The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019170	Listeria monocytogenes strain CFSAN042079 chromosome, complete genome	3005348	123987	130512	3005348	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|123987_124440_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|124445_124781_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|124997_125426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732220.1|125437_125854_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	39.3	1.3e-20
WP_012952083.1|126131_126521_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|126533_127046_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|127093_127396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012952082.1|127437_127842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012952081.1|127828_129697_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_003734720.1|129693_130512_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP019170	Listeria monocytogenes strain CFSAN042079 chromosome, complete genome	3005348	371491	379335	3005348		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722610.1|371491_372451_+	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
WP_012952019.1|372569_373553_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	37.2	5.8e-51
WP_012952018.1|373569_374631_+	galactose mutarotase	NA	NA	NA	NA	NA
WP_012952017.1|374672_376403_+	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	54.0	3.0e-175
WP_003722606.1|376510_377386_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_003722605.1|377387_378356_+	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722604.1|378363_379335_+	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
>prophage 3
NZ_CP019170	Listeria monocytogenes strain CFSAN042079 chromosome, complete genome	3005348	521539	560770	3005348	holin,tail,terminase	Listeria_phage(98.15%)	58	NA	NA
WP_012951970.1|521539_522898_-	recombinase family protein	NA	Q8LTD8	Listeria_phage	99.8	1.1e-257
WP_012951969.1|522958_524473_-	putative DNA binding domain-containing protein	NA	NA	NA	NA	NA
WP_012951968.1|524677_525112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951967.1|525170_525878_-	hypothetical protein	NA	A0A0B5CTT6	Listeria_phage	99.1	5.3e-123
WP_012951966.1|525904_526396_-	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_012951965.1|526426_526732_-	helix-turn-helix transcriptional regulator	NA	A8ASM2	Listeria_phage	68.5	1.8e-27
WP_012951964.1|526894_527146_+	helix-turn-helix transcriptional regulator	NA	A8ASM3	Listeria_phage	76.7	9.3e-22
WP_003733687.1|527149_527344_+	hypothetical protein	NA	A0A059T6E5	Listeria_phage	95.3	1.4e-25
WP_012951963.1|527302_527662_-	DUF2513 domain-containing protein	NA	A0A2H4J4K9	uncultured_Caudovirales_phage	26.3	2.1e-06
WP_012951962.1|527726_527963_+	hypothetical protein	NA	A0A059T5E9	Listeria_phage	97.4	2.8e-36
WP_012951961.1|527959_528241_+	hypothetical protein	NA	A8ATX8	Listeria_phage	96.7	3.6e-38
WP_003733684.1|528242_528440_-	hypothetical protein	NA	Q9T179	Listeria_phage	96.0	4.0e-20
WP_012951960.1|528503_529280_+	phage antirepressor KilAC domain-containing protein	NA	A0A0B5D0I2	Listeria_phage	99.2	9.6e-142
WP_012951959.1|529403_529937_+	hypothetical protein	NA	A0A059T5F0	Listeria_phage	87.9	1.5e-77
WP_012951958.1|529933_530149_+	hypothetical protein	NA	Q9T176	Listeria_phage	93.0	9.7e-28
WP_003722564.1|530257_530446_+	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_003734953.1|530751_530946_+	hypothetical protein	NA	A0A059T6E8	Listeria_phage	100.0	1.6e-29
WP_012951957.1|530942_531419_+	siphovirus Gp157 family protein	NA	A0A059T5F1	Listeria_phage	100.0	9.5e-76
WP_012951956.1|531424_532084_+	ERF family protein	NA	A8ASN3	Listeria_phage	94.1	5.3e-93
WP_012951955.1|532100_533084_+	phage replisome organizer N-terminal domain-containing protein	NA	A8ASN4	Listeria_phage	91.7	1.4e-166
WP_012951954.1|533080_533368_+	hypothetical protein	NA	A0A059T7V3	Listeria_phage	88.4	1.7e-40
WP_012951953.1|533364_533895_+	hypothetical protein	NA	A0A059T5F9	Listeria_phage	95.5	8.4e-97
WP_031645470.1|534030_534261_+	DUF3850 domain-containing protein	NA	A0A059T699	Listeria_phage	73.8	1.1e-18
WP_012951951.1|534282_534642_+	hypothetical protein	NA	A0A059T801	Listeria_phage	92.0	6.6e-45
