The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	446798	480056	5348589	terminase,protease,capsid,portal,tRNA,tail,integrase,head	uncultured_Caudovirales_phage(75.0%)	34	464406:464423	480401:480418
WP_002919147.1|446798_447746_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|447760_448270_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|448398_449523_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|449494_449968_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|449993_450536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002919132.1|450540_451113_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|451116_451935_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|451931_452189_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|452164_452719_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|458514_458736_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|459029_462140_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|462152_463292_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|463670_464321_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
464406:464423	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|464596_465823_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|465915_466857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|467038_467323_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|467333_468113_+	hypothetical protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_157263200.1|468615_468834_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	1.4e-34
WP_001549752.1|468826_469015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004218267.1|469091_469220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|469318_469687_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|469683_470049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|470048_472184_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|472526_472862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|472910_473423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|473686_474853_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|474904_475465_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|475466_476708_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|476704_477040_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|477036_477336_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|477335_477779_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|477771_477924_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|478054_478411_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|478394_480056_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
480401:480418	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	1241529	1290030	5348589	terminase,lysis,plate,capsid,portal,coat,tRNA,tail,transposase,integrase,head	Salmonella_phage(82.22%)	64	1239823:1239869	1278656:1278702
1239823:1239869	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151020.1|1241529_1242555_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1242557_1243187_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1243309_1243552_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1243584_1244094_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1244101_1244302_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1244265_1244604_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1244671_1244905_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1244904_1245132_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1245128_1245980_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_004151012.1|1245976_1248361_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.9	0.0e+00
WP_004151011.1|1248523_1248712_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004099053.1|1248846_1249815_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_075995119.1|1249834_1250023_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	100.0	1.0e-25
WP_004151009.1|1250118_1250802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077274269.1|1250788_1251667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|1251724_1252705_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_162780153.1|1252750_1253068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1253067_1254069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1254590_1254860_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1254916_1255960_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1255959_1257723_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1257863_1258697_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1258713_1259766_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1259769_1260423_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1260518_1260983_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1260982_1261186_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1261189_1261405_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1261385_1261895_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1261899_1262283_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1262279_1262708_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1262682_1262841_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1262803_1263226_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1263218_1263665_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1263687_1264554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1264648_1265221_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1265217_1265580_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1265566_1266475_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1266467_1267139_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1267140_1269090_+|coat	spore coat protein CotH	coat	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1269099_1270218_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1270269_1271343_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1271491_1272664_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1272673_1273189_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1273241_1273541_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1273555_1273675_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1273901_1276298_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1276294_1276780_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1276776_1277871_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1277937_1278156_+	positive regulator of late gene transcription	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1278183_1278561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1279164_1279647_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1278656:1278702	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1279757_1280234_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1280223_1280514_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1280580_1280922_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_004145681.1|1280903_1281044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914159.1|1281069_1282731_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1282817_1283696_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1283820_1284411_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1284530_1285817_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1285836_1286628_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1286791_1288156_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1288415_1288664_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1288682_1289231_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1289262_1290030_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	1388343	1442255	5348589	terminase,tRNA,tail,transposase,holin,integrase	Salmonella_phage(40.43%)	61	1381155:1381171	1433875:1433891
