The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	451496	484753	5470889	terminase,head,capsid,protease,integrase,portal,tail,tRNA	uncultured_Caudovirales_phage(75.0%)	34	469103:469120	485098:485115
WP_002919147.1|451496_452444_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	37.2	2.2e-07
WP_002919144.1|452458_452968_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	40.3	2.6e-18
WP_002919139.1|453096_454221_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002919137.1|454192_454666_+	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_004145330.1|454691_455234_+	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_002919132.1|455238_455811_+	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	NA	NA	NA	NA
WP_002919126.1|455814_456633_+	shikimate dehydrogenase	NA	NA	NA	NA	NA
WP_002919125.1|456629_456887_+	DUF1488 domain-containing protein	NA	NA	NA	NA	NA
WP_002919123.1|456862_457417_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002919103.1|463211_463433_-	membrane protein	NA	NA	NA	NA	NA
WP_002919102.1|463726_466837_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_002919101.1|466849_467989_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_004150972.1|468367_469018_+	acrEF/envCD operon transcriptional regulator	NA	NA	NA	NA	NA
469103:469120	attL	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
WP_004150971.1|469293_470520_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	62.2	1.8e-150
WP_004150970.1|470612_471554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001547839.1|471735_472020_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_004150969.1|472030_472810_+	phage antirepressor KilAC domain-containing protein	NA	Q8HA02	Enterobacteria_phage	51.5	6.2e-40
WP_106918304.1|473261_473531_+	host cell division inhibitor Icd-like protein	NA	A0A2H4JGW3	uncultured_Caudovirales_phage	94.4	2.4e-44
WP_001549752.1|473523_473712_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150967.1|473704_474019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150966.1|474015_474384_+	hypothetical protein	NA	A0A2H4JCX7	uncultured_Caudovirales_phage	81.1	3.7e-51
WP_001549749.1|474380_474746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150965.1|474745_476881_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	62.4	3.4e-205
WP_004150964.1|477223_477559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004150963.1|477607_478120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001549743.1|478383_479550_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.9	9.8e-207
WP_001547826.1|479601_480162_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	95.7	1.2e-98
WP_004150962.1|480163_481405_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	96.5	1.0e-230
WP_004150961.1|481401_481737_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	57.8	3.7e-26
WP_001547824.1|481733_482033_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	80.8	3.4e-39
WP_004150959.1|482032_482476_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	91.8	2.8e-77
WP_004150957.1|482468_482621_+	hypothetical protein	NA	A0A2H4JCY9	uncultured_Caudovirales_phage	88.0	2.4e-17
WP_000113647.1|482751_483108_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	99.2	5.5e-60
WP_004150955.1|483091_484753_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	98.0	0.0e+00
485098:485115	attR	GTATCAGTTCATGCCGTA	NA	NA	NA	NA
>prophage 2
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	1219073	1290233	5470889	terminase,transposase,head,capsid,lysis,plate,integrase,portal,tail,tRNA	Salmonella_phage(80.0%)	84	1242292:1242338	1278859:1278905
WP_001339197.1|1219073_1220282_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_146642486.1|1220351_1220549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914261.1|1220578_1221247_-	molecular chaperone	NA	NA	NA	NA	NA
WP_002914260.1|1221288_1221837_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_004218900.1|1221940_1222558_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002914253.1|1222910_1223759_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152937.1|1223814_1224435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914250.1|1224590_1225385_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004151028.1|1225445_1226378_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_004151027.1|1226383_1227112_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_004151026.1|1227112_1228633_-	amino acid ABC transporter permease/ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.8	1.3e-33
WP_004151025.1|1228663_1229467_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002914201.1|1229486_1230554_-	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_002914200.1|1230550_1231414_-	TIM barrel protein	NA	NA	NA	NA	NA
WP_004151024.1|1231424_1232375_-	agmatinase	NA	NA	NA	NA	NA
WP_002914199.1|1232490_1233402_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002914191.1|1233815_1234295_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000347934.1|1234364_1237517_-	multidrug efflux RND transporter permease subunit OqxB	NA	NA	NA	NA	NA
WP_002914189.1|1237540_1238716_-	multidrug efflux RND transporter periplasmic adaptor subunit OqxA	NA	NA	NA	NA	NA
WP_002914181.1|1239050_1239413_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002914180.1|1239423_1239996_-	flavin reductase	NA	NA	NA	NA	NA
WP_002914178.1|1240207_1241092_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004151022.1|1241216_1242017_+	hypothetical protein	NA	NA	NA	NA	NA
1242292:1242338	attL	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004151021.1|1242451_1244002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151020.1|1243998_1245024_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	93.8	1.5e-190
WP_004151019.1|1245026_1245656_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	54.5	1.4e-61
WP_001397669.1|1245778_1246021_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	98.8	4.0e-38
WP_004151018.1|1246053_1246563_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	85.8	1.1e-77
WP_004151017.1|1246570_1246771_+	DUF2724 domain-containing protein	NA	A0A1S6L005	Salmonella_phage	68.8	4.5e-19
WP_004144796.1|1246734_1247073_+	DUF5347 domain-containing protein	NA	A0A218M4I7	Erwinia_phage	58.0	6.2e-29
WP_004151016.1|1247140_1247374_+	DUF2732 family protein	NA	A0A1S6L021	Salmonella_phage	90.9	6.0e-31
WP_004151014.1|1247373_1247601_+	TraR/DksA family transcriptional regulator	NA	A0A1S6L007	Salmonella_phage	92.0	5.1e-35
WP_004151013.1|1247597_1248449_+	DNA adenine methylase	NA	A0A1S6L011	Salmonella_phage	75.4	2.2e-115
WP_077274515.1|1248445_1250830_+	replication endonuclease	NA	A0A1S6L028	Salmonella_phage	87.8	0.0e+00
WP_004151011.1|1250992_1251181_+	hypothetical protein	NA	A0A1S6L006	Salmonella_phage	90.3	2.2e-23
WP_004151010.1|1251192_1251426_+	DinI family protein	NA	A0A0M4S6H1	Salmonella_phage	96.1	2.0e-34
WP_004151009.1|1251521_1252205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151008.1|1252191_1253271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004151007.1|1253270_1254272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024940854.1|1254793_1255063_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	41.3	1.4e-15
WP_004151006.1|1255119_1256163_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	85.6	3.1e-172
WP_019405037.1|1256162_1257926_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	91.8	0.0e+00