WP_012951950.1|534638_535040_+	hypothetical protein	NA	A8ATZ6	Listeria_phage	75.9	1.4e-48
WP_012951949.1|535036_535516_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	91.2	1.4e-74
WP_012951948.1|535537_535915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031645468.1|535942_536125_+	hypothetical protein	NA	A8ASP6	Listeria_phage	81.0	2.9e-17
WP_012951947.1|536069_536474_+	DUF1064 domain-containing protein	NA	A8ASP7	Listeria_phage	89.6	1.9e-61
WP_012951946.1|536477_536861_+	DUF2481 family protein	NA	A0A0B5CYS3	Listeria_phage	96.1	5.7e-63
WP_012951945.1|537001_537436_+	hypothetical protein	NA	A8AU03	Listeria_phage	97.2	1.6e-74
WP_012951944.1|537721_537949_+	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_012951943.1|537988_538729_+	hypothetical protein	NA	A0A0B5CTX0	Listeria_phage	99.6	2.4e-134
WP_047934348.1|538694_540041_+|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.1	1.1e-262
WP_012951941.1|540055_541612_+	hypothetical protein	NA	A8ATU7	Listeria_phage	97.9	9.4e-298
WP_012951940.1|541616_542660_+	hypothetical protein	NA	A0A0B5D111	Listeria_phage	96.5	1.9e-193
WP_003744996.1|542755_543310_+	hypothetical protein	NA	A8ATU9	Listeria_phage	99.5	1.1e-88
WP_012951939.1|543332_544205_+	hypothetical protein	NA	A8ATV0	Listeria_phage	99.0	3.0e-160
WP_012951938.1|544218_544386_+	hypothetical protein	NA	A8ATV1	Listeria_phage	97.1	6.4e-11
WP_012951937.1|544386_544740_+	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_003733695.1|544739_545105_+	hypothetical protein	NA	A8ATV3	Listeria_phage	99.2	9.9e-65
WP_012951936.1|545094_545412_+	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	98.1	2.4e-51
WP_010991155.1|545408_545780_+	hypothetical protein	NA	A0A0B5CTY4	Listeria_phage	99.2	5.5e-63
WP_012951935.1|545784_546471_+	Ig domain-containing protein	NA	A0A0B5CYK8	Listeria_phage	97.4	2.6e-114
WP_012951934.1|546526_546958_+	hypothetical protein	NA	A8ATV7	Listeria_phage	95.8	3.2e-70
WP_074046934.1|546954_547266_+	hypothetical protein	NA	A0A0B5D116	Listeria_phage	96.7	1.3e-41
WP_012951932.1|547270_552070_+|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.1	0.0e+00
WP_012951931.1|552066_553635_+|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.2	2.0e-303
WP_012951930.1|553647_555810_+|tail	phage tail protein	tail	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_003722523.1|555848_556214_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_003722522.1|556226_556508_+|holin	holin	holin	A8ASL4	Listeria_phage	94.6	3.4e-41
WP_012951929.1|556507_557353_+	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	92.6	1.4e-133
WP_003722520.1|557393_558167_-	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	100.0	9.5e-150
WP_012951928.1|558441_558939_-	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	90.9	4.9e-83
WP_012951927.1|558950_559379_-	transcriptional regulator	NA	A8ATJ2	Listeria_phage	87.3	3.9e-28
WP_012951926.1|559380_559785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951925.1|559886_560096_-	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	97.1	5.5e-28
WP_012951924.1|560536_560770_+	hypothetical protein	NA	A0A059T6E1	Listeria_phage	94.8	8.0e-36
>prophage 4
NZ_CP019170	Listeria monocytogenes strain CFSAN042079 chromosome, complete genome	3005348	1074034	1082320	3005348		Synechococcus_phage(33.33%)	8	NA	NA
WP_003729814.1|1074034_1075327_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
WP_012951773.1|1075407_1076121_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	38.3	1.2e-42
WP_003722248.1|1076132_1076378_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_003722247.1|1076381_1077065_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_012951772.1|1077057_1079277_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	5.0e-159
WP_003722245.1|1079261_1080689_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_012951771.1|1080707_1081757_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.5	4.6e-62
WP_003722243.1|1081753_1082320_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
>prophage 5
NZ_CP019170	Listeria monocytogenes strain CFSAN042079 chromosome, complete genome	3005348	1622997	1684183	3005348	protease,tRNA	Bacillus_virus(17.65%)	58	NA	NA
