The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015585	Roseomonas gilardii strain U14-5 plasmid 1, complete sequence	265182	0	209755	265182	protease,transposase,integrase	Escherichia_phage(14.63%)	179	55974:55996	61171:61193
WP_075801033.1|1010_1349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156878753.1|1345_2272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800824.1|2271_4575_-	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075800825.1|4584_5058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800826.1|5057_6239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800827.1|6235_6691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019460430.1|6747_7263_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_075800828.1|7259_7685_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019460428.1|7681_7930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083671467.1|7929_9114_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_075800829.1|9110_10088_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_083671469.1|10080_10563_-	DotD/TraH family lipoprotein	NA	NA	NA	NA	NA
WP_075800831.1|10870_11116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800832.1|11112_11538_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_075800833.1|11659_14698_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_075800834.1|14694_15357_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_075800835.1|15370_15805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800836.1|15910_16447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156878754.1|16458_17736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800838.1|17990_19358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156878774.1|19358_20303_-	type IV secretion protein DotH	NA	NA	NA	NA	NA
WP_019460417.1|20359_20989_-	DotI/IcmL/TraM family protein	NA	NA	NA	NA	NA
WP_075800840.1|21056_21767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800841.1|22332_22755_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075800842.1|23401_23860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167668433.1|23898_24384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800844.1|24402_25593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800845.1|25605_27003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800846.1|27062_29390_+	DotA/TraY family protein	NA	NA	NA	NA	NA
WP_156878755.1|29540_29834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800848.1|29890_30208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800849.1|30204_30561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800850.1|30724_31435_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	34.6	2.2e-20
WP_083671475.1|31424_32732_-	pyruvate oxidase	NA	NA	NA	NA	NA
WP_075800851.1|33863_34457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800852.1|34645_35287_-	Asp/Glu racemase	NA	NA	NA	NA	NA
WP_075800853.1|35327_36710_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_075801036.1|36769_38356_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_083671477.1|38416_39241_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075801038.1|39237_40113_-	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_075800854.1|40117_40939_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_167668419.1|40954_41818_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_075800855.1|41829_42597_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	4.0e-31
WP_058389798.1|42593_43436_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_075800856.1|44638_45538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_083671481.1|45619_47236_-	recombinase family protein	NA	A0A1B2LRQ3	Wolbachia_phage	28.7	5.4e-54
WP_075800859.1|48263_48977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800860.1|48973_49612_-	ParA family protein	NA	M4HZI5	Mycobacterium_phage	29.8	3.9e-08
WP_075800861.1|50110_50440_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_075800863.1|51470_52181_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	34.6	2.2e-20
WP_027297467.1|52503_52722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800865.1|52722_53082_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_027297468.1|53394_53655_+	plasmid stability protein	NA	NA	NA	NA	NA
WP_075800866.1|53651_54074_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_156878756.1|54070_55090_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075800867.1|55105_55741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800868.1|55733_56570_+	segregation/condensation protein A	NA	NA	NA	NA	NA
55974:55996	attL	GACTGGCTGGTGATGGCGAGCGA	NA	NA	NA	NA
WP_156878757.1|56808_57039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167668421.1|57824_58778_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_075800870.1|58774_59680_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_075800871.1|59676_60717_+	TniQ family protein	NA	NA	NA	NA	NA
WP_156878758.1|60924_61791_+	segregation/condensation protein A	NA	NA	NA	NA	NA
61171:61193	attR	GACTGGCTGGTGATGGCGAGCGA	NA	NA	NA	NA