1381155:1381171	attL	GCGGTGACGCCGGGCAC	NA	NA	NA	NA
WP_004149335.1|1388343_1389618_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913890.1|1389652_1390273_+	YfgM family protein	NA	NA	NA	NA	NA
WP_002913889.1|1390283_1391462_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_002913888.1|1391575_1393054_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_004151982.1|1393171_1394251_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_004144303.1|1394300_1394519_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004151981.1|1394502_1395894_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	33.0	6.3e-35
WP_004151980.1|1396052_1397519_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	1.2e-87
WP_004151979.1|1397586_1399164_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_075995025.1|1399356_1400607_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	84.9	5.2e-206
WP_032441415.1|1400623_1400815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075995026.1|1400811_1400994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075995027.1|1400990_1401584_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_075995028.1|1401580_1402291_-	hypothetical protein	NA	Q5QF30	Pseudomonas_virus	51.9	1.3e-57
WP_075995029.1|1402287_1402446_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_023339275.1|1402438_1402732_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004144294.1|1402841_1403090_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	78.0	2.8e-31
WP_065520988.1|1403138_1404020_-	recombinase RecT	NA	T1SBJ5	Salmonella_phage	82.6	2.7e-132
WP_042632443.1|1404016_1404838_-	exodeoxyribonuclease VIII	NA	A0A193GYK2	Enterobacter_phage	81.0	1.2e-131
WP_004164029.1|1404834_1405134_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_040173662.1|1405509_1406091_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.3	2.7e-64
WP_004152538.1|1406245_1406479_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_075995030.1|1406825_1408004_+	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	66.2	1.6e-143
WP_075995031.1|1407993_1408764_+	DNA replication domain protein	NA	G9L6A8	Escherichia_phage	91.7	5.5e-57
WP_075995032.1|1408889_1409234_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	85.1	5.3e-52
WP_075995034.1|1409842_1410325_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	81.3	6.5e-72
WP_075995035.1|1410321_1410705_+	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	43.4	4.0e-08
WP_023283338.1|1410705_1410918_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	43.9	2.4e-10
WP_075995036.1|1410914_1411307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048336845.1|1411306_1411495_+	hypothetical protein	NA	R9TNE4	Aeromonas_phage	76.7	9.4e-19
WP_023339258.1|1411487_1411826_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	1.8e-44
WP_048336844.1|1411901_1412231_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	55.1	1.9e-27
WP_075995037.1|1412288_1412909_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	72.2	1.4e-74
WP_075995038.1|1412905_1414381_+|terminase	terminase	terminase	Q858H3	Salmonella_phage	93.5	4.5e-281
WP_075995039.1|1414674_1414947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075995040.1|1415026_1415395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004141368.1|1416098_1416305_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_075995042.1|1416319_1418002_+|tail	phage tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	3.0e-265
WP_004141364.1|1417998_1418298_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	68.4	3.1e-32
WP_004141362.1|1418294_1418618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075995043.1|1418629_1419319_+	peptidase	NA	G9L6C4	Escherichia_phage	82.3	9.6e-69
WP_075995044.1|1419333_1420320_+	hypothetical protein	NA	A0A193GZ49	Enterobacter_phage	93.6	3.3e-179
WP_020953461.1|1420373_1420811_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.7	1.3e-66
WP_004152442.1|1420821_1421163_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_023339246.1|1421536_1422142_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	79.0	2.5e-89
WP_075995045.1|1422141_1424619_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.6	0.0e+00
WP_075995046.1|1424618_1425083_+	hypothetical protein	NA	Q858G2	Salmonella_phage	80.5	3.4e-70
WP_075995047.1|1425082_1425622_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	70.9	1.2e-58
WP_075995048.1|1425632_1428167_+	hypothetical protein	NA	Q858G0	Salmonella_phage	84.0	0.0e+00
WP_075995049.1|1428166_1430077_+	hypothetical protein	NA	Q858F9	Salmonella_phage	81.6	2.1e-283
WP_075995050.1|1430076_1432842_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.3	0.0e+00
WP_071531206.1|1432984_1433368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152433.1|1433453_1434143_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
1433875:1433891	attR	GTGCCCGGCGTCACCGC	NA	NA	NA	NA
WP_004152432.1|1434457_1434754_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_000019473.1|1435991_1436972_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_162780154.1|1436953_1438276_+	SGNH/GDSL hydrolase family protein	NA	F8R4T7	Escherichia_phage	49.5	6.1e-112
WP_004146394.1|1438372_1438777_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_023339240.1|1438763_1439069_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	81.4	2.7e-39
WP_048293150.1|1439058_1439688_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	77.4	8.1e-91
WP_075995051.1|1439684_1440167_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	90.6	7.9e-70
WP_004152009.1|1440386_1442255_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
>prophage 4
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	1770975	1777880	5348589	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1770975_1771839_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_024264506.1|1771849_1772623_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.7	3.9e-26
WP_004151134.1|1772863_1773760_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1774002_1775364_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004890796.1|1775682_1776405_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1776401_1777880_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 5
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	1818705	1830986	5348589		Enterobacteria_phage(22.22%)	11	NA	NA
WP_000043542.1|1818705_1820112_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_075995067.1|1820335_1821400_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	2.9e-104
WP_023278825.1|1821426_1822296_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.7	1.7e-110
WP_040230682.1|1822327_1823218_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.2	9.6e-29
WP_040230680.1|1823232_1823787_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	2.3e-52
WP_000704907.1|1823968_1825135_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_004144151.1|1825558_1825681_-	small membrane protein	NA	NA	NA	NA	NA
WP_001741931.1|1825871_1826012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038435495.1|1826081_1827086_-	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.5	1.4e-31
WP_004180506.1|1828165_1829581_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	31.0	1.4e-53
WP_012967600.1|1829603_1830986_+	phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	25.8	4.2e-31
>prophage 6
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	2027840	2077749	5348589	plate,protease,transposase	Microcystis_virus(21.43%)	52	NA	NA
WP_032425077.1|2027840_2028587_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_032425076.1|2029025_2030012_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_004145488.1|2030843_2030966_-	nitrilotriacetate monooxygenase	NA	NA	NA	NA	NA