WP_004151004.1|1258066_1258900_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	77.6	4.4e-100
WP_004151003.1|1258916_1259969_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	91.0	6.8e-175
WP_004134644.1|1259972_1260626_+|terminase	terminase endonuclease subunit	terminase	A0A1S6KZX1	Salmonella_phage	80.0	1.9e-90
WP_004151002.1|1260721_1261186_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	85.7	1.5e-73
WP_004151001.1|1261185_1261389_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	89.6	9.8e-30
WP_004134639.1|1261392_1261608_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	88.7	6.1e-30
WP_004151000.1|1261588_1262098_+	lysozyme	NA	E5G6N1	Salmonella_phage	85.2	1.6e-81
WP_004150999.1|1262102_1262486_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	45.4	1.9e-18
WP_004150998.1|1262482_1262911_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	82.5	7.1e-54
WP_072093160.1|1262885_1263044_+	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	75.0	9.0e-15
WP_004150997.1|1263006_1263429_+|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	83.2	8.2e-63
WP_004150996.1|1263421_1263868_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	72.3	2.5e-54
WP_004150995.1|1263890_1264757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150994.1|1264851_1265424_+|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	70.8	1.4e-76
WP_004150993.1|1265420_1265783_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	85.6	8.4e-48
WP_004150992.1|1265769_1266678_+|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	68.9	1.9e-109
WP_004152935.1|1266670_1267342_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	58.9	3.2e-61
WP_004150990.1|1267343_1269293_+	CotH kinase family protein	NA	Q6QI97	Burkholderia_phage	38.9	1.0e-06
WP_004200602.1|1269302_1270421_+	hypothetical protein	NA	A0A248XD67	Klebsiella_phage	38.0	4.4e-55
WP_004150988.1|1270472_1271546_+|tail	phage tail protein	tail	A0A1S6KZZ8	Salmonella_phage	53.6	6.6e-40
WP_004150987.1|1271694_1272867_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	91.5	3.4e-207
WP_004150986.1|1272876_1273392_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	84.2	1.4e-80
WP_004150985.1|1273444_1273744_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	78.0	8.2e-33
WP_002896220.1|1273758_1273878_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_072093161.1|1274104_1276501_+|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.5	8.1e-107
WP_004150983.1|1276497_1276983_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.1	5.2e-61
WP_004150982.1|1276979_1278074_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	83.6	2.4e-170
WP_004150981.1|1278140_1278359_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	72.2	1.9e-26
WP_004150980.1|1278386_1278764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002914164.1|1279367_1279850_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	2.3e-29
1278859:1278905	attR	TTTGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_004188817.1|1279960_1280437_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_002914161.1|1280426_1280717_+	RnfH family protein	NA	NA	NA	NA	NA
WP_002914160.1|1280783_1281125_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_002914159.1|1281272_1282934_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_002914158.1|1283020_1283899_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_002914155.1|1284023_1284614_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_004149392.1|1284733_1286020_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002914153.1|1286039_1286831_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_002914152.1|1286994_1288359_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002914149.1|1288618_1288867_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_004150977.1|1288885_1289434_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002914147.1|1289465_1290233_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
>prophage 3
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	1399894	1460148	5470889	terminase,transposase,holin,capsid,tail	Salmonella_phage(41.51%)	71	NA	NA
WP_004152546.1|1399894_1400488_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|1400484_1400643_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_077274516.1|1400646_1400928_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	73.9	4.7e-30
WP_004152543.1|1401037_1401286_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152542.1|1401337_1402360_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	95.3	2.4e-180
WP_004152541.1|1402369_1403269_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|1403265_1403565_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|1403561_1403711_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004152539.1|1403931_1404513_-	helix-turn-helix transcriptional regulator	NA	Q858D7	Salmonella_phage	64.8	1.9e-65
WP_004152538.1|1404666_1404900_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|1405046_1405256_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|1405255_1406023_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|1406019_1406805_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|1406924_1407272_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|1407463_1407874_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|1407857_1408049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|1408045_1408471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|1408467_1409211_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152528.1|1409210_1409381_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004141386.1|1409381_1409594_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|1409590_1410259_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|1410251_1410491_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|1410490_1410829_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004178082.1|1410925_1412413_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004152524.1|1412813_1413071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|1413148_1413733_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_020314691.1|1413729_1415205_+	hypothetical protein	NA	Q858H3	Salmonella_phage	92.7	3.2e-279
WP_004152473.1|1415248_1415770_-	DUF2829 domain-containing protein	NA	A0A1B0VMG3	Pseudomonas_phage	55.2	7.8e-47
WP_004152472.1|1416475_1416679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152471.1|1416682_1418362_+|tail	tail protein	tail	T1S9Z7	Salmonella_phage	58.9	3.4e-192
WP_004152470.1|1418358_1418664_+	hypothetical protein	NA	Q2A090	Sodalis_phage	51.3	1.1e-16
WP_004152468.1|1418945_1419344_+	peptidase	NA	T1SAP9	Salmonella_phage	59.5	5.6e-37
WP_004152467.1|1419356_1420364_+|capsid	phage capsid protein	capsid	T1S9H9	Salmonella_phage	92.5	2.7e-181
WP_004152466.1|1420373_1420766_+	hypothetical protein	NA	T1SA71	Salmonella_phage	89.9	1.5e-55
WP_004152465.1|1420758_1421037_+	hypothetical protein	NA	T1SA01	Salmonella_phage	58.9	6.7e-21
WP_004153043.1|1421085_1421697_+	hypothetical protein	NA	T1SAQ2	Salmonella_phage	48.8	1.2e-46
WP_004152463.1|1421696_1424174_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	56.5	3.6e-267
WP_004152462.1|1424175_1424646_+	hypothetical protein	NA	Q858G2	Salmonella_phage	55.3	7.3e-44
WP_004152461.1|1424638_1425136_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	40.5	5.7e-23