WP_003732816.1|1622997_1624704_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723454.1|1624743_1626006_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_010989733.1|1626019_1627162_-	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_003732813.1|1627176_1627965_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003732812.1|1627978_1628737_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	42.1	4.4e-22
WP_003723450.1|1628966_1629524_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_003723449.1|1629523_1630252_-	UMP kinase	NA	NA	NA	NA	NA
WP_003723448.1|1630544_1630919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072217143.1|1630896_1632102_+	helicase SNF2	NA	L0P6E9	Lactobacillus_phage	47.1	3.7e-92
WP_003723446.1|1632091_1633396_+	DUF3440 domain-containing protein	NA	A0A220GKF8	Streptococcus_phage	52.1	9.5e-134
WP_003723445.1|1633405_1633912_+	ParB-like nuclease domain-containing protein	NA	A0A220GKT8	Streptococcus_phage	66.7	4.0e-56
WP_003723443.1|1634683_1635526_+	DUF2785 domain-containing protein	NA	NA	NA	NA	NA
WP_003723442.1|1635576_1635816_-	YneF family protein	NA	NA	NA	NA	NA
WP_003732809.1|1636036_1638031_-	transketolase	NA	NA	NA	NA	NA
WP_003723440.1|1638177_1638405_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_003723439.1|1638496_1638826_-	cell division suppressor protein YneA	NA	NA	NA	NA	NA
WP_003723438.1|1638983_1639598_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	62.1	9.3e-15
WP_003723437.1|1639627_1640149_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012951579.1|1640192_1641488_-	arsenic transporter	NA	A0A2H4PQU3	Staphylococcus_phage	61.9	2.8e-146
WP_003723435.1|1641631_1642966_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	26.4	2.0e-06
WP_003719570.1|1643036_1643405_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010989728.1|1643607_1644834_-	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
WP_003733804.1|1644826_1646050_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003719566.1|1646160_1646394_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_012951578.1|1646516_1647434_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_003723738.1|1647559_1649236_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_012951577.1|1649468_1650167_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	32.4	9.9e-13
WP_012951576.1|1650379_1652248_+	peptidoglycan O-acetyltransferase OatA	NA	B5WZU0	Pseudomonas_phage	31.9	6.5e-43
WP_012951575.1|1652281_1654078_-	class 1 internalin InlK	NA	NA	NA	NA	NA
WP_012951574.1|1654409_1656143_-	LapB repeat-containing protein	NA	NA	NA	NA	NA
WP_009913867.1|1656469_1656937_-	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_010989723.1|1657019_1659479_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	4.7e-102
WP_003723731.1|1659475_1661443_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	42.5	6.7e-123
WP_003732802.1|1661623_1662031_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_003724132.1|1662188_1662785_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_009932949.1|1662826_1663699_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_003724130.1|1663701_1664013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951573.1|1664035_1664455_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003726695.1|1664557_1665337_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_003732800.1|1665357_1666767_-|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	28.7	3.7e-43
WP_003724001.1|1666780_1667320_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_009911635.1|1667340_1668243_-	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_009924616.1|1668525_1669830_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_012951572.1|1669892_1671971_-	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.5	3.2e-107
WP_003723892.1|1672242_1673103_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_003723891.1|1673236_1674022_-	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723890.1|1674018_1674882_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_003723889.1|1674891_1675434_-	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_009924619.1|1675535_1676105_-	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723887.1|1676139_1676706_-	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723886.1|1676824_1678084_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723884.1|1678268_1679552_-	trigger factor	NA	NA	NA	NA	NA