WP_004219597.1|2031263_2031407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|2031745_2032726_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_114144096.1|2032849_2033725_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2033818_2034808_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2034833_2036165_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_032425074.1|2036192_2037401_+	propionate kinase	NA	NA	NA	NA	NA
WP_032425474.1|2037429_2039724_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.7	7.4e-158
WP_004225356.1|2039775_2039922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075995074.1|2040211_2041270_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004175489.1|2041379_2042294_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_060614333.1|2042303_2043590_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_032425073.1|2043586_2044462_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	8.9e-11
WP_004175491.1|2044458_2045178_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	1.5e-11
WP_002910720.1|2045183_2046077_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004180410.1|2046360_2048004_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	5.7e-136
WP_002910717.1|2048053_2048530_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020801827.1|2048628_2049555_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032425072.1|2049858_2051154_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	7.4e-62
WP_004145468.1|2051165_2051975_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_020801945.1|2051949_2052849_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2052958_2053441_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_072159826.1|2053538_2054330_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	3.0e-05
WP_002910652.1|2054355_2054895_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2055009_2055339_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_032423435.1|2055508_2055670_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019473.1|2055834_2056815_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_075995122.1|2056840_2057284_+	S-type Pyocin family protein	NA	NA	NA	NA	NA
WP_072198477.1|2057328_2058297_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.3	2.9e-172
WP_032425068.1|2058373_2058883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2058879_2059386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614320.1|2059622_2060132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004099053.1|2060269_2061238_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_032425067.1|2061491_2062847_+	S-type Pyocin	NA	NA	NA	NA	NA
WP_004200304.1|2062847_2063357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015958632.1|2063353_2063860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072198474.1|2064321_2065350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343204.1|2065367_2065679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060614315.1|2065700_2066594_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	1.1e-13
WP_032410376.1|2066639_2066756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016946122.1|2066777_2067671_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2067696_2067825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064182053.1|2067966_2068740_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	28.1	1.2e-11
WP_004164123.1|2068915_2069269_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_014343198.1|2069232_2069805_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	33.3	3.9e-07
WP_072093175.1|2070147_2070282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2070542_2070728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2071025_2071292_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032411808.1|2072441_2075852_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_032411805.1|2075985_2077749_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	2761021	2770435	5348589		Escherichia_phage(87.5%)	9	NA	NA
WP_160463746.1|2761021_2762656_+	DUF4981 domain-containing protein	NA	L0N6M2	Herpes_simplex_virus	55.8	3.1e-182
WP_004151612.1|2762710_2763976_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2764006_2765095_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_002904006.1|2765181_2765442_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_075995080.1|2765739_2766600_+	SHV family class A beta-lactamase	NA	A0A077SL40	Escherichia_phage	99.0	6.4e-155
WP_002210513.1|2766620_2767382_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_004151610.1|2767642_2768545_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.3	7.7e-159
WP_004151609.1|2768556_2769822_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	6.6e-233
WP_002210516.1|2769814_2770435_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 8
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	2935697	2965130	5348589	tRNA	Salmonella_phage(29.17%)	32	NA	NA
WP_002902433.1|2935697_2936852_+	porin OmpK37	NA	Q1MVN1	Enterobacteria_phage	58.9	4.8e-113
WP_002902432.1|2936995_2937208_+	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_004140161.1|2937289_2937724_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	50.7	3.2e-30
WP_075995085.1|2938357_2939029_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	9.0e-80
WP_075995086.1|2939052_2939667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075995087.1|2939726_2940992_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.8	3.5e-210
WP_004179627.1|2940993_2941413_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.3	8.5e-36
WP_023332914.1|2941491_2942979_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_064173262.1|2943653_2944766_+	ParB N-terminal domain-containing protein	NA	Q7Y4B3	Escherichia_virus	24.2	3.0e-19
WP_075995088.1|2944769_2945789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064173263.1|2945790_2946798_-	DNA adenine methylase	NA	NA	NA	NA	NA
WP_064190503.1|2947274_2948144_-	hypothetical protein	NA	A0A0H4IU61	Shigella_phage	42.0	9.4e-13
WP_075995090.1|2949005_2949242_-	hypothetical protein	NA	S4TVX5	Salmonella_phage	48.5	7.4e-13
WP_075995091.1|2949238_2949493_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	50.7	7.0e-09
WP_016946301.1|2949485_2949689_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	86.4	1.3e-26
WP_064190507.1|2949685_2950054_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	43.0	3.7e-11
WP_064145491.1|2950046_2950760_-	Replication protein P	NA	A0A0M3ULE2	Salmonella_phage	58.4	9.0e-70
WP_103857350.1|2950756_2951614_-	hypothetical protein	NA	K7PGZ0	Enterobacteria_phage	63.7	4.7e-89
WP_040225552.1|2952019_2952556_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	67.8	4.1e-59
WP_071526640.1|2952558_2952822_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_048230998.1|2952918_2953275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004179600.1|2953703_2953895_+	YebW family protein	NA	NA	NA	NA	NA
WP_016160782.1|2953903_2954059_+	hypothetical protein	NA	H6WRX3	Salmonella_phage	73.1	5.7e-14
WP_075995092.1|2954196_2957298_+	exodeoxyribonuclease	NA	H6WRX1	Salmonella_phage	59.1	1.1e-278
WP_075995093.1|2957310_2958399_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	56.2	2.8e-107
WP_023282473.1|2958439_2958679_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	83.3	2.7e-31
WP_004179593.1|2958743_2958956_+	DUF1233 family excisionase	NA	A0A0U2RY08	Escherichia_phage	71.8	8.4e-24
WP_075995094.1|2958956_2960195_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	67.1	1.0e-161
WP_004179591.1|2960243_2961179_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	1.4e-139
WP_004151591.1|2961224_2962598_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	8.6e-53
WP_004148192.1|2963123_2964107_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_002902419.1|2964386_2965130_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	3.5e-16
>prophage 9