WP_004243852.1|1425148_1427893_+	hypothetical protein	NA	A0A193GYI3	Enterobacter_phage	39.2	1.2e-93
WP_004152459.1|1427892_1431282_+	hypothetical protein	NA	G9L6D4	Escherichia_phage	42.0	6.3e-121
WP_004152458.1|1431291_1431906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152457.1|1432180_1432579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077274517.1|1432583_1432766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152455.1|1432956_1433652_-	hypothetical protein	NA	A0A193GYJ9	Enterobacter_phage	52.7	4.4e-61
WP_157833602.1|1433735_1433924_-	ash family protein	NA	NA	NA	NA	NA
WP_004152454.1|1434032_1434230_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0M4RCZ9	Salmonella_phage	69.8	2.0e-19
WP_004152453.1|1434233_1434491_-	DUF1902 domain-containing protein	NA	A0A0M4R2Z9	Salmonella_phage	54.1	2.3e-12
WP_004152452.1|1434581_1434878_-	hypothetical protein	NA	T1SA06	Salmonella_phage	65.5	6.2e-25
WP_004221284.1|1435029_1437399_+|tail	phage tail fibers	tail	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004229092.1|1437407_1437560_+	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004146394.1|1437683_1438088_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|1438074_1438380_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|1438369_1438999_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|1438995_1439478_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_004152009.1|1439697_1441566_-	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	22.6	2.6e-07
WP_004162150.1|1441549_1442728_-	anaerobic sulfatase maturase	NA	NA	NA	NA	NA
WP_002913847.1|1443021_1444254_-	MFS transporter	NA	NA	NA	NA	NA
WP_004221278.1|1444327_1445239_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004174861.1|1445335_1445509_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	78.8	1.4e-16
WP_002913841.1|1445879_1448108_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_002913839.1|1448161_1449694_-	exopolyphosphatase	NA	NA	NA	NA	NA
WP_002913838.1|1449697_1451758_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_004152007.1|1451938_1452580_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	41.1	1.2e-28
WP_002913836.1|1452576_1453614_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.5	8.2e-72
WP_002913833.1|1453877_1454771_+	ROK family protein	NA	NA	NA	NA	NA
WP_002913829.1|1454780_1456214_+	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002913827.1|1456431_1457058_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_002913824.1|1457153_1458440_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	38.1	1.9e-65
WP_020947395.1|1458538_1459240_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_002913812.1|1459236_1460148_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	58.8	3.5e-74
>prophage 4
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	1771624	1778531	5470889	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004175147.1|1771624_1772488_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_002912638.1|1772498_1773272_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.3	1.5e-25
WP_004151134.1|1773514_1774411_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_002912635.1|1774653_1776015_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.5	2.5e-206
WP_002912634.1|1776333_1777056_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	6.4e-31
WP_004151135.1|1777052_1778531_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	1.1e-29
>prophage 5
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	1815098	1822723	5470889		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1815098_1816505_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1816729_1817794_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1817820_1818690_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1818721_1819612_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1819626_1820181_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1820361_1821528_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1821721_1822723_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 6
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	2194390	2251168	5470889	transposase,plate,protease	Staphylococcus_phage(15.38%)	54	NA	NA
WP_002910830.1|2194390_2195137_+|protease	proteasome-type protease	protease	NA	NA	NA	NA
WP_002910809.1|2195575_2196562_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_077274528.1|2196554_2197397_+	PhnD/SsuA/transferrin family substrate-binding protein	NA	NA	NA	NA	NA
WP_002910767.1|2197340_2197514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004219597.1|2197811_2197955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910764.1|2198131_2199073_+	transcriptional regulator TdcA	NA	NA	NA	NA	NA
WP_002910762.1|2199166_2200156_+	bifunctional threonine ammonia-lyase/L-serine ammonia-lyase TdcB	NA	NA	NA	NA	NA
WP_004145486.1|2200181_2201513_+	threonine/serine transporter TdcC	NA	NA	NA	NA	NA
WP_002910759.1|2201540_2202749_+	propionate kinase	NA	NA	NA	NA	NA
WP_004152312.1|2202777_2205072_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.8	2.3e-159
WP_004225356.1|2205123_2205270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002910729.1|2205559_2206618_+	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002910727.1|2206727_2207642_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002910725.1|2207651_2208929_+	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_002910722.1|2208925_2209801_+	ATP-binding cassette domain-containing protein	NA	A0A285PWH2	Cedratvirus	25.5	1.5e-10
WP_002910721.1|2209797_2210517_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.0	2.5e-11
WP_002910720.1|2210522_2211416_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910719.1|2211699_2213343_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	50.4	9.8e-136
WP_002910717.1|2213392_2213869_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002910715.1|2213967_2214894_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152313.1|2215197_2216493_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	36.8	1.3e-61
WP_004899032.1|2216504_2217314_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_004152315.1|2217288_2218188_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002910657.1|2218297_2218780_-	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_002910654.1|2218970_2219669_+	RluA family pseudouridine synthase	NA	A0A2H4UV25	Bodo_saltans_virus	27.2	2.6e-05
WP_002910652.1|2219694_2220234_-	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_002910650.1|2220348_2220678_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_002910645.1|2221246_2222587_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004152316.1|2222583_2223237_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_004152317.1|2223240_2224938_+	OmpA family protein	NA	NA	NA	NA	NA
WP_004152319.1|2227901_2229257_+	S-type pyocin domain-containing protein	NA	NA	NA	NA	NA
WP_002910593.1|2229257_2229767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910591.1|2229763_2230270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910589.1|2230364_2230517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910586.1|2230506_2231016_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001339197.1|2231532_2232741_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_022644641.1|2233959_2234928_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.3	6.5e-180