WP_003732796.1|1679666_1680605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003732795.1|1680866_1681532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989719.1|1681549_1682083_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003727524.1|1682201_1682417_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003723563.1|1682567_1682963_+	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003723562.1|1683043_1684183_+|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP019170	Listeria monocytogenes strain CFSAN042079 chromosome, complete genome	3005348	1703325	1747690	3005348	protease,tail,portal,capsid,terminase,integrase,holin	Listeria_phage(92.0%)	62	1703039:1703060	1747786:1747807
1703039:1703060	attL	ATATTACGTCCTGAGAGGGATT	NA	NA	NA	NA
WP_012951563.1|1703325_1703559_-	hypothetical protein	NA	A8ATC5	Listeria_phage	98.7	1.6e-36
WP_012951561.1|1703999_1704182_+	hypothetical protein	NA	A0A059T7Z0	Listeria_phage	96.6	2.3e-22
WP_012951560.1|1704406_1705405_-	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	44.8	3.9e-71
WP_012951559.1|1705508_1706354_-	M15 family metallopeptidase	NA	A0A059T7Y8	Listeria_phage	83.7	5.4e-130
WP_012951558.1|1706353_1706611_-|holin	phage holin	holin	A8ATB7	Listeria_phage	69.0	3.2e-25
WP_012951557.1|1706610_1706913_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	93.0	1.7e-38
WP_031644619.1|1706960_1708055_-	hypothetical protein	NA	A0A059T7R4	Listeria_phage	87.9	2.2e-184
WP_012951555.1|1708044_1710339_-|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	94.0	0.0e+00
WP_012951554.1|1710351_1712001_-|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.1	0.0e+00
WP_012951553.1|1711988_1716920_-|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	95.1	0.0e+00
WP_009914372.1|1716923_1717085_-	hypothetical protein	NA	A0A059T6F4	Listeria_phage	97.9	2.1e-19
WP_012951552.1|1717135_1717468_-	hypothetical protein	NA	A8ATA5	Listeria_phage	96.4	2.8e-50
WP_012951551.1|1717538_1718126_-|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	1.7e-106
WP_009931623.1|1718146_1718530_-	hypothetical protein	NA	A0A059T681	Listeria_phage	96.1	6.1e-65
WP_012951550.1|1718526_1718928_-	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_009934006.1|1718924_1719290_-	hypothetical protein	NA	A0A059T6F2	Listeria_phage	96.7	1.6e-62
WP_009934007.1|1719273_1719573_-	hypothetical protein	NA	A8ATA0	Listeria_phage	98.0	9.9e-47
WP_012951548.1|1719582_1719753_-	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	100.0	6.3e-22
WP_012951547.1|1719759_1720911_-|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	99.5	3.1e-213
WP_012951546.1|1720937_1721654_-|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	59.0	9.3e-67
WP_012951545.1|1721650_1722781_-|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	99.5	2.8e-214
WP_009917707.1|1722831_1723221_+	DUF2513 domain-containing protein	NA	A0A1Q1PVT8	Staphylococcus_phage	39.8	3.7e-17
WP_012951544.1|1723230_1724874_-|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	99.3	0.0e+00
WP_012951543.1|1724870_1725227_-|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	98.0	2.0e-46
WP_009931610.1|1725276_1725591_-	HNH endonuclease	NA	A8ATF8	Listeria_phage	98.1	5.0e-57
WP_014930130.1|1725590_1725917_-	hypothetical protein	NA	A0A059T5G5	Listeria_phage	100.0	2.2e-55
WP_012951542.1|1726385_1727129_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_009917712.1|1727226_1727652_-	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	100.0	8.0e-74
WP_012951541.1|1727693_1727843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003731657.1|1727871_1728141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951540.1|1728137_1728677_-	DUF3310 domain-containing protein	NA	A8ATF5	Listeria_phage	77.1	9.2e-75
WP_003731659.1|1729124_1729337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951539.1|1729338_1729656_-	VRR-NUC domain-containing protein	NA	A8ATF4	Listeria_phage	89.3	7.3e-48
WP_012951538.1|1729989_1732278_-	primase	NA	R4IBW2	Listeria_phage	95.4	0.0e+00
WP_009918373.1|1732300_1732783_-	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	98.8	5.5e-87
WP_074471730.1|1732807_1734049_-	DEAD/DEAH box helicase	NA	A8ATF1	Listeria_phage	96.1	1.2e-213