WP_075800873.1|61862_62150_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_075800874.1|62158_62515_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_075800875.1|63005_64559_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_075800876.1|64658_65114_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083671489.1|65211_65409_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_075800877.1|65411_67343_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_156878759.1|67444_68434_-	NAD-dependent epimerase/dehydratase family protein	NA	E3SLH0	Synechococcus_phage	27.3	9.1e-20
WP_075800879.1|68430_69696_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_075800880.1|69695_70586_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_083671493.1|70654_75100_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_083671495.1|75216_76638_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_075800883.1|76713_77583_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.9	1.1e-88
WP_075800884.1|77597_78497_-	dTDP-4-dehydrorhamnose reductase	NA	A0A1D8EQE2	Escherichia_phage	33.3	3.0e-30
WP_075800885.1|78496_79576_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	51.4	1.6e-94
WP_083671497.1|79586_80237_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	40.7	1.5e-31
WP_075796883.1|80447_81254_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075800887.1|82822_83560_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	39.2	7.2e-38
WP_156878760.1|83570_83993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800889.1|84006_85950_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_075800892.1|89106_89517_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075800895.1|90827_92435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156878761.1|92627_93905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075801042.1|94495_95521_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	37.0	3.7e-56
WP_075800897.1|95607_96729_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075800898.1|96865_98437_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	46.4	9.7e-117
WP_075800899.1|98492_98840_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	52.8	2.4e-28
WP_075800900.1|98836_99223_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_075800901.1|99363_100260_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_075800902.1|100276_101110_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_083671540.1|101335_101479_-	DUF2474 domain-containing protein	NA	NA	NA	NA	NA
WP_075800903.1|101481_102489_-	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_075800904.1|102501_103911_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_075800905.1|104044_105424_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.2	1.5e-12
WP_075800906.1|105615_106839_+	5-aminolevulinate synthase	NA	V5LQ39	Emiliania_huxleyi_virus	30.8	3.0e-33
WP_083671503.1|106780_108409_+	MFS transporter	NA	NA	NA	NA	NA
WP_075800908.1|108572_109049_-	heme-binding protein	NA	NA	NA	NA	NA
WP_075800909.1|109294_109609_+	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_075800911.1|111244_111811_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	54.3	3.4e-48
WP_075800912.1|112015_112915_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075800913.1|113025_113889_+	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_075800914.1|114177_114804_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	51.6	3.8e-40
WP_083671507.1|114758_115181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156878762.1|115602_115923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800917.1|116070_116895_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	41.9	6.1e-46
WP_075800918.1|117077_117395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800919.1|117399_117681_+	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	48.2	1.4e-13
WP_075800920.1|118195_118690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800921.1|118814_119342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800875.1|119375_120929_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_075800850.1|121597_122308_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	34.6	2.2e-20
WP_083671509.1|122516_123155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156878763.1|123218_124035_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075800922.1|124463_125198_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.6	2.3e-52
WP_075800923.1|125253_126015_-	creatininase family protein	NA	NA	NA	NA	NA
WP_075800924.1|126891_127761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800926.1|129679_130612_-	NmrA family NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_075800927.1|130685_131513_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075800928.1|131641_132241_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075800929.1|132331_133342_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075800922.1|133459_134194_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	47.6	2.3e-52