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	2987182	3081517	5348589	integrase,terminase,plate,transposase	uncultured_Caudovirales_phage(26.67%)	107	3072630:3072644	3078639:3078653
WP_002902268.1|2987182_2988268_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_004151598.1|2988231_2989986_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004151599.1|2991657_2995083_-	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002902254.1|2995066_2996206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902252.1|2996202_2996460_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_002902180.1|2998909_2999440_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902178.1|2999507_3000038_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_075995096.1|3000106_3000637_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902174.1|3000704_3001235_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902172.1|3001303_3001834_-	T6SS immunity phospholipase A1-binding lipoprotein Tli1-KP	NA	NA	NA	NA	NA
WP_002902169.1|3001897_3002677_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_004228410.1|3002677_3005047_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	33.8	9.1e-18
WP_002902163.1|3005048_3007703_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	2.5e-96
WP_002902160.1|3007967_3008459_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004151602.1|3008463_3010170_-	OmpA family protein	NA	NA	NA	NA	NA
WP_004151603.1|3010166_3010856_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004218490.1|3010852_3012196_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_002902148.1|3012205_3013750_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_002902144.1|3013792_3014284_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_004230193.1|3014442_3014565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902136.1|3015129_3015378_+	DinI-like family protein	NA	S5MQI1	Escherichia_phage	70.4	1.4e-25
WP_002902133.1|3015600_3015885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002902131.1|3015989_3016199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|3016961_3017714_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|3018135_3019161_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|3019389_3020166_-	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_001067858.1|3020279_3020984_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_011264039.1|3021056_3021296_+	macrolide transporter	NA	NA	NA	NA	NA
WP_000612791.1|3021441_3022305_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001354008.1|3022342_3022588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|3023056_3023848_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_109023896.1|3023850_3024126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|3025027_3025360_-	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
WP_001206316.1|3025529_3026321_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|3026413_3027673_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|3027934_3028726_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|3028783_3029392_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|3029487_3030330_-	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
WP_000845048.1|3030496_3031510_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|3031712_3032063_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001323888.1|3032082_3032250_-	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_001161490.1|3032238_3032799_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|3032802_3035769_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001039464.1|3036616_3037003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030005799.1|3037142_3038111_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	5.5e-179
WP_014343022.1|3039775_3042799_-	hypothetical protein	NA	A0A286S1P0	Klebsiella_phage	44.7	1.6e-22
WP_004152577.1|3042854_3043052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231602.1|3043026_3043158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004231600.1|3043278_3043443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152575.1|3043917_3044691_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_004152574.1|3044687_3045884_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.9e-158
WP_004152573.1|3045883_3046237_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_004152572.1|3046238_3046892_-	hypothetical protein	NA	A0A2H4J8H6	uncultured_Caudovirales_phage	63.5	1.0e-59
WP_004225248.1|3046945_3047296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004173705.1|3047548_3047734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152570.1|3047786_3048128_-	hypothetical protein	NA	A0A2H4J1A5	uncultured_Caudovirales_phage	46.6	1.8e-23
WP_004152569.1|3048127_3049150_-	hypothetical protein	NA	A0A2H4J1B2	uncultured_Caudovirales_phage	54.2	9.2e-100
WP_004217362.1|3049152_3049380_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	56.0	4.6e-20
WP_004225238.1|3049455_3049869_-	hypothetical protein	NA	A0A2H4J1B3	uncultured_Caudovirales_phage	55.9	8.1e-31
WP_004152566.1|3050054_3052058_-	lytic transglycosylase domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	63.6	1.2e-247
WP_004152565.1|3052047_3052200_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	88.0	7.6e-19
WP_004152564.1|3052235_3052661_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	63.4	2.6e-40
WP_004199809.1|3052664_3053105_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.1	3.3e-62
WP_004152177.1|3053115_3054261_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.9	6.3e-166
WP_004152176.1|3054264_3054705_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_001116156.1|3054799_3055186_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	78.2	1.1e-48
WP_000834982.1|3055185_3055692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3055688_3056108_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3056076_3056358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132269.1|3056397_3057339_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_000528476.1|3057350_3057845_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.7	4.2e-50
WP_004199270.1|3057848_3059051_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	54.1	2.6e-106
WP_004152174.1|3059102_3059651_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	56.3	3.0e-49
WP_004152173.1|3059706_3061158_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	68.8	3.8e-192
WP_004152172.1|3061395_3062796_-|terminase	PBSX family phage terminase large subunit	terminase	A0A077KAW0	Edwardsiella_phage	69.0	9.4e-188
WP_004218030.1|3062746_3063235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152170.1|3063600_3063921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153952.1|3064155_3064545_-	lipase chaperone	NA	A0A192Y6H8	Salmonella_phage	49.2	9.4e-21
WP_004152169.1|3064541_3065072_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	77.1	2.7e-79
WP_004146526.1|3065074_3065323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004218026.1|3065340_3065469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152168.1|3065506_3065662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152167.1|3065728_3066511_-	antitermination protein	NA	F1C595	Cronobacter_phage	76.8	7.2e-113
WP_004198239.1|3066507_3066984_-	hypothetical protein	NA	A0A286N2Q1	Klebsiella_phage	100.0	1.8e-90
WP_004218023.1|3066980_3067958_-	DNA primase	NA	A0A286N2Q0	Klebsiella_phage	99.4	4.8e-183
WP_004198228.1|3067944_3069603_-	DEAD/DEAH box helicase	NA	A0A286N2P9	Klebsiella_phage	96.0	0.0e+00
WP_004152162.1|3070179_3070401_-	helix-turn-helix transcriptional regulator	NA	A0A286S2C1	Klebsiella_phage	100.0	3.0e-32
WP_004152161.1|3070498_3071167_+	LexA family transcriptional regulator	NA	A0A286S2B2	Klebsiella_phage	99.5	2.4e-125
