837133_2839131_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_075396037.1|2839311_2839806_-	nucleoside triphosphate pyrophosphohydrolase family protein	NA	A0A0U4IBD0	Bacillus_phage	50.5	3.1e-21
WP_075396007.1|2839821_2840241_-	hypothetical protein	NA	A0A1B1P8B9	Bacillus_phage	43.0	4.8e-15
WP_075396008.1|2840253_2840508_-	hypothetical protein	NA	A0A0U3SU43	Bacillus_phage	91.7	3.2e-38
WP_075396009.1|2840522_2840696_-	DUF3954 domain-containing protein	NA	A0A1B1P7U5	Bacillus_phage	98.2	4.7e-25
WP_075396010.1|2840914_2841718_-	ATP-binding protein	NA	A0A1B1P7U2	Bacillus_phage	98.5	5.6e-145
WP_139316691.1|2841686_2842562_-	DnaD domain protein	NA	A0A1B1P7T6	Bacillus_phage	96.2	3.7e-49
WP_075396013.1|2842938_2843205_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	76.5	1.4e-28
WP_044792376.1|2843261_2843453_-	helix-turn-helix transcriptional regulator	NA	A0A0U3SLC2	Bacillus_phage	85.2	2.4e-22
WP_075396014.1|2843669_2844023_+	helix-turn-helix transcriptional regulator	NA	A0A0U3SD25	Bacillus_phage	92.2	3.2e-52
WP_075396015.1|2844347_2844494_-	complement C1q protein	NA	NA	NA	NA	NA
WP_075396016.1|2844531_2845683_-	hypothetical protein	NA	A0A1B0T6A5	Bacillus_phage	32.8	2.1e-52
WP_075666805.1|2846323_2846803_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_075396017.1|2847102_2848212_+|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	79.1	5.2e-149
WP_000413152.1|2848280_2848952_-	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_080496862.1|2850132_2850342_-|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
2855534:2855548	attR	TTTAATAATTTTATA	NA	NA	NA	NA
>prophage 2
NZ_CP018931	Bacillus cereus strain ISSFR-3F chromosome, complete genome	5242668	3132169	3138386	5242668		Bacillus_phage(71.43%)	10	NA	NA
WP_139316659.1|3132169_3132754_-	hypothetical protein	NA	A0A288WFQ7	Bacillus_phage	77.5	2.9e-82
WP_075395665.1|3132731_3133922_-	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	65.2	2.9e-145
WP_075395666.1|3134040_3134223_-	hypothetical protein	NA	A0A288WGN6	Bacillus_phage	76.7	9.1e-19
WP_075395667.1|3134219_3134522_-	hypothetical protein	NA	H0USY0	Bacillus_phage	54.6	2.4e-24
WP_080496853.1|3134705_3134924_+	helix-turn-helix transcriptional regulator	NA	A0A0S2SXU5	Bacillus_phage	52.3	2.9e-11
WP_075395668.1|3134920_3135505_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_075395669.1|3135633_3136086_+	SHOCT domain-containing protein	NA	B8R671	Lactobacillus_phage	36.2	3.6e-08
WP_075395670.1|3136177_3137149_+	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_075395671.1|3137265_3137862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395672.1|3138032_3138386_+	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	29.6	8.2e-08
>prophage 3
NZ_CP018931	Bacillus cereus strain ISSFR-3F chromosome, complete genome	5242668	3447819	3456554	5242668		Bacillus_phage(71.43%)	9	NA	NA
WP_075395549.1|3447819_3448692_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.9	1.1e-66
WP_003158174.1|3448834_3448948_-	hypothetical protein	NA	W8CYT3	Bacillus_phage	95.8	1.6e-05
WP_000818985.1|3449064_3449784_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_000823559.1|3449979_3450567_+	DUF3139 domain-containing protein	NA	NA	NA	NA	NA
WP_001231492.1|3450591_3451665_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	88.2	2.7e-171
WP_128294964.1|3451661_3452348_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	93.4	8.5e-118
WP_000453764.1|3452427_3454188_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	95.5	8.2e-266
WP_001194297.1|3454428_3455193_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755546.1|3455291_3456554_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	32.0	6.8e-12
>prophage 4
NZ_CP018931	Bacillus cereus strain ISSFR-3F chromosome, complete genome	5242668	4484917	4495462	5242668	holin	Bacillus_phage(62.5%)	9	NA	NA
WP_000609128.1|4484917_4485592_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.1	6.1e-36
WP_075396510.1|4485594_4486770_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_075396509.1|4486882_4488106_-	hypothetical protein	NA	A0A173GB44	Bacillus_phage	44.1	5.9e-21
WP_075396508.1|4488309_4489593_-	C40 family peptidase	NA	A0A2I7SDE4	Paenibacillus_phage	30.7	2.6e-19