WP_075800930.1|134263_134467_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156878764.1|134511_135703_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	44.0	4.7e-55
WP_075800933.1|135977_137165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019463438.1|137765_137972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075800934.1|137975_139574_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	43.7	5.2e-110
WP_075800935.1|139633_139981_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	51.4	3.2e-28
WP_167668423.1|139977_140379_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167668424.1|140620_141154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800939.1|141723_142923_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	47.6	5.9e-90
WP_075800940.1|143297_145547_+	response regulator	NA	Q6XM27	Feldmannia_irregularis_virus	24.5	3.1e-07
WP_075800941.1|145962_146925_-	pirin	NA	NA	NA	NA	NA
WP_083671516.1|147458_150044_-	PAS domain S-box protein	NA	Q6XLV6	Feldmannia_irregularis_virus	26.6	1.4e-06
WP_075796883.1|150245_151052_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075800943.1|152727_152967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_083671518.1|153131_154136_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_075800944.1|154464_154908_+	Hsp20 family protein	NA	A0A1B1IW69	uncultured_Mediterranean_phage	37.4	6.3e-21
WP_156878766.1|154997_155171_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800945.1|155213_156767_+|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_075800947.1|158496_159513_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075800948.1|159597_160533_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075800949.1|160646_161441_+	type 1 glutamine amidotransferase domain-containing protein	NA	NA	NA	NA	NA
WP_075800950.1|161512_161809_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_156878767.1|161820_161997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800951.1|162014_162755_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_075801047.1|162866_163160_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_075800952.1|163301_164645_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_075800953.1|166724_168320_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	45.5	6.6e-105
WP_075800954.1|168367_168715_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	57.9	8.0e-32
WP_075800955.1|168711_169083_-	IS66 family insertion sequence hypothetical protein	NA	A0A1B0YZU7	Pseudomonas_phage	37.5	1.8e-05
WP_075801048.1|171396_173988_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	33.4	5.8e-159
WP_075800958.1|174579_175689_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.9	3.8e-35
WP_075800959.1|176107_176398_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_075800960.1|176689_177679_-	zinc-dependent alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_075800961.1|177775_178396_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_075800962.1|180267_181407_-	glutathione-independent formaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_075800945.1|183042_184596_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_075796883.1|185811_186618_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_075800963.1|186869_187349_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_075800964.1|187464_187956_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_075800965.1|187976_188375_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	28.9	9.6e-05
WP_075800966.1|188389_188773_-	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_075801049.1|189024_189453_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075800967.1|189469_191302_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	A0A0P0CCN8	Ostreococcus_mediterraneus_virus	43.0	2.0e-105
WP_075800968.1|191366_194273_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	K4FB40	Cronobacter_phage	39.9	6.8e-124
WP_075800969.1|194351_195491_+	flagellar biosynthesis protein FliA	NA	NA	NA	NA	NA
WP_075800970.1|195487_196072_+	ETC complex I subunit	NA	NA	NA	NA	NA
WP_075800971.1|196178_196826_+	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_075800972.1|196960_197257_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_156878768.1|197626_199483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800974.1|200002_201115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167668426.1|201170_202409_-	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_083671524.1|202510_203824_-	MFS transporter	NA	NA	NA	NA	NA
WP_075800977.1|203882_204932_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_075800978.1|205087_205444_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_167668428.1|205596_207126_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	51.2	4.4e-138
WP_075800980.1|207139_207889_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	47.9	6.3e-58
WP_083671526.1|209248_209755_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	48.3	9.6e-34
>prophage 2
NZ_CP015585	Roseomonas gilardii strain U14-5 plasmid 1, complete sequence	265182	224482	243429	265182		Caulobacter_phage(16.67%)	16	NA	NA