WP_004152160.1|3071337_3071652_+	hypothetical protein	NA	A0A286S1T9	Klebsiella_phage	100.0	1.0e-49
WP_004152159.1|3071644_3071833_+	hypothetical protein	NA	A0A286S1P8	Klebsiella_phage	100.0	4.6e-26
WP_004218017.1|3072206_3072368_+	hypothetical protein	NA	A0A286S1Q6	Klebsiella_phage	96.2	1.5e-20
WP_004152157.1|3072360_3072615_+	hypothetical protein	NA	A0A286SGR4	Klebsiella_phage	97.6	3.1e-41
3072630:3072644	attL	AGGCGCTGCAGGTCC	NA	NA	NA	NA
WP_004146412.1|3072682_3072805_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	100.0	1.3e-16
WP_004152156.1|3072801_3073227_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	77.9	3.5e-53
WP_004152155.1|3073223_3073418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152154.1|3073414_3074242_+	hypothetical protein	NA	Q8W654	Enterobacteria_phage	84.0	5.5e-111
WP_004152153.1|3074346_3074865_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	98.8	1.7e-94
WP_004154298.1|3074870_3075581_+	DNA-binding protein	NA	A0A286S260	Klebsiella_phage	88.3	2.1e-111
WP_004152151.1|3075570_3075795_+	hypothetical protein	NA	A0A286S2B3	Klebsiella_phage	89.2	3.1e-29
WP_004218013.1|3075890_3076004_+	hypothetical protein	NA	A0A286S2B6	Klebsiella_phage	100.0	4.6e-13
WP_014343018.1|3076246_3076480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004198245.1|3076552_3076699_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	70.8	2.9e-15
WP_004152148.1|3076658_3076901_+	hypothetical protein	NA	A0A0M4RTZ2	Salmonella_phage	73.8	2.2e-20
WP_004152147.1|3076881_3078063_-|integrase	site-specific integrase	integrase	A0A0M4QX09	Salmonella_phage	84.2	5.6e-202
WP_016197745.1|3078259_3078808_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
3078639:3078653	attR	GGACCTGCAGCGCCT	NA	NA	NA	NA
WP_004152145.1|3079006_3080539_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	30.0	1.1e-21
WP_004152144.1|3080755_3081517_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.5	2.4e-20
>prophage 10
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	3493380	3586331	5348589	terminase,lysis,plate,protease,capsid,portal,tRNA,tail,integrase,head	Salmonella_phage(57.63%)	97	3548906:3548924	3586406:3586424
WP_002898139.1|3493380_3494673_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3494763_3496107_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3496115_3496727_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3496849_3501103_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3501238_3501733_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_004147787.1|3502016_3502148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002898019.1|3502265_3503234_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3503348_3505115_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3505115_3506837_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_004141853.1|3506863_3507583_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3507936_3508155_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3508275_3510555_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3510585_3510903_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3511228_3511450_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3511526_3513467_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3513463_3514579_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3514725_3516384_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3516803_3517499_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3517614_3518514_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3518657_3520310_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3520320_3521289_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3521500_3521935_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3522086_3523805_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3523843_3524845_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3524855_3526298_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3526385_3527399_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3527395_3528226_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3528257_3529397_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3530274_3530790_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3531016_3531745_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3531765_3532497_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3532503_3533220_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3533219_3533888_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3534071_3534803_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3534845_3536318_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3536314_3537031_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3537109_3538237_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3538278_3538767_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3538824_3539670_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3539666_3540620_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_004176719.1|3540630_3541797_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.3e-30
WP_002896368.1|3541927_3543040_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3543388_3543868_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3543956_3544859_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3545680_3545968_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3546170_3546434_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3546440_3546824_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3547090_3548776_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_004226292.1|3548767_3548890_-	hypothetical protein	NA	NA	NA	NA	NA
3548906:3548924	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3548995_3549214_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3549305_3550406_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3550402_3550888_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3550884_3553278_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3553504_3553624_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3553638_3553938_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3553990_3554506_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3554515_3555688_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3555826_3556903_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_004232615.1|3556932_3557094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002896186.1|3557132_3557864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152882.1|3557867_3560819_-	hypothetical protein	NA	A0A2H4N7A3	Pectobacterium_phage	50.9	1.2e-06
WP_004150856.1|3560820_3561420_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3561412_3562321_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3562307_3562670_-|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3562666_3563239_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004226282.1|3563353_3563518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199112.1|3563516_3564026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3564022_3564469_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3564461_3564893_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3564855_3565002_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3564988_3565417_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3565413_3565797_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3565801_3566311_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3566291_3566507_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3566510_3566714_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3566713_3567178_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3567273_3567924_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_002895972.1|3567927_3568986_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	1.1e-180
