The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019196	Salmonella enterica subsp. enterica serovar Thompson strain ATCC BAA-1738 chromosome, complete genome	4710704	1675091	1684262	4710704	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000569168.1|1675091_1676039_+	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	27.8	2.8e-10
WP_000824854.1|1676022_1676754_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001261696.1|1676734_1676842_-	protein YohO	NA	NA	NA	NA	NA
WP_001240418.1|1676901_1677633_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_000272850.1|1677855_1679541_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.3	4.8e-279
WP_000598637.1|1679537_1680257_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950413.1|1680303_1680771_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_017465874.1|1680827_1681358_-	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000703143.1|1681529_1681988_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	71.9	2.4e-52
WP_000195330.1|1682228_1684262_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 2
NZ_CP019196	Salmonella enterica subsp. enterica serovar Thompson strain ATCC BAA-1738 chromosome, complete genome	4710704	1858066	1865334	4710704		Morganella_phage(33.33%)	8	NA	NA
WP_000394197.1|1858066_1858486_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
WP_017465541.1|1858488_1859757_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	91.7	3.5e-226
WP_000208509.1|1860211_1860424_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_024131163.1|1860434_1860623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017465542.1|1860882_1862094_-	porin	NA	Q1MVN1	Enterobacteria_phage	56.2	4.4e-109
WP_017465543.1|1862743_1863055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000377042.1|1863134_1863830_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	27.1	2.8e-07
WP_001157305.1|1863903_1865334_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
>prophage 3
NZ_CP019196	Salmonella enterica subsp. enterica serovar Thompson strain ATCC BAA-1738 chromosome, complete genome	4710704	2763173	2850975	4710704	tRNA,lysis,integrase,protease,tail,terminase,holin,capsid,head,portal	Salmonella_phage(45.28%)	92	2785967:2785986	2862124:2862143
WP_000374046.1|2763173_2763833_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	52.4	2.7e-44
WP_000904446.1|2763919_2764249_+	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_000072884.1|2764245_2764527_-	acylphosphatase	NA	NA	NA	NA	NA
WP_017465795.1|2764575_2765355_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000859416.1|2765380_2765929_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_000140480.1|2766143_2767355_+	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_000561983.1|2767412_2767730_+	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_001537782.1|2767774_2768188_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_000847719.1|2768361_2769024_+	DUF2057 family protein	NA	NA	NA	NA	NA
WP_000424187.1|2769118_2769577_+	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_017465794.1|2769612_2771667_-	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.6	8.5e-20
WP_001261222.1|2771790_2772237_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_000950861.1|2772255_2774409_+	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_001202375.1|2774395_2775001_-	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_017465793.1|2775217_2775727_+	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_001674965.1|2776084_2777137_+	porin OmpA	NA	NA	NA	NA	NA
WP_017465792.1|2777208_2777661_-	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_017465791.1|2777846_2779607_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227928.1|2779675_2780194_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_001537784.1|2780293_2780461_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759136.1|2780716_2781280_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_017465790.1|2781276_2782917_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_017465789.1|2782921_2784175_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053044.1|2784189_2786097_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
2785967:2785986	attL	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
WP_001086485.1|2786109_2788218_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224072.1|2788316_2789426_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_001220671.1|2789422_2789965_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_000291723.1|2790130_2791141_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000193775.1|2791348_2793961_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.8	3.7e-20
WP_000497440.1|2794387_2794594_+	DinI-like family protein	NA	S4TNM0	Salmonella_phage	100.0	1.8e-31
WP_001536069.1|2795069_2795870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010835411.1|2796437_2797928_+	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	98.6	1.6e-254