WP_083671530.1|224482_225457_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.6	3.6e-45
WP_156878775.1|225465_226464_+	phosphoadenosine phosphosulfate reductase family protein	NA	NA	NA	NA	NA
WP_075800994.1|226505_227141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019462443.1|227137_227290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075800995.1|227836_232909_+	N-6 DNA methylase	NA	I6WLR1	Burkholderia_virus	41.4	0.0e+00
WP_075800996.1|232962_233223_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075800997.1|233327_234566_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_075800998.1|235077_236874_+	ParB N-terminal domain-containing protein	NA	A0A160DCL1	Gordonia_phage	30.9	6.5e-08
WP_075800999.1|236947_237244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075801000.1|237427_238126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075801001.1|238207_240016_+	DNA cytosine methyltransferase	NA	L7TH64	Pseudomonas_virus	57.3	3.3e-161
WP_075801002.1|240169_240721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075801003.1|240850_241345_+	hypothetical protein	NA	A0A1B1INF6	uncultured_Mediterranean_phage	34.3	5.7e-07
WP_075801004.1|241554_241767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075801005.1|241848_242367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075801006.1|242940_243429_+	single-stranded DNA-binding protein	NA	A0A0U2C0X4	Paracoccus_phage	59.6	4.6e-41
>prophage 3
NZ_CP015585	Roseomonas gilardii strain U14-5 plasmid 1, complete sequence	265182	246959	251874	265182	integrase	uncultured_Caudovirales_phage(40.0%)	9	245036:245048	253713:253725
245036:245048	attL	CCGCCGCCGCCCA	NA	NA	NA	NA
WP_075801013.1|246959_247604_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	29.9	2.7e-12
WP_075801014.1|247744_248023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075801015.1|248022_248391_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_075801016.1|248424_248868_-	NUDIX domain-containing protein	NA	A0A1W6DX89	Sphingobium_phage	33.0	8.2e-05
WP_167668429.1|249046_249553_-	VOC family protein	NA	A0A2K9L1J4	Tupanvirus	29.1	4.5e-07
WP_083671534.1|249748_250426_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J6I5	uncultured_Caudovirales_phage	30.5	2.8e-12
WP_075801014.1|250528_250807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075801019.1|250806_251175_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_075801020.1|251235_251874_-	type B chloramphenicol O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	36.0	8.2e-22
253713:253725	attR	CCGCCGCCGCCCA	NA	NA	NA	NA
>prophage 1
NZ_CP015586	Roseomonas gilardii strain U14-5 plasmid 2, complete sequence	64339	0	9456	64339	transposase	Burkholderia_virus(50.0%)	4	NA	NA
WP_075801056.1|5252_6059_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_115359401.1|6145_7373_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	65.9	9.0e-102
WP_156878776.1|7628_8399_+	FCD domain-containing protein	NA	NA	NA	NA	NA
WP_167668437.1|8505_9456_+	3-phosphoglycerate dehydrogenase	NA	A0A1B1IVB5	uncultured_Mediterranean_phage	34.5	3.3e-19
>prophage 2
NZ_CP015586	Roseomonas gilardii strain U14-5 plasmid 2, complete sequence	64339	12733	22160	64339	transposase	Stx2-converting_phage(40.0%)	10	NA	NA
WP_115359401.1|12733_13962_-|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	65.9	9.0e-102
WP_083671565.1|14517_14976_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_019463438.1|14953_15160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075801064.1|15163_16762_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.1	5.2e-110
WP_075800935.1|16821_17169_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	51.4	3.2e-28
WP_167668423.1|17165_17567_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_083671549.1|17662_17962_+|transposase	transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	49.5	6.1e-20
WP_075801065.1|17909_18839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156878777.1|19150_19420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083671553.1|19691_22160_+	PAS domain S-box protein	NA	Q8QKW6	Ectocarpus_siliculosus_virus	22.3	5.2e-08
>prophage 3
NZ_CP015586	Roseomonas gilardii strain U14-5 plasmid 2, complete sequence	64339	25217	25583	64339		Thermobifida_phage(100.0%)	1	NA	NA
WP_083671555.1|25217_25583_+	helix-turn-helix transcriptional regulator	NA	A0A0R8VBU2	Thermobifida_phage	41.0	6.8e-05
>prophage 4
NZ_CP015586	Roseomonas gilardii strain U14-5 plasmid 2, complete sequence	64339	36188	40421	64339	transposase	Halomonas_phage(20.0%)	6	NA	NA
WP_075801082.1|36188_36839_+	AAA family ATPase	NA	B0ZSI1	Halomonas_phage	36.1	6.6e-19
WP_075801083.1|37276_37561_+	hypothetical protein	NA	A0A222YWE2	Escherichia_phage	52.1	4.7e-06
WP_075801084.1|37573_37885_+	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	42.7	4.1e-11
WP_156878783.1|38142_38908_+|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	42.1	4.4e-14
WP_156878784.1|38914_39226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075801087.1|39392_40421_+	thymidylate synthase	NA	G3MA60	Bacillus_virus	30.9	1.1e-23