WP_004199326.1|2235069_2235252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004153085.1|2235248_2235578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910551.1|2235574_2236081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910547.1|2237596_2237902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910544.1|2237923_2238817_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	30.5	6.7e-14
WP_004217423.1|2238862_2238979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152633.1|2239000_2239894_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.3	1.7e-12
WP_038435084.1|2239919_2240048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910539.1|2240069_2240963_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A075BSL8	Microcystis_phage	27.1	2.8e-12
WP_004152632.1|2241138_2242029_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.8	4.1e-11
WP_000019473.1|2242365_2243346_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_171815252.1|2243403_2243706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072093174.1|2243966_2244152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002910497.1|2244449_2244716_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_004198077.1|2244719_2245877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152262.1|2245860_2249271_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_002910495.1|2249404_2251168_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 7
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	3567546	3660503	5470889	terminase,head,capsid,protease,lysis,plate,tail,portal,integrase,tRNA	Salmonella_phage(58.62%)	94	3623072:3623090	3660578:3660596
WP_002898139.1|3567546_3568839_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.7	7.3e-94
WP_002898137.1|3568929_3570273_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	7.3e-81
WP_002898132.1|3570281_3570893_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_004150846.1|3571015_3575269_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.2	5.2e-88
WP_000228469.1|3575404_3575899_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_002898019.1|3576431_3577400_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.0	3.2e-62
WP_002898017.1|3577514_3579281_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	2.3e-21
WP_004150847.1|3579281_3581003_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.4	3.4e-14
WP_002898014.1|3581047_3581749_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3582102_3582321_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3582441_3584721_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3584751_3585069_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3585394_3585616_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_004150848.1|3585692_3587633_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	1.9e-37
WP_002896440.1|3587629_3588745_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_002896437.1|3588891_3590550_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_002896434.1|3590969_3591665_+	aquaporin Z	NA	NA	NA	NA	NA
WP_004147773.1|3591780_3592680_+	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_002896412.1|3592823_3594476_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_002896410.1|3594486_3595455_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_002896408.1|3595666_3596101_-	DoxX family protein	NA	NA	NA	NA	NA
WP_002896406.1|3596252_3597971_+	ubiquinone-dependent pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_002896404.1|3598009_3599011_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_002896401.1|3599021_3600464_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002896399.1|3600551_3601565_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_002896397.1|3601561_3602392_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	31.6	4.1e-05
WP_004150851.1|3602423_3603563_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_002896394.1|3604440_3604956_+	lipoprotein	NA	NA	NA	NA	NA
WP_002896392.1|3605182_3605911_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	37.1	1.2e-29
WP_002896390.1|3605931_3606663_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896386.1|3606669_3607386_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004150852.1|3607385_3608054_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_002896384.1|3608237_3608969_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002896382.1|3609011_3610484_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	31.8	7.9e-28
WP_002896380.1|3610480_3611197_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	2.1e-34
WP_002896378.1|3611275_3612403_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A2K5B251	Erysipelothrix_phage	25.6	1.3e-19
WP_002896376.1|3612444_3612933_-	DUF2593 family protein	NA	NA	NA	NA	NA
WP_002896372.1|3612990_3613836_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_002896371.1|3613832_3614786_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_002896370.1|3614796_3615930_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	2.2e-30
WP_002896368.1|3616093_3617206_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_002896365.1|3617554_3618034_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_002896363.1|3618122_3619025_-	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	35.3	2.0e-34
WP_002896354.1|3619846_3620134_-	YbjC family protein	NA	NA	NA	NA	NA
WP_002896352.1|3620336_3620600_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	73.1	1.6e-27
WP_002896351.1|3620606_3620990_-	membrane protein	NA	NA	NA	NA	NA
WP_004179131.1|3621256_3622942_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
3623072:3623090	attL	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
WP_000972391.1|3623161_3623380_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_002896225.1|3623471_3624572_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	4.9e-176
WP_002896224.1|3624568_3625054_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	75.6	7.2e-63
WP_014342962.1|3625050_3627444_-|tail	phage tail tape measure protein	tail	E5FFG5	Burkholderia_phage	44.0	1.1e-106
WP_002896220.1|3627670_3627790_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.2e-13
WP_002896204.1|3627804_3628104_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	79.0	3.7e-33
WP_002896201.1|3628156_3628672_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	85.4	1.3e-81
WP_002896193.1|3628681_3629854_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	93.3	1.9e-210
WP_002896191.1|3629992_3631069_-|tail	phage tail protein	tail	Q37842	Escherichia_phage	44.8	1.2e-25
WP_002896188.1|3631098_3631302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171482189.1|3631298_3631673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019724930.1|3632033_3632768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004150856.1|3634986_3635586_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	60.5	1.3e-58
WP_002896182.1|3635578_3636487_-|plate	baseplate assembly protein	plate	E5G6N8	Salmonella_phage	66.9	7.6e-106
WP_002896179.1|3636473_3636836_-	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	84.7	5.8e-49
WP_002896177.1|3636832_3637405_-|plate	phage baseplate assembly protein V	plate	E5G6N6	Salmonella_phage	72.3	4.7e-77
WP_004150857.1|3637499_3638192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002896175.1|3638188_3638635_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	71.2	2.2e-50
