The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019046	Halioglobus pacificus strain RR3-57 chromosome, complete genome	4847776	1666469	1675160	4847776		Escherichia_phage(50.0%)	8	NA	NA
WP_075999678.1|1666469_1667375_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	58.9	1.1e-96
WP_075999679.1|1667364_1667913_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A1D8EQH2	Escherichia_phage	52.0	9.7e-48
WP_075999680.1|1667962_1669027_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	43.6	1.1e-79
WP_076002184.1|1669028_1669901_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.9	7.0e-40
WP_157516107.1|1670018_1672091_-	acyltransferase family protein	NA	W6MVL2	Pseudomonas_phage	39.8	1.3e-55
WP_075999682.1|1672216_1673752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075999683.1|1673867_1674536_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084179453.1|1674545_1675160_-	hypothetical protein	NA	B2ZYD5	Ralstonia_phage	27.8	9.0e-10
>prophage 2
NZ_CP019046	Halioglobus pacificus strain RR3-57 chromosome, complete genome	4847776	3872928	3936079	4847776	tRNA,protease,transposase,integrase	Tetraselmis_virus(40.0%)	42	3924508:3924523	3946403:3946418
WP_076001313.1|3872928_3874011_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	27.7	6.9e-21
WP_084179839.1|3873995_3876275_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_076001314.1|3876619_3878335_-	sulfate permease	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.5	1.1e-09
WP_076001315.1|3878585_3879809_-	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_076001316.1|3879994_3880294_+	YciI family protein	NA	NA	NA	NA	NA
WP_157516196.1|3880427_3882455_+	phosphotransferase	NA	A0A0R6PEF3	Moraxella_phage	23.6	1.3e-09
WP_076001318.1|3882459_3883674_-	CoA transferase	NA	NA	NA	NA	NA
WP_076001319.1|3883706_3885179_-	carboxyl transferase	NA	NA	NA	NA	NA
WP_076002400.1|3885356_3886529_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_076001320.1|3886734_3888282_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	50.2	5.0e-134
WP_076001321.1|3888305_3888761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076001322.1|3888783_3889770_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076001323.1|3889803_3891078_-	MFS transporter	NA	NA	NA	NA	NA
WP_076001324.1|3891407_3893654_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	27.5	1.3e-08
WP_076001325.1|3893668_3894442_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_076001326.1|3894578_3895949_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_076001327.1|3895968_3896691_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_076001328.1|3896777_3898157_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_076001329.1|3898153_3899671_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_076001330.1|3899714_3901832_-	PQQ-dependent dehydrogenase, methanol/ethanol family	NA	NA	NA	NA	NA
WP_076001331.1|3901892_3903326_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_076001332.1|3903613_3905341_+	dihydroxy-acid dehydratase	NA	NA	NA	NA	NA
WP_076002401.1|3905605_3908035_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_076002402.1|3908398_3910492_+	PQQ-dependent dehydrogenase, methanol/ethanol family	NA	NA	NA	NA	NA
WP_084180036.1|3910544_3910994_-	DUF1330 domain-containing protein	NA	NA	NA	NA	NA
WP_157516197.1|3911480_3912410_+	universal stress protein	NA	NA	NA	NA	NA
WP_076001334.1|3912634_3913303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084179843.1|3913551_3914118_+	universal stress protein	NA	NA	NA	NA	NA
WP_084179844.1|3914226_3914652_+	universal stress protein	NA	NA	NA	NA	NA
WP_076001335.1|3915783_3916014_+	antitoxin	NA	NA	NA	NA	NA
WP_076001336.1|3916013_3916415_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_076001337.1|3916472_3917246_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_076001338.1|3917956_3923149_+	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_076001339.1|3923328_3924543_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3924508:3924523	attL	CATGGCATCAAAGCAT	NA	NA	NA	NA
WP_076001340.1|3924654_3927699_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_076001341.1|3928507_3929788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076001342.1|3929844_3930744_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076001343.1|3931222_3931513_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_076001344.1|3931509_3931899_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_084179846.1|3931919_3933065_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_084179847.1|3932827_3934828_-	DUF4158 domain-containing protein	NA	NA	NA	NA	NA
WP_157516198.1|3935029_3936079_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
3946403:3946418	attR	ATGCTTTGATGCCATG	NA	NA	NA	NA
>prophage 3
NZ_CP019046	Halioglobus pacificus strain RR3-57 chromosome, complete genome	4847776	4497953	4559957	4847776	protease,integrase,holin	Pseudomonas_phage(40.0%)	51	4500158:4500204	4511549:4511595
WP_076001759.1|4497953_4498820_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_076001761.1|4499038_4500127_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	48.2	2.6e-92
4500158:4500204	attL	TTGGCGCGCCTGGCACGATTCGAACGTGCGACCGCCTGGTTCGTAGC	NA	NA	NA	NA
WP_027949335.1|4500433_4500679_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_035526823.1|4500675_4500879_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_076001762.1|4501295_4502531_-	cytochrome P450	NA	NA	NA	NA	NA
WP_051230679.1|4502600_4503062_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_027951253.1|4503129_4504284_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_084179922.1|4504237_4507348_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_027951252.1|4507353_4507821_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_076001765.1|4507826_4508228_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_027948882.1|4509278_4510145_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_084179923.1|4510653_4511529_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A059VF45	Pseudomonas_phage	44.7	2.0e-58