WP_075396507.1|4489696_4490680_-	N-acetylmuramoyl-L-alanine amidase	NA	A9QTG1	Bacillus_phage	74.6	5.9e-88
WP_000930102.1|4490684_4491110_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	72.1	1.1e-46
WP_075396506.1|4491876_4492260_-	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	43.8	2.1e-17
WP_000402993.1|4492630_4492984_+	helix-turn-helix transcriptional regulator	NA	A0A2I7SDF8	Paenibacillus_phage	36.5	1.0e-05
WP_139316730.1|4494145_4495462_+	SH3 domain-containing protein	NA	J9PQW7	Bacillus_phage	72.8	9.2e-36
>prophage 5
NZ_CP018931	Bacillus cereus strain ISSFR-3F chromosome, complete genome	5242668	4993703	5002076	5242668		Synechococcus_phage(50.0%)	8	NA	NA
WP_075396331.1|4993703_4994291_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.8	7.7e-27
WP_001262445.1|4994287_4995328_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	3.2e-68
WP_000879025.1|4995430_4996846_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_075396330.1|4996830_4999050_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.2	7.4e-163
WP_000666779.1|4999033_4999717_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278820.1|4999713_4999968_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170540.1|4999960_5000680_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	43.9	2.0e-48
WP_000625683.1|5000768_5002076_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	6.4e-21
>prophage 6
NZ_CP018931	Bacillus cereus strain ISSFR-3F chromosome, complete genome	5242668	5047137	5055087	5242668		Bacillus_phage(33.33%)	6	NA	NA
WP_075396323.1|5047137_5048643_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	30.8	9.2e-32
WP_000929888.1|5048626_5049328_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	7.3e-40
WP_075396322.1|5049473_5050799_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	9.2e-44
WP_000743900.1|5051183_5052722_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.2	2.6e-21
WP_001029999.1|5053129_5054764_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.2	2.0e-157
WP_000917306.1|5054802_5055087_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	53.8	1.2e-20
>prophage 1
NZ_CP018932	Bacillus cereus strain ISSFR-3F plasmid unnamed, complete sequence	97731	5758	12719	97731	integrase	Bacillus_phage(33.33%)	9	8195:8209	15995:16009
WP_075395863.1|5758_7024_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	6.4e-103
WP_075395797.1|7020_7362_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	40.3	1.9e-09
WP_075395864.1|7408_7783_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	9.0e-29
WP_075395798.1|7896_8142_-	hypothetical protein	NA	NA	NA	NA	NA
8195:8209	attL	TTTTCTAAAAATAGG	NA	NA	NA	NA
WP_075666865.1|8217_8802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075395799.1|8937_9174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395865.1|9467_10541_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	5.1e-77
WP_000023351.1|11109_11721_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.1	7.8e-14
WP_075395800.1|11738_12719_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.1e-38
15995:16009	attR	TTTTCTAAAAATAGG	NA	NA	NA	NA
>prophage 2
NZ_CP018932	Bacillus cereus strain ISSFR-3F plasmid unnamed, complete sequence	97731	81675	88663	97731	integrase	Bacillus_phage(33.33%)	9	75368:75391	92540:92563
75368:75391	attL	TTTGTGTAAATGTGTAAATGTGTA	NA	NA	NA	NA
WP_075395863.1|81675_82941_+	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.7	6.4e-103
WP_075395797.1|82937_83279_+	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	40.3	1.9e-09
WP_075395864.1|83325_83700_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	9.0e-29
WP_075395798.1|83813_84059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075666865.1|84134_84719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075395799.1|84854_85091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075395865.1|85384_86458_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	44.2	5.1e-77
WP_000023351.1|87026_87638_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	32.1	7.8e-14
WP_075696925.1|87655_88663_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	34.3	1.5e-38
92540:92563	attR	TACACATTTACACATTTACACAAA	NA	NA	NA	NA