WP_002895967.1|3569002_3569836_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3569978_3571745_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3571744_3572770_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3572831_3574574_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3574849_3575527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3575641_3575875_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3575885_3576074_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_004150862.1|3576227_3578642_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.5	0.0e+00
WP_004150863.1|3578638_3579496_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3579492_3579720_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3579719_3579953_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3580020_3580362_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3580325_3580526_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3580533_3581043_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3581075_3581297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3581442_3582321_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3582332_3583277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3583375_3584863_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3585350_3586331_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3586406:3586424	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 11
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	4239541	4251195	5348589	integrase	Enterobacteria_phage(70.0%)	15	4239393:4239406	4243606:4243619
4239393:4239406	attL	TCTGACATATTTTT	NA	NA	NA	NA
WP_004144574.1|4239541_4240645_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
WP_002889940.1|4240655_4241909_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4242261_4243452_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4243439_4244390_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
4243606:4243619	attR	AAAAATATGTCAGA	NA	NA	NA	NA
WP_004152979.1|4244389_4244815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802988.1|4245161_4245311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4245383_4245950_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4245967_4246213_-	hypothetical protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4246209_4246947_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_004903606.1|4247246_4247384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002889915.1|4247488_4247755_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4247757_4248309_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_004219964.1|4248353_4248533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4248529_4248850_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4248861_4251195_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
>prophage 12
NZ_CP015385	Klebsiella pneumoniae strain NY9 chromosome, complete genome	5348589	4719441	4725266	5348589		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4719441_4721775_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4721789_4722110_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4722106_4722334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4722330_4722873_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4722875_4723142_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4723702_4724440_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4724436_4724682_+	hypothetical protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4724699_4725266_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 1
NZ_CP015386	Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence	199497	1727	60898	199497	protease,transposase,integrase	uncultured_Caudovirales_phage(27.78%)	54	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004099053.1|3074_4043_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_004152065.1|4677_5625_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|5651_5963_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|5982_6951_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_004197688.1|7623_7881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|8482_9937_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|10919_12197_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|12259_14257_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|15296_16504_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|17932_18364_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|18614_20090_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|20082_20763_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|20952_22338_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|22366_22720_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|22833_24126_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|24136_27283_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|27369_27810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|27936_30384_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|30424_30622_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|30655_31393_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|31681_32131_-	copper resistance protein	NA	NA	NA	NA	NA
WP_004099053.1|32296_33265_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.8	5.1e-185
WP_000925242.1|33430_35248_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|35247_36144_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|36183_36564_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|36568_37498_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|37552_38233_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|38229_39630_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|39846_40281_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|40512_40692_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|42434_42944_+	major intrinsic protein MIP	NA	NA	NA	NA	NA
WP_004152091.1|42993_43491_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|43822_44149_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|44145_44859_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|44867_45413_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|45488_45851_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|47747_48284_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|48316_48742_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|48754_50044_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|50091_51843_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|51860_52223_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|52272_52623_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|52980_53250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|53237_53813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|53843_54338_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|54381_54750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|54783_54987_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|55035_55293_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|55368_55623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|55798_56065_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|56052_56535_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020314316.1|56746_58093_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|59935_60898_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP015386	Klebsiella pneumoniae strain NY9 plasmid pNY9_1, complete sequence	199497	66385	134609	199497	integrase,transposase,bacteriocin	Escherichia_phage(31.58%)	59	99608:99625	137744:137761
WP_004118209.1|66385_66649_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|67850_68831_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|70039_70909_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|70902_71913_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|71921_72749_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|72757_73621_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|73617_74445_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|75300_76005_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_044117068.1|77308_77977_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.5	1.9e-130