WP_076001766.1|4511693_4512977_-	acetyl-CoA hydrolase/transferase family protein	NA	NA	NA	NA	NA
4511549:4511595	attR	TTGGCGCGCCTGGCACGATTCGAACGTGCGACCGCCTGGTTCGTAGC	NA	NA	NA	NA
WP_076001767.1|4513079_4513490_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076001768.1|4513527_4513902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076001769.1|4513973_4514396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076001770.1|4514392_4515340_-	alpha-L-glutamate ligase-like protein	NA	NA	NA	NA	NA
WP_076002471.1|4515336_4516857_-	inactive transglutaminase family protein	NA	NA	NA	NA	NA
WP_076001771.1|4516867_4517521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076001772.1|4517685_4518006_+	DUF4124 domain-containing protein	NA	NA	NA	NA	NA
WP_076001773.1|4518089_4519118_+	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	61.5	3.8e-13
WP_076001774.1|4519125_4520310_+	glycine C-acetyltransferase	NA	D2TEZ5	Emiliania_huxleyi_virus	26.8	4.3e-32
WP_076001775.1|4520322_4521291_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_076001776.1|4521287_4521716_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_076001777.1|4521712_4523245_-	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_084179924.1|4523247_4524435_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_076001779.1|4524509_4528322_-	bifunctional proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase PutA	NA	NA	NA	NA	NA
WP_076001780.1|4528521_4529550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_084179925.1|4529789_4531214_-	DUF3482 domain-containing protein	NA	NA	NA	NA	NA
WP_076001781.1|4531210_4532572_-	DUF2868 domain-containing protein	NA	NA	NA	NA	NA
WP_076001782.1|4532652_4533096_+	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_084179926.1|4534977_4535565_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_076001783.1|4535561_4536275_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_076001784.1|4536458_4537676_+	serine hydrolase	NA	NA	NA	NA	NA
WP_076001785.1|4537688_4538270_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_076001786.1|4538423_4539278_+	phytanoyl-CoA dioxygenase	NA	NA	NA	NA	NA
WP_076001787.1|4539322_4541101_+	biotin carboxylase	NA	NA	NA	NA	NA
WP_076001788.1|4541272_4541473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076001790.1|4543776_4545837_+	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	27.6	8.2e-07
WP_076001791.1|4545862_4547464_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_076001792.1|4547532_4548903_-	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_076001793.1|4548991_4550986_-	DUF3604 domain-containing protein	NA	NA	NA	NA	NA
WP_076001794.1|4551013_4551766_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_076001797.1|4553589_4553946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076001798.1|4553923_4554532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076001799.1|4554578_4554962_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_084179927.1|4554982_4555864_-	DMT family transporter	NA	NA	NA	NA	NA
WP_076001801.1|4555916_4556798_-	TIGR03619 family F420-dependent LLM class oxidoreductase	NA	NA	NA	NA	NA
WP_084179928.1|4557147_4557702_+	hypothetical protein	NA	NA	NA	NA	NA
WP_133125955.1|4557691_4558285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084179929.1|4558367_4559957_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
>prophage 1
NZ_CP019045	Halioglobus pacificus strain RR3-57 plasmid pRR3-57, complete sequence	155799	27965	87812	155799	integrase,transposase	Leptospira_phage(25.0%)	46	77587:77603	93986:94002
WP_075998273.1|27965_29507_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.8	3.2e-88
WP_075998382.1|32579_32858_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_075998274.1|32854_33382_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_075998275.1|33481_34924_-	coniferyl aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_084178951.1|35151_36042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084178954.1|36038_36650_+	DUF1298 domain-containing protein	NA	NA	NA	NA	NA
WP_075998276.1|36646_38023_+	wax ester/triacylglycerol synthase family O-acyltransferase	NA	NA	NA	NA	NA
WP_075998277.1|38075_39506_+|transposase	ISKra4 family transposase	transposase	NA	NA	NA	NA
WP_084178957.1|39475_39694_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_084178960.1|39893_40679_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_075998279.1|40880_43055_-	cation:dicarboxylase symporter family transporter	NA	NA	NA	NA	NA
WP_075998280.1|43437_44715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998281.1|44708_46061_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_157516025.1|46064_47201_-	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_075998283.1|47505_48081_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_084178963.1|48195_49458_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_075998285.1|49470_50271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075998286.1|50301_51444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075998287.1|51555_53412_-	twin-arginine translocation signal domain-containing protein	NA	NA	NA	NA	NA
WP_075998383.1|53479_54988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075998288.1|55172_56123_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_075998289.1|56119_57880_-	amidohydrolase	NA	NA	NA	NA	NA
WP_075998290.1|57903_59115_-	MFS transporter	NA	NA	NA	NA	NA
WP_084179000.1|59115_60303_-	M20 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_075998291.1|60374_61295_-	amidinotransferase	NA	NA	NA	NA	NA
WP_084178969.1|61591_63769_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_075998293.1|63974_65021_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_075998294.1|65158_66319_+	MFS transporter	NA	NA	NA	NA	NA