WP_002896172.1|3638627_3639059_-|tail	phage tail protein	tail	A0A1S6KZY0	Salmonella_phage	82.5	9.9e-64
WP_002896170.1|3639021_3639168_-	hypothetical protein	NA	A0A1S6KZX6	Salmonella_phage	76.1	6.0e-13
WP_002896168.1|3639154_3639583_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A1S6KZX8	Salmonella_phage	77.9	9.6e-51
WP_002896163.1|3639579_3639963_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	42.0	2.1e-17
WP_002896161.1|3639967_3640477_-	lysozyme	NA	E5G6N1	Salmonella_phage	83.4	2.1e-81
WP_002896158.1|3640457_3640673_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	90.1	3.6e-30
WP_002896155.1|3640676_3640880_-|tail	tail protein X	tail	A0A1S6KZY4	Salmonella_phage	88.1	1.3e-29
WP_002896151.1|3640879_3641344_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	8.4e-77
WP_000059191.1|3641439_3642090_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_077274541.1|3642093_3643152_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.8	7.1e-180
WP_002895967.1|3643168_3644002_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	88.8	6.3e-123
WP_004150858.1|3644144_3645911_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.0	0.0e+00
WP_002895959.1|3645910_3646936_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	86.7	7.6e-171
WP_004199124.1|3646997_3648740_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|3649015_3649693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|3649807_3650041_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|3650051_3650240_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_032413214.1|3650393_3652814_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.3	0.0e+00
WP_004150863.1|3652810_3653668_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.4	2.0e-156
WP_000752622.1|3653664_3653892_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_004150864.1|3653891_3654125_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	96.1	4.1e-32
WP_000963473.1|3654192_3654534_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_000956179.1|3654497_3654698_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	97.0	1.6e-32
WP_000460893.1|3654705_3655215_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188448.1|3655247_3655469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152885.1|3655614_3656493_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	39.9	1.7e-30
WP_004150866.1|3656504_3657449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|3657547_3659035_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_014342959.1|3659522_3660503_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	57.2	1.4e-97
3660578:3660596	attR	ATGGGTTTTTTGTTGCCTG	NA	NA	NA	NA
>prophage 8
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	4315175	4326829	5470889	integrase	Enterobacteria_phage(70.0%)	13	4315625:4315639	4338682:4338696
WP_004144574.1|4315175_4316279_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.5	4.8e-62
4315625:4315639	attL	CAATCTCTCCGCGCT	NA	NA	NA	NA
WP_002889940.1|4316289_4317543_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	44.9	8.9e-89
WP_002889938.1|4317895_4319086_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	62.7	6.4e-145
WP_004152029.1|4319073_4320024_+	AAA family ATPase	NA	A0A1X9IGI7	Lactococcus_phage	27.1	1.2e-13
WP_004152979.1|4320023_4320449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889930.1|4321017_4321584_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	64.3	1.5e-59
WP_002889919.1|4321601_4321847_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	58.0	1.9e-19
WP_002889917.1|4321843_4322581_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	60.7	9.0e-73
WP_002889915.1|4323122_4323389_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_072028197.1|4323391_4323943_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.8e-33
WP_002889911.1|4323939_4324167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002889897.1|4324163_4324484_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_002889890.1|4324495_4326829_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	82.2	0.0e+00
4338682:4338696	attR	CAATCTCTCCGCGCT	NA	NA	NA	NA
>prophage 9
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	4796409	4802234	5470889		Enterobacteria_phage(100.0%)	8	NA	NA
WP_004152207.1|4796409_4798743_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	83.9	0.0e+00
WP_004152206.1|4798757_4799078_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_004152205.1|4799074_4799302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093163.1|4799298_4799841_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	69.4	1.1e-30
WP_000556592.1|4799843_4800110_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_004152204.1|4800670_4801408_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	59.4	1.1e-70
WP_004152203.1|4801404_4801650_+	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	56.8	5.5e-19
WP_004152202.1|4801667_4802234_+	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	9.7e-59
>prophage 10
NZ_CP015392	Klebsiella pneumoniae strain CR14 chromosome, complete genome	5470889	5212910	5260499	5470889	terminase,tail,holin,integrase	Salmonella_phage(35.42%)	57	5206928:5206944	5250791:5250807
5206928:5206944	attL	AGGTGCTGCCGCAGATC	NA	NA	NA	NA
WP_004152055.1|5212910_5214737_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	5.7e-84
WP_002883408.1|5214804_5215665_-	phospholipase A	NA	NA	NA	NA	NA
WP_002883404.1|5215817_5216282_+	thioesterase family protein	NA	NA	NA	NA	NA
WP_004152549.1|5216877_5218128_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1X9TCT6	Enterobacter_phage	85.3	1.4e-206
WP_004152548.1|5218144_5218336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152547.1|5218332_5218515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152546.1|5218511_5219105_-	adenine methylase	NA	T1SA14	Salmonella_phage	92.4	4.3e-110
WP_004152545.1|5219101_5219260_-	DUF1317 family protein	NA	T1SAR0	Salmonella_phage	78.8	1.9e-17
WP_004153052.1|5219252_5219546_-	PerC family transcriptional regulator	NA	T1S9J5	Salmonella_phage	71.1	8.9e-32
WP_004152543.1|5219655_5219904_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	69.5	1.1e-27
WP_004152541.1|5220986_5221886_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	93.0	1.5e-159
WP_004164029.1|5221882_5222182_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	54.5	2.1e-20
WP_004164037.1|5222178_5222328_-	hypothetical protein	NA	G9L6A5	Escherichia_phage	84.2	7.9e-13
WP_004152538.1|5223281_5223515_+	hypothetical protein	NA	T1SAR5	Salmonella_phage	66.2	9.2e-24
WP_004152537.1|5223660_5223870_+	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	78.3	1.8e-26
WP_004207253.1|5223869_5224637_+	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	91.4	8.9e-140
WP_004152535.1|5224633_5225419_+	replication protein	NA	A0A193GYX1	Enterobacter_phage	87.4	8.2e-133
WP_004152534.1|5225538_5225886_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	82.6	5.0e-50
WP_004152532.1|5226078_5226489_+	hypothetical protein	NA	A0A2P1MXC5	Escherichia_phage	42.2	3.1e-14
WP_004152531.1|5226472_5226664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152530.1|5226660_5227086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152529.1|5227082_5227826_+	hypothetical protein	NA	A6N3G8	Burkholderia_virus	59.5	1.5e-19
WP_004152528.1|5227825_5227996_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	69.6	2.5e-15