WP_000018329.1|78166_78982_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067834.1|79132_79837_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000219391.1|79958_80864_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|80860_82099_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|82098_82683_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|83175_83940_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|84166_84472_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|84482_85688_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000376616.1|85843_86047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|86174_87014_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|87007_87355_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001206356.1|87518_88310_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|88315_88606_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|88717_89215_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|89359_90373_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067834.1|90674_91379_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_004118832.1|95141_96875_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	6.9e-15
WP_004118225.1|96882_97830_-	acetamidase/formamidase family protein	NA	A0A1V0S8X7	Catovirus	22.7	9.6e-11
WP_004152278.1|97874_99479_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118227.1|99491_100412_-	ABC transporter permease	NA	NA	NA	NA	NA
99608:99625	attL	CCACCTGTTGAATCGCCT	NA	NA	NA	NA
WP_004152279.1|100411_101260_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_004118229.1|101256_101850_-	ANTAR domain-containing protein	NA	NA	NA	NA	NA
WP_004118840.1|101846_102974_-	transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004118231.1|103258_103426_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_161989521.1|103354_103567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118235.1|104528_105050_+	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_004118237.1|105046_106000_+	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004152280.1|106085_108410_+	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118241.1|108454_109357_+	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004118243.1|109353_110352_+	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004152281.1|110348_111305_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004152282.1|111305_112073_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004118251.1|112171_112465_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_071527925.1|112795_113038_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152284.1|113416_114427_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|114887_115970_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|116091_119166_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|119217_120471_+	lactose permease	NA	NA	NA	NA	NA
WP_004152290.1|122176_124486_+	ATPase	NA	NA	NA	NA	NA
WP_004152291.1|124489_125806_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000093087.1|125802_127998_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_029505403.1|128598_128808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408758.1|129016_129151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093215.1|129235_129394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152292.1|129444_130302_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|130294_130372_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|130588_130867_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_009485932.1|131187_131667_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004152296.1|132007_132286_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004178051.1|132287_134609_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
137744:137761	attR	CCACCTGTTGAATCGCCT	NA	NA	NA	NA
>prophage 1
NZ_CP015387	Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence	139933	48	19164	139933	transposase	Stx2-converting_phage(20.0%)	26	NA	NA
WP_012539983.1|48_804_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_022644883.1|891_2430_-|transposase	IS66-like element ISKpn24 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	94.7	4.6e-281
WP_000612626.1|2478_2826_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_007372134.1|2822_3227_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.8	1.6e-68
WP_015632469.1|4008_5214_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_022644882.1|5213_6188_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.0	9.4e-86
WP_022644881.1|6269_7541_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.5	1.6e-149
WP_020805749.1|7540_7972_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
WP_001568038.1|8204_9176_+	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_022644880.1|9178_9850_+	plasmid stability mediator StbB	NA	NA	NA	NA	NA
WP_001568040.1|9911_10142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072216848.1|10260_10377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|10578_11280_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_001568042.1|11279_11501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644879.1|11510_11930_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_022644878.1|11983_12751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032408983.1|12823_13180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073558255.1|13194_13860_+	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.9	2.0e-10
WP_013214014.1|13902_14409_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.4	1.2e-07
WP_001568047.1|14451_14643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644876.1|14830_15094_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.4e-12
WP_022644875.1|15118_15439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072223070.1|16119_16209_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_020314935.1|16239_16797_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	72.4	1.8e-49
WP_020314938.1|16846_17095_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020314932.1|17163_19164_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	28.4	3.3e-21
>prophage 2
NZ_CP015387	Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence	139933	69356	108735	139933	transposase	Escherichia_phage(16.67%)	46	NA	NA
WP_022644915.1|69356_70310_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	49.4	1.4e-62
WP_022644914.1|70417_71005_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	36.5	2.6e-22
WP_022644913.1|71544_72063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644912.1|72384_73032_+	P-loop NTPase	NA	A0A222YXS3	Escherichia_phage	43.5	9.7e-39
WP_032072061.1|73022_73298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644911.1|73498_73699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644910.1|73800_75072_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.5	7.3e-147
WP_044596206.1|75083_75533_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.0	5.2e-31
WP_022644908.1|75529_75775_-	DinI-like family protein	NA	Q7Y3V9	Yersinia_phage	39.3	1.5e-08
WP_022644907.1|75978_76209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072216862.1|76317_76443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644906.1|76644_77577_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_004194746.1|77611_77845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644905.1|77841_78177_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160541601.1|78277_78361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|78562_79264_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