WP_000143168.1|2798757_2799339_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	88.9	3.3e-94
WP_023193196.1|2799338_2801834_-|tail	Gifsy-2 prophage tail fiber protein	tail	E5G6P0	Salmonella_phage	76.1	7.3e-159
WP_000178849.1|2801887_2802130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000514902.1|2802168_2805531_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	79.5	0.0e+00
WP_001750110.1|2805592_2806240_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	78.1	1.6e-89
WP_000662738.1|2806137_2806875_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	84.2	9.8e-128
WP_001152686.1|2806881_2807580_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	75.9	1.6e-103
WP_000447370.1|2807589_2807919_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	71.3	7.3e-43
WP_000372075.1|2807921_2811017_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	61.7	4.8e-277
WP_010989052.1|2810988_2811327_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	62.4	1.3e-31
WP_000479607.1|2811323_2811719_-|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.5	2.3e-30
WP_000971953.1|2811769_2812516_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	76.9	1.9e-99
WP_000033885.1|2812523_2812925_-|tail	tail protein	tail	Q9G0F3	Phage_Gifsy-1	100.0	8.1e-52
WP_000677089.1|2812921_2813500_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.2	3.7e-82
WP_000083293.1|2813486_2813864_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	55.6	1.5e-28
WP_000201485.1|2813874_2814240_-	DNA packaging protein	NA	NA	NA	NA	NA
WP_000522566.1|2814297_2815326_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_000011260.1|2815380_2815728_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	52.7	9.2e-20
WP_001189498.1|2815740_2817237_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.2	1.1e-96
WP_000831821.1|2817226_2818807_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.8	9.6e-189
WP_000201415.1|2818803_2819007_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_000623092.1|2818990_2820922_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	1.3e-259
WP_001102153.1|2820893_2821439_-|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	1.5e-56
WP_001750111.1|2821724_2822126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001252721.1|2822382_2822886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031607240.1|2823214_2823664_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	90.4	6.1e-64
WP_000984583.1|2823681_2824134_-	lysozyme	NA	A0A0M4R365	Salmonella_phage	98.7	4.6e-80
WP_001574216.1|2824117_2824447_-|holin	phage holin, lambda family	holin	A0A0M3ULK9	Salmonella_phage	100.0	5.8e-56
WP_000798705.1|2825769_2826219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|2826354_2826480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047630.1|2826878_2827676_-	antitermination protein	NA	A0A0M4S661	Salmonella_phage	99.6	4.0e-151
WP_001617856.1|2827665_2827812_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	97.9	4.3e-19
WP_001096547.1|2827808_2828420_-	hypothetical protein	NA	A0A0M4RU10	Salmonella_phage	99.5	4.2e-92
WP_001750112.1|2828628_2829231_-	DUF1367 family protein	NA	S4TTI0	Salmonella_phage	99.0	2.8e-109
WP_014343878.1|2829265_2829514_-	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_001217669.1|2829630_2829864_-	DinI family protein	NA	H6WRY5	Salmonella_phage	100.0	5.6e-37
WP_000802853.1|2830111_2830438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107251218.1|2830531_2830600_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_000132543.1|2830580_2831798_-	hypothetical protein	NA	J9Q803	Salmonella_phage	53.3	3.1e-118
WP_000974174.1|2832108_2832354_-	hypothetical protein	NA	Q5G8U9	Enterobacteria_phage	88.9	3.0e-33
WP_000065089.1|2832353_2832674_-	hypothetical protein	NA	H6WRY0	Salmonella_phage	65.5	6.7e-25
WP_000113626.1|2832670_2833018_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	100.0	4.5e-59
WP_001750113.1|2833028_2833778_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	99.2	7.3e-139
WP_001540689.1|2833780_2834764_-	hypothetical protein	NA	H6WRX7	Salmonella_phage	100.0	1.9e-163
WP_010835408.1|2834848_2835223_-	hypothetical protein	NA	S4TTD7	Salmonella_phage	98.4	1.9e-63
WP_000992434.1|2835188_2835425_-	Rha family transcriptional regulator	NA	A0A0M4QX15	Salmonella_phage	73.1	9.0e-27
WP_001230956.1|2835529_2835925_+	helix-turn-helix domain-containing protein	NA	K7PM35	Enterobacteria_phage	72.5	3.5e-47
WP_001750114.1|2836030_2836972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750115.1|2836998_2837205_-	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	69.1	4.3e-17
WP_000551857.1|2837601_2837772_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	49.0	9.7e-07
WP_001750116.1|2837793_2838144_+	hypothetical protein	NA	S4TSN6	Salmonella_phage	96.6	3.2e-60
WP_010835407.1|2841159_2842317_+	recombinase RecT	NA	S4TTE8	Salmonella_phage	99.7	7.9e-217
WP_001237031.1|2842359_2842599_+	DUF4060 family protein	NA	S4TR31	Salmonella_phage	100.0	2.0e-37
WP_000065276.1|2842639_2842888_+	excisionase family protein	NA	S4TND0	Salmonella_phage	100.0	4.7e-42