WP_012951536.1|1734127_1734817_-	AAA family ATPase	NA	R4IDY8	Listeria_phage	96.9	3.1e-128
WP_003731665.1|1734836_1735316_-	siphovirus Gp157 family protein	NA	R4IBM0	Listeria_phage	76.7	7.6e-57
WP_012951535.1|1735317_1735701_-	hypothetical protein	NA	A8ATE8	Listeria_phage	92.9	5.3e-61
WP_003731667.1|1735697_1735871_-	hypothetical protein	NA	Q8W5W3	Listeria_phage	100.0	6.8e-24
WP_003731668.1|1735873_1736137_-	hypothetical protein	NA	Q8W5W6	Listeria_phage	67.1	8.8e-23
WP_012951534.1|1736339_1736531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951533.1|1736500_1736719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951532.1|1736715_1736949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951531.1|1736967_1737597_-	hypothetical protein	NA	A0A191KBJ8	Streptococcus_virus	58.4	1.1e-66
WP_012951530.1|1737597_1738077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951529.1|1738269_1738713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951528.1|1738715_1738949_-	DUF1642 domain-containing protein	NA	B6D7L5	Listeria_phage	55.6	6.8e-11
WP_012951527.1|1738945_1739626_-	hypothetical protein	NA	A8ATD7	Listeria_phage	95.6	9.0e-120
WP_012951526.1|1739638_1740583_-|integrase	site-specific integrase	integrase	A8ATD6	Listeria_phage	97.8	1.1e-176
WP_012951525.1|1740593_1741307_-	SAM-dependent DNA methyltransferase	NA	A8ATD5	Listeria_phage	97.9	4.5e-130
WP_012951524.1|1741303_1741768_-	class I SAM-dependent methyltransferase	NA	A0A059T693	Listeria_phage	94.8	2.9e-85
WP_012951522.1|1742584_1742827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012951521.1|1743192_1743345_-	hypothetical protein	NA	A8ATD4	Listeria_phage	70.0	3.6e-13
WP_003730997.1|1743579_1743765_-	hypothetical protein	NA	A8ATD3	Listeria_phage	98.4	3.7e-28
WP_003730996.1|1743767_1744010_-	hypothetical protein	NA	A8ATD2	Listeria_phage	93.8	3.9e-41
WP_012951520.1|1744031_1744223_-	helix-turn-helix transcriptional regulator	NA	Q8W5X9	Listeria_phage	84.1	1.6e-21
WP_003730994.1|1744289_1744493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951519.1|1744893_1745217_+	helix-turn-helix transcriptional regulator	NA	R4IDX0	Listeria_phage	75.7	6.3e-39
WP_012951518.1|1745233_1745686_+	ImmA/IrrE family metallo-endopeptidase	NA	R4IBK9	Listeria_phage	91.3	1.1e-78
WP_012951517.1|1745737_1746394_+	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_012951516.1|1746535_1747690_+|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	95.8	1.6e-209
1747786:1747807	attR	ATATTACGTCCTGAGAGGGATT	NA	NA	NA	NA
>prophage 7
NZ_CP019170	Listeria monocytogenes strain CFSAN042079 chromosome, complete genome	3005348	1869220	1878773	3005348		Hokovirus(28.57%)	9	NA	NA
WP_012951455.1|1869220_1871134_-	site-specific DNA-methyltransferase	NA	A0A2K5B2C1	Erysipelothrix_phage	36.9	1.3e-59
WP_012951454.1|1871351_1872908_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.0e-17
WP_003730540.1|1873036_1873441_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_012951453.1|1873500_1873809_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003727000.1|1873821_1874646_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	9.7e-68
WP_003721509.1|1874657_1876148_-	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_010989660.1|1876356_1877370_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	32.0	7.9e-11
WP_003732709.1|1877384_1878368_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_003721506.1|1878389_1878773_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
>prophage 8
NZ_CP019170	Listeria monocytogenes strain CFSAN042079 chromosome, complete genome	3005348	2897439	2907471	3005348		Tupanvirus(33.33%)	7	NA	NA
WP_012951084.1|2897439_2899593_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	34.1	6.7e-44
WP_003732117.1|2899616_2901389_-	DNA helicase RecQ	NA	A0A2K9L3P7	Tupanvirus	37.1	6.3e-80
WP_003722118.1|2901549_2903016_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.0	8.0e-97
WP_012951083.1|2903303_2903834_-	ADP-ribose-binding protein	NA	A0A0K1L687	Scale_drop_disease_virus	49.3	3.4e-29
WP_012951082.1|2903891_2905502_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.5	1.2e-45
WP_072215787.1|2905680_2905989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009924391.1|2906016_2907471_+	glycoside hydrolase family 1 protein	NA	A0A0B5JD41	Pandoravirus	30.3	1.9e-50