WP_004141386.1|5227996_5228209_+	hypothetical protein	NA	A0A0F6TJE4	Escherichia_coli_O157_typing_phage	45.5	8.1e-11
WP_004152527.1|5228205_5228874_+	DUF551 domain-containing protein	NA	Q6UAT8	Klebsiella_phage	52.5	1.5e-05
WP_004152526.1|5228866_5229106_+	hypothetical protein	NA	G8C7S3	Escherichia_phage	48.0	4.6e-10
WP_004152525.1|5229105_5229444_+	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	80.0	4.7e-45
WP_004152524.1|5229518_5229776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152523.1|5229853_5230438_+|terminase	terminase small subunit	terminase	T1SBI8	Salmonella_phage	88.1	2.4e-89
WP_004154331.1|5230434_5231910_+	hypothetical protein	NA	Q858H3	Salmonella_phage	93.1	3.8e-280
WP_004152449.1|5231976_5232288_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	45.2	2.5e-16
WP_004141368.1|5233089_5233296_+	hypothetical protein	NA	T1SA67	Salmonella_phage	88.2	4.8e-08
WP_004152447.1|5233310_5234993_+|tail	tail protein	tail	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	84.6	2.3e-265
WP_004152446.1|5234989_5235286_+	hypothetical protein	NA	T1SBI9	Salmonella_phage	70.4	1.2e-33
WP_004152445.1|5235288_5235969_+	peptidase	NA	G9L6C4	Escherichia_phage	83.5	4.0e-75
WP_032413483.1|5235983_5236970_+	phage protein	NA	A0A193GZ49	Enterobacter_phage	94.2	2.5e-179
WP_004152443.1|5237023_5237461_+	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	91.0	4.8e-66
WP_004152442.1|5237471_5237813_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	70.8	4.0e-36
WP_004152441.1|5237863_5238187_+	hypothetical protein	NA	G9L6C8	Escherichia_phage	85.0	5.3e-46
WP_004152440.1|5238186_5238792_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	78.5	2.8e-88
WP_004152439.1|5238791_5241290_+	hypothetical protein	NA	Q858G3	Salmonella_phage	84.0	0.0e+00
WP_004152438.1|5241289_5241754_+	hypothetical protein	NA	Q858G2	Salmonella_phage	81.2	1.5e-70
WP_004152437.1|5241753_5242293_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	80.0	6.1e-71
WP_077274554.1|5242303_5245135_+	hypothetical protein	NA	Q858G0	Salmonella_phage	75.6	0.0e+00
WP_004152435.1|5245134_5247045_+	hypothetical protein	NA	Q858F9	Salmonella_phage	81.9	5.2e-290
WP_004152434.1|5247044_5249810_+	hypothetical protein	NA	Q858F8	Salmonella_phage	94.5	0.0e+00
WP_071531206.1|5249952_5250336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152433.1|5250421_5251111_-	hypothetical protein	NA	G9L6E2	Escherichia_phage	65.2	1.6e-79
5250791:5250807	attR	GATCTGCGGCAGCACCT	NA	NA	NA	NA
WP_004152432.1|5251425_5251722_-	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	64.0	1.1e-24
WP_004207261.1|5251878_5254245_+	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	79.5	9.1e-268
WP_004229092.1|5254253_5254406_+	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	54.3	1.9e-06
WP_004146394.1|5254529_5254934_+	membrane protein	NA	T1SA79	Salmonella_phage	84.1	9.3e-56
WP_004146393.1|5254920_5255226_+|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	82.4	2.7e-39
WP_004152706.1|5255215_5255845_+	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	76.4	3.1e-90
WP_004152707.1|5255841_5256324_+	DUF2514 domain-containing protein	NA	Q858E9	Salmonella_phage	80.6	3.0e-61
WP_002883400.1|5257030_5257981_-	magnesium/cobalt transporter CorA	NA	NA	NA	NA	NA
WP_002883398.1|5258336_5260499_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.3	6.0e-117
>prophage 1
NZ_CP015393	Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence	202696	21194	52869	202696	integrase,transposase,protease	Escherichia_phage(25.0%)	28	17707:17722	60124:60139
17707:17722	attL	CGCAGGCCGTCGCCGC	NA	NA	NA	NA
WP_020314316.1|21194_22541_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_004152113.1|24383_25346_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|25332_26082_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152115.1|26319_26517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|26516_29312_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|29426_29996_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|30030_30312_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|30555_30819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|30833_31097_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000019473.1|32298_33279_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_004152692.1|34487_35357_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004152693.1|35350_36361_-	phosphonate dehydrogenase PtxD	NA	A0A1V0SBV6	Catovirus	25.1	1.4e-15
WP_004152694.1|36369_37197_-	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_004152695.1|37205_38069_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004153729.1|38065_38893_-	phosphonate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	2.6e-20
WP_004217321.1|39748_40453_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000427623.1|41787_42792_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_071527925.1|43089_43332_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004118251.1|43662_43956_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	96.9	2.7e-49
WP_004152282.1|44054_44822_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	25.2	9.8e-14
WP_004152281.1|44822_45779_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	NA	NA	NA	NA
WP_004118243.1|45775_46774_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_004118241.1|46770_47673_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_004152280.1|47717_50042_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_004118237.1|50127_51081_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_004118235.1|51077_51599_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_161989521.1|52560_52773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118231.1|52701_52869_+|integrase	integrase	integrase	NA	NA	NA	NA
60124:60139	attR	GCGGCGACGGCCTGCG	NA	NA	NA	NA
>prophage 2
NZ_CP015393	Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence	202696	65152	97884	202696	transposase	Escherichia_phage(44.44%)	24	NA	NA
WP_020956879.1|65152_65539_-|transposase	transposase	transposase	B6DZU5	Stx2-converting_phage	90.7	1.1e-58
WP_004118217.1|66086_66722_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005560.1|66718_67831_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	S5WIP3	Leptospira_phage	33.8	1.5e-47
WP_004118216.1|67823_69212_-	His-Xaa-Ser system radical SAM maturase HxsB	NA	S5VT21	Leptospira_phage	29.0	6.3e-51
WP_000333416.1|69211_69484_-	His-Xaa-Ser system protein HxsD	NA	NA	NA	NA	NA
WP_000412211.1|71100_71760_+	type A-1 chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	100.0	8.4e-131
WP_000656305.1|71960_72338_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000427623.1|72648_73653_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_000184001.1|73880_75086_+	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000130000.1|75096_75402_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|75628_76393_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001137892.1|76885_77470_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|77469_78708_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|78704_79610_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_044503635.1|79731_80400_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.1	3.3e-130
WP_000427623.1|80691_81696_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004152284.1|82099_83110_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004152286.1|83570_84653_+	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	96.4	6.8e-186