WP_001262307.1|2842932_2844225_+|integrase	site-specific integrase	integrase	S4TSP2	Salmonella_phage	100.0	3.4e-253
WP_017465611.1|2844419_2845622_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_017465610.1|2845702_2847136_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_021294193.1|2847381_2848596_-	diaminopropionate ammonia-lyase	NA	NA	NA	NA	NA
WP_000762342.1|2848912_2849374_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000117867.1|2849574_2850975_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.8	4.5e-81
2862124:2862143	attR	GTGGATTTCCCGGCGCCGTT	NA	NA	NA	NA
>prophage 4
NZ_CP019196	Salmonella enterica subsp. enterica serovar Thompson strain ATCC BAA-1738 chromosome, complete genome	4710704	4296264	4343341	4710704	tRNA,plate,tail	Burkholderia_phage(36.36%)	49	NA	NA
WP_017465897.1|4296264_4297263_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_001039337.1|4297350_4298661_-	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_000416271.1|4298907_4299423_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030592.1|4299522_4299732_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001575282.1|4299753_4299867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001128112.1|4299863_4301189_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646079.1|4301367_4301976_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002900.1|4302084_4302453_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017360.1|4302623_4305044_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455249.1|4305142_4306015_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000019230.1|4306028_4306526_-	chorismate lyase	NA	NA	NA	NA	NA
WP_017465896.1|4306707_4307625_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_017465895.1|4307788_4309147_-	maltoporin	NA	NA	NA	NA	NA
WP_000179176.1|4309235_4310345_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_000695415.1|4310706_4311897_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000382570.1|4312028_4313573_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_001252081.1|4313587_4314478_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_000982749.1|4314643_4315054_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000750810.1|4315195_4317292_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000977968.1|4317291_4318029_-	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_126489750.1|4318025_4318694_-	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_001541297.1|4318727_4318970_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000790028.1|4319413_4321063_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000136394.1|4321407_4322757_+	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000615248.1|4322887_4323235_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_001226439.1|4323810_4324098_+	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	3.0e-16
WP_017465893.1|4324100_4324706_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.9	4.2e-60
WP_017465892.1|4324718_4325033_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.2	1.1e-19
WP_000449433.1|4325193_4325649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875314.1|4325645_4325843_+	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	8.6e-07
WP_000729852.1|4325832_4327260_+|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	70.9	1.1e-194
WP_000907494.1|4327259_4327784_+|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.5	2.8e-68
WP_001003639.1|4327835_4328153_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001185654.1|4328112_4328241_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_001262486.1|4328337_4330692_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	30.9	4.0e-66
WP_017465891.1|4330691_4331645_+	hypothetical protein	NA	A4JWL1	Burkholderia_virus	50.8	2.3e-36
WP_017465890.1|4331644_4331854_+	membrane protein	NA	A4JWL2	Burkholderia_virus	58.8	2.8e-16
WP_017465889.1|4331841_4332885_+	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.9	6.5e-77
WP_017465888.1|4332894_4333617_+|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_000593184.1|4333944_4334307_+	GtrA family protein	NA	U5P0S6	Shigella_phage	70.8	9.6e-44
WP_000703628.1|4334303_4335233_+	glycosyltransferase family 2 protein	NA	S5FKN0	Shigella_phage	84.1	7.9e-151
WP_001095011.1|4335232_4336780_+	membrane protein	NA	B9UDL6	Salmonella_phage	29.9	1.9e-48
WP_001093501.1|4336943_4337303_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	64.2	2.8e-35
WP_000951730.1|4337293_4338409_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	52.2	3.1e-101
WP_000359504.1|4338401_4339034_+|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	56.4	1.1e-23
WP_076031660.1|4339036_4340812_+|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	40.5	3.3e-52
WP_017465886.1|4340816_4341422_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_017465885.1|4341418_4341874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022544687.1|4342612_4343341_+	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	37.3	7.3e-35