WP_075998295.1|66336_67101_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.8	1.5e-22
WP_075998296.1|67206_69399_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_075998297.1|69420_69891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998298.1|69920_71537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998299.1|71588_72509_+	cation diffusion facilitator family transporter	NA	NA	NA	NA	NA
WP_084178972.1|72623_73682_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_157516026.1|74166_74775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157516027.1|74856_75015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998302.1|75495_76911_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_075998303.1|76999_78655_+	long-chain-fatty-acid--CoA ligase	NA	A0A2K9L3I8	Tupanvirus	22.1	1.2e-05
77587:77603	attL	CCTGTACAGCCACCGCT	NA	NA	NA	NA
WP_075998305.1|80503_81052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075998306.1|81570_82263_-	DUF433 domain-containing protein	NA	NA	NA	NA	NA
WP_075998307.1|82521_82809_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_075998308.1|82801_83068_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_075998309.1|83204_83627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075998310.1|83619_85722_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075998311.1|85712_86900_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	25.2	7.6e-13
WP_075998312.1|87038_87812_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
93986:94002	attR	AGCGGTGGCTGTACAGG	NA	NA	NA	NA
>prophage 2
NZ_CP019045	Halioglobus pacificus strain RR3-57 plasmid pRR3-57, complete sequence	155799	102306	150642	155799	integrase,transposase	Ralstonia_phage(12.5%)	49	110832:110847	144396:144411
WP_075998330.1|102306_103527_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075998331.1|103513_104497_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075998332.1|104493_105516_+|integrase	site-specific integrase	integrase	A0A2D2W4Z2	Ralstonia_phage	23.8	1.5e-09
WP_075998333.1|105594_106188_-	hypothetical protein	NA	A0A0F7L836	uncultured_marine_virus	34.8	2.1e-11
WP_075998334.1|106407_106665_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_075998335.1|106652_106970_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_075998336.1|107017_107683_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	46.6	4.1e-24
WP_157516030.1|107954_108980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998338.1|109517_110972_-	hypothetical protein	NA	NA	NA	NA	NA
110832:110847	attL	CTTGTCTCCACTCAAG	NA	NA	NA	NA
WP_075998339.1|111201_112158_+	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.5e-07
WP_075998340.1|112161_113355_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998341.1|113347_113803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998342.1|113884_114862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998343.1|115027_115384_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998344.1|115400_116147_+	NAD-dependent protein deacylase	NA	A0A068EPD4	Bacillus_phage	33.1	3.0e-31
WP_084178974.1|116274_116820_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_084178977.1|116816_117305_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_075998346.1|117370_117619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075998347.1|118466_119330_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_075998348.1|119428_119755_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_157516031.1|119901_120381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157516032.1|120699_121005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998351.1|121001_121703_+	TIGR03759 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_075998352.1|121684_122233_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_084178983.1|122132_122765_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_075998354.1|122757_124803_+	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_075998355.1|124799_125468_+	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_084178986.1|125485_125737_+	DUF3262 family protein	NA	NA	NA	NA	NA
WP_157516033.1|125762_126167_+	TIGR03745 family integrating conjugative element membrane protein	NA	NA	NA	NA	NA
WP_075998357.1|126170_126554_+	TIGR03750 family conjugal transfer protein	NA	NA	NA	NA	NA
WP_075998358.1|126550_127186_+	TIGR03746 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_075998359.1|127182_128013_+	TIGR03749 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_075998360.1|128015_129395_+	TIGR03752 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_157516034.1|129378_129912_+	TIGR03751 family conjugal transfer lipoprotein	NA	NA	NA	NA	NA
WP_075998361.1|129908_132632_+	conjugative transfer ATPase	NA	NA	NA	NA	NA
WP_084178989.1|132594_133062_+	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_084178992.1|132982_134002_+	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_084178995.1|134012_135341_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_084178998.1|135489_137313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157516035.1|137315_137546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157516036.1|137785_138004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_075998369.1|138042_138258_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	52.9	2.0e-09
WP_075998370.1|138238_140491_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	28.7	3.5e-35
WP_075998390.1|140662_141001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075998371.1|141290_142097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075998372.1|142163_142844_-	AbiV family abortive infection protein	NA	NA	NA	NA	NA
WP_075998374.1|143418_147522_-	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
144396:144411	attR	CTTGAGTGGAGACAAG	NA	NA	NA	NA
WP_075998375.1|147651_148623_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_075998273.1|149100_150642_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	39.8	3.2e-88