WP_004152287.1|84774_87849_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	96.7	0.0e+00
WP_003846917.1|87900_89154_+	lactose permease	NA	NA	NA	NA	NA
WP_004152290.1|90859_93169_+	TerB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004152291.1|93172_94489_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_000093087.1|94485_96681_+	DEAD/DEAH box helicase	NA	NA	NA	NA	NA
WP_000019473.1|96903_97884_-|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
>prophage 3
NZ_CP015393	Klebsiella pneumoniae strain CR14 plasmid pCR14_1, complete sequence	202696	136079	184714	202696	integrase,transposase,holin	Macacine_betaherpesvirus(15.0%)	49	154335:154351	185396:185412
WP_001339197.1|136079_137288_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_004178059.1|137692_137998_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_004178060.1|138011_138380_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_004208838.1|138433_138805_-	TraY domain-containing protein	NA	NA	NA	NA	NA
WP_011977735.1|138888_139575_-	conjugal transfer protein TraJ	NA	NA	NA	NA	NA
WP_004178062.1|139797_140190_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_004178063.1|140623_141109_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_011977736.1|141141_141471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178064.1|141503_142325_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.4	2.6e-44
WP_004152722.1|143158_143572_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004152721.1|143572_143851_-	helix-turn-helix transcriptional regulator	NA	O64356	Escherichia_phage	39.4	2.5e-07
WP_004152720.1|143840_144161_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A088CBP5	Shigella_phage	39.5	6.8e-09
WP_004152719.1|144241_144466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152718.1|144476_144689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152717.1|144749_145106_-	hypothetical protein	NA	A0A248SL90	Klebsiella_phage	58.1	2.6e-25
WP_004152758.1|145741_146092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152759.1|146088_146361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118124.1|147060_147222_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_004220208.1|147293_148373_+|transposase	IS481-like element ISKpn28 family transposase	transposase	NA	NA	NA	NA
WP_004152638.1|148550_148925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152639.1|148980_149307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152640.1|149303_150032_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_004152641.1|150028_150460_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_004178066.1|150526_152563_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.0	9.0e-22
WP_004152643.1|152632_152881_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_004152644.1|152929_153472_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	6.0e-50
WP_004152645.1|154247_154811_-	methyltransferase	NA	A8HNV9	Thalassomonas_phage	34.1	1.3e-18
154335:154351	attL	CTCCAGCGCCTTTTGCT	NA	NA	NA	NA
WP_004178068.1|154858_156214_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_004198570.1|156265_156496_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178072.1|156587_156815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118473.1|157596_157914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152754.1|157948_158203_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	1.2e-11
WP_004118478.1|158439_158865_-	antirestriction protein	NA	NA	NA	NA	NA
WP_004152753.1|159385_159616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004178082.1|159849_161337_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_004178083.1|161739_162165_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	49.6	8.3e-31
WP_004152715.1|162164_163436_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.6e-155
WP_004152062.1|166387_167359_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	86.6	4.1e-150
WP_000523813.1|167358_168525_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	97.7	1.4e-224
WP_004152063.1|169276_170287_+	replication initiation protein	NA	J9Q7H0	Salmonella_phage	55.9	8.8e-87
WP_001515717.1|171003_171744_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|172887_173835_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|173861_174173_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_011977741.1|174192_175161_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.5e-184
WP_004197688.1|175833_176091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020444838.1|176692_178147_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|179129_180407_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|180469_182467_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|183506_184714_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
185396:185412	attR	AGCAAAAGGCGCTGGAG	NA	NA	NA	NA
>prophage 1
NZ_CP015394	Klebsiella pneumoniae strain CR14 plasmid pCR14_2, complete sequence	154343	105708	128892	154343	transposase,integrase	Salmonella_phage(30.0%)	20	100093:100107	125842:125856
100093:100107	attL	TCTGTGACTGGTGAG	NA	NA	NA	NA
WP_000427623.1|105708_106713_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_001138073.1|106791_109764_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.1	0.0e+00
WP_001162012.1|109766_110324_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_000845054.1|110629_111643_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_032488579.1|111792_112347_+	aminoglycoside N-acetyltransferase AAC(6')-Ib3	NA	NA	NA	NA	NA
WP_001007673.1|112428_113256_+	oxacillin-hydrolyzing class D beta-lactamase OXA-2	NA	NA	NA	NA	NA
WP_000470556.1|113316_113607_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_000679427.1|113711_114059_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|114052_114892_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000050481.1|115296_116838_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_025368620.1|117336_118212_+	class A extended-spectrum beta-lactamase CTX-M-2	NA	A0A1B0VBP7	Salmonella_phage	81.5	1.0e-123
WP_000679427.1|119295_119643_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|119636_120476_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376623.1|120603_121104_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_012291341.1|121621_124630_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.5	0.0e+00
WP_001235713.1|124793_125351_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|125533_126394_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
125842:125856	attR	CTCACCAGTCACAGA	NA	NA	NA	NA
WP_000557452.1|126535_127396_+	aminoglycoside N-acetyltransferase AAC(3)-IIe	NA	NA	NA	NA	NA
WP_000587836.1|127408_127702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162832797.1|127754_128892_+|transposase	IS3-like element ISKpn11 family transposase	transposase	A0A2P1JR32	Mycobacterium_phage	32.3	1.5e-18
>prophage 1
NZ_CP015395	Klebsiella pneumoniae strain CR14 plasmid pCR14_3, complete sequence	116419	7713	55909	116419	bacteriocin,transposase,integrase	Escherichia_phage(21.43%)	44	NA	NA
WP_001339197.1|7713_8922_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_004152343.1|9334_12592_+	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_004152342.1|12596_13865_+|transposase	ISL3-like element ISKpn25 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.7	5.2e-60