WP_022644904.1|79263_79485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644903.1|79494_79914_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_032072058.1|79967_80735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032072057.1|81178_81844_+	antirestriction protein	NA	NA	NA	NA	NA
WP_022644900.1|81888_82395_+	antirestriction protein	NA	G9FHQ1	Rhodococcus_virus	31.9	6.9e-08
WP_022644899.1|82437_82629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025404029.1|82822_83077_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.7	2.6e-11
WP_022644897.1|83112_83433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644896.1|84107_84650_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	74.4	1.7e-49
WP_022644895.1|84698_84947_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_022644894.1|85015_87016_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.5	3.2e-24
WP_015632482.1|87060_87492_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_022644893.1|87488_88217_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_015632484.1|88213_88540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087439983.1|88728_90103_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_022644891.1|90273_91314_+	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_077253291.1|91678_93802_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_015065592.1|94235_95768_-|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_004196353.1|95856_97197_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_032072095.1|97452_97875_-	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196366.1|98036_99167_-	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_004196355.1|99179_99449_-	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196314.1|99554_100853_-	MFS transporter	NA	NA	NA	NA	NA
WP_004196325.1|101086_101845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196315.1|101898_102819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004196359.1|102881_103253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|104164_105484_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|105733_106615_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|106933_107713_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|107709_108735_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
>prophage 3
NZ_CP015387	Klebsiella pneumoniae strain NY9 plasmid pNY9_2, complete sequence	139933	128964	135454	139933	integrase,transposase	Burkholderia_phage(33.33%)	7	126393:126452	134860:135517
126393:126452	attL	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCA	NA	NA	NA	NA
WP_001288432.1|128964_130398_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|130431_131646_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|131906_132671_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001144737.1|132813_133080_-	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_004201280.1|133300_133774_-	trimethoprim-resistant dihydrofolate reductase DfrA14	NA	G3MBI7	Bacillus_virus	28.9	8.4e-16
WP_022644888.1|133929_134859_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	40.1	1.5e-45
WP_001067855.1|134749_135454_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
134860:135517	attR	TGGTGGCGTAAGCCGTCTTCATGGATTTAAATCCCAGCGTGGCGCCGATTATCCGTTTCAGTTTGCCATGATCGCATTCAATCACGTTGTTCCGGTACTTAATCTGTCGGTGTTCAACGTCAGACGGGCACCGGCCTTCGCGTTTGAGCAGAGCAAGCGCGCGACCATAGGCGGGCGCTTTATCCGTGTTGATGAATCGCGGGATCTGCCACTTCTTCACGTTGTTGAGGATTTTACCCAGAAACCGGTATGCAGCTTTGCTGTTACGACGGGAGGAGAGATAAAAATCGACAGTGCGGCCCCGGCTGTCGACGGCCCGGTACAGATACGCCCAGCGGCCATTGACCTTCACGTAGGTTTCATCCATGTGCCACGGGCAAAGATCGGAAGGGTTACGCCAGTACCAGCGCAGCCGTTTTTCCATTTCAGGCGCATAACGCTGAACCCAGCGGTAAATCGTGGAGTGATCGACATTCACTCCGCGTTCAGCCAGCATCTCCTGCAGCTCACGGTAACTGATGCCGTATTTGCAGTACCAGCGTACGGCCCACAGAATGATGTCACGCTGAAAATGCCGGCCTTTGAATGGGTTCATGTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGTGCC	NA	NA	NA	NA
>prophage 1
NZ_CP015388	Klebsiella pneumoniae strain NY9 plasmid pNY9_3, complete sequence	89067	1796	53242	89067	protease,transposase	Escherichia_phage(27.78%)	50	NA	NA
WP_000616807.1|1796_2450_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|2542_2800_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|2732_3134_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|3270_6168_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|6262_6868_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|7644_8037_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|8174_9059_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|9090_10290_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|10395_11046_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|11077_11320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|12941_13646_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|13789_14344_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|14474_15305_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_001067855.1|15936_16641_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001393253.1|18962_19295_+	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_000239590.1|19341_20217_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|20472_21735_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|22298_22856_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|23038_23899_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067858.1|26659_27364_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_071557810.1|27354_27495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001333089.1|30082_30364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361389.1|30486_30837_-	protein stbB	NA	NA	NA	NA	NA
WP_075995130.1|30839_31802_-	plasmid segregation protein ParM	NA	A0A222YXF2	Escherichia_phage	54.2	1.1e-94
WP_032146011.1|31948_32242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085883.1|32318_33002_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	5.6e-29
WP_001104881.1|33002_33224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274503.1|33237_33672_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_011161242.1|34371_34944_+	YubH family protein	NA	NA	NA	NA	NA
WP_001198928.1|34916_35342_+	antirestriction protein	NA	NA	NA	NA	NA
WP_001763816.1|35388_35811_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027493.1|35807_35999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|37036_37267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170695.1|37318_38680_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001298559.1|38726_39290_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_000290834.1|40138_40666_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	74.4	6.0e-47
WP_000006003.1|40723_40957_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000845953.1|43109_43544_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276217.1|43540_44260_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001312861.1|44539_44698_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000422741.1|45055_45481_+	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_000624722.1|45477_45828_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000080200.1|45858_47472_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	1.8e-182
WP_001272251.1|48152_48449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234445.1|48559_49381_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	3.4e-44
WP_000252683.1|49677_50268_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001354030.1|50602_50986_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000283561.1|51179_51851_+	conjugal transfer transcriptional regulator TraJ	NA	NA	NA	NA	NA
WP_075995131.1|51987_52161_+	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_000019473.1|52261_53242_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