WP_004152341.1|13984_14458_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_011977773.1|14549_14780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152340.1|15671_16454_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	4.6e-51
WP_004152339.1|16453_16786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004171440.1|16792_17191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152337.1|17216_17546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152336.1|17573_17882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004153649.1|17927_18134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072093212.1|18368_18830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|18786_19017_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|19013_19430_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|19503_20214_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|20945_21071_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|21106_21529_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|21580_23275_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|23292_23655_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|23651_23888_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|23923_24592_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000027057.1|26502_27363_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|29106_29811_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004152403.1|29883_32781_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|32869_33490_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|34655_35015_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|35518_36703_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|36979_38299_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|38548_39430_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|39717_40497_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|40493_41519_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|41625_44655_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|44764_46480_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001404092.1|46774_46930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|46978_47971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152390.1|47997_48159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152389.1|48367_48979_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_004152388.1|48962_49526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152292.1|50744_51602_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_004171457.1|51594_51672_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_004199332.1|51888_52167_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_009485932.1|52487_52967_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	35.2	9.8e-20
WP_004152296.1|53307_53586_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_004178051.1|53587_55909_-|bacteriocin	klebicin B-related nuclease bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP015396	Klebsiella pneumoniae strain CR14 plasmid pCR14_4, complete sequence	110092	4233	63078	110092	lysis,transposase,integrase	Salmonella_phage(20.0%)	52	NA	NA
WP_077274559.1|4233_5385_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	95.0	4.1e-173
WP_000443938.1|5409_6861_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_009309939.1|6853_8896_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_009309938.1|9082_14818_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_020802676.1|15279_18177_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	5.5e-182
WP_000509966.1|18271_18877_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	5.5e-20
WP_004194048.1|19536_20718_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	64.2	1.9e-120
WP_000091613.1|21144_21459_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000215515.1|21713_22070_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001293886.1|22059_22461_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_001247892.1|22457_22748_-	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_015065644.1|22822_25789_+|transposase	Tn3-like element ISPa38 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.2	0.0e+00
WP_000427623.1|25867_26872_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_004197809.1|27053_27257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004197808.1|27270_27474_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004197807.1|27507_27876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020802777.1|27919_28414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020317495.1|28444_29020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020804424.1|29007_29277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020315560.1|29713_30403_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_004193995.1|30434_31124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020801688.1|31669_32614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074192992.1|32722_33115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020801687.1|33165_33951_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.4	1.9e-52
WP_020804422.1|33968_34334_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568031.1|34872_35628_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	2.0e-136
WP_017901447.1|36620_37253_+	ParA family protein	NA	A0A0K1LMB9	Rhodobacter_phage	39.6	1.8e-29
WP_017901448.1|37252_37627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020801689.1|37866_38841_+	StbA protein	NA	A0A222YXF2	Escherichia_phage	44.2	1.5e-70
WP_020801683.1|38844_39237_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_146642489.1|39594_39822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016809156.1|39867_40836_-|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.1	3.9e-185
WP_023317809.1|42022_42247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077274560.1|43213_44569_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_042922559.1|44616_45180_+	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	9.7e-19
WP_032425974.1|45367_45580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020802172.1|46509_47022_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.7	8.5e-54
WP_004152655.1|47069_47312_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020802171.1|47380_49390_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.7	2.7e-26
WP_001067855.1|49558_50263_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004178188.1|51104_52790_+	cloacin	NA	NA	NA	NA	NA
WP_004152553.1|52799_53057_+	cloacin	NA	NA	NA	NA	NA
WP_004152552.1|53141_53291_+|lysis	colicin release lysis protein	lysis	NA	NA	NA	NA
WP_004178196.1|54771_56736_+	TraM recognition domain-containing protein	NA	NA	NA	NA	NA
WP_004152551.1|56735_57467_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_004153058.1|57473_58004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000165971.1|58031_58211_-	Rop family plasmid primer RNA-binding protein	NA	NA	NA	NA	NA
WP_000312627.1|58279_58657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001146176.1|58718_59018_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000072676.1|59007_59271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254601.1|59576_59996_-	Exc2 family lipoprotein	NA	NA	NA	NA	NA
WP_001143775.1|60072_63078_-|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
