The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	78985	281436	2802604	tRNA,holin,transposase	Streptococcus_phage(28.3%)	172	NA	NA
WP_002298563.1|78985_79732_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_002301399.1|80404_81364_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002326711.1|81738_82917_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002317041.1|83261_83600_-	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_002348801.1|83734_84136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002317547.1|84247_84868_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002294300.1|84958_87628_-	YfhO family protein	NA	NA	NA	NA	NA
WP_002290463.1|87865_88054_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_002294298.1|88323_88686_+	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002301169.1|88737_90420_+	DAK2 domain-containing protein	NA	NA	NA	NA	NA
WP_002301167.1|90536_92573_+	ATP-dependent DNA helicase RecG	NA	A0A2H4JBQ0	uncultured_Caudovirales_phage	22.9	5.3e-06
WP_002289721.1|92621_93623_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_002294295.1|93744_93987_+	acyl carrier protein	NA	NA	NA	NA	NA
WP_002287889.1|94254_95259_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.2	5.1e-18
WP_002287891.1|95259_96204_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.1	3.9e-20
WP_002287892.1|96203_97166_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287893.1|97192_98107_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002287894.1|98132_99914_+	oligopeptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287896.1|100261_100948_+	ribonuclease III	NA	K7YH73	Megavirus	32.3	9.1e-27
WP_002301166.1|100967_104549_+	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_002348798.1|104557_105367_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002301165.1|105378_106377_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_002294288.1|106563_108831_+	bifunctional glutamate--cysteine ligase GshA/glutathione synthetase GshB	NA	NA	NA	NA	NA
WP_002326066.1|109014_109968_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294287.1|109985_110438_-	YueI family protein	NA	NA	NA	NA	NA
WP_002294286.1|110587_111538_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	40.5	1.6e-66
WP_002301163.1|111530_112490_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_002301162.1|112486_113242_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.1	2.2e-13
WP_002301160.1|113264_114218_+	siderophore ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002287909.1|114861_115158_-|tRNA	phenylalanyl-tRNA synthetase subunit alpha	tRNA	NA	NA	NA	NA
WP_002287910.1|115513_115870_+	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002348747.1|115879_116779_+	metallophosphoesterase	NA	NA	NA	NA	NA
WP_010782507.1|117011_117971_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_010782508.1|118228_119674_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
WP_002348590.1|119719_120454_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_002301190.1|120779_121190_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_002294273.1|121182_121884_+	LrgB family protein	NA	NA	NA	NA	NA
WP_002348592.1|121883_123497_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002290506.1|123486_123708_+	DUF2829 domain-containing protein	NA	A0A0S2MV93	Bacillus_phage	33.3	1.1e-05
WP_002297929.1|123704_124466_+	3-oxoacyl-ACP reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	31.7	1.2e-16
WP_002294268.1|124846_125356_+	QueT transporter family protein	NA	E7DN70	Pneumococcus_phage	31.8	7.5e-10
WP_002294267.1|125425_125965_-	biotin transporter BioY	NA	NA	NA	NA	NA
WP_002294265.1|126104_126716_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
WP_002348593.1|126977_127829_+	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_002294262.1|127856_128492_+	DNA alkylation repair protein	NA	NA	NA	NA	NA
WP_002294261.1|128511_129285_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002348595.1|129692_130490_+	TIGR00282 family metallophosphoesterase	NA	NA	NA	NA	NA
WP_002297923.1|130467_130881_+	YlbF family regulator	NA	NA	NA	NA	NA
WP_002294258.1|130864_133510_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	26.1	3.6e-39
WP_002301736.1|133527_135636_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.1	1.8e-57
WP_002348596.1|135657_136218_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_002297218.1|136356_137652_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002285758.1|137911_138106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|138095_138449_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|138550_140098_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002348864.1|140177_142166_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_002294254.1|142388_143102_+	trehalose operon repressor	NA	A0A291LID1	Streptomyces_phage	39.7	1.2e-05
WP_002294252.1|143178_143625_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_002290528.1|143794_144397_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_002289812.1|144409_145411_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.8	2.3e-07
WP_002341570.1|145439_146018_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002294249.1|146069_146552_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_002289815.1|146668_147043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294246.1|147842_149195_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002297079.1|149341_149932_+	DUF1211 domain-containing protein	NA	NA	NA	NA	NA
WP_002294242.1|150059_151409_-	amino acid permease	NA	NA	NA	NA	NA
WP_002294240.1|151576_152317_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	5.5e-30
WP_002297081.1|152329_153922_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002293448.1|154489_154786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294236.1|154961_155687_+	NAD-dependent protein deacylase	NA	NA	NA	NA	NA
WP_002301156.1|155679_156522_+	chorismate mutase	NA	NA	NA	NA	NA
WP_002294232.1|156524_157046_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_002289284.1|157298_157862_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	37.1	2.3e-12
WP_002289282.1|158112_158382_+	30S ribosomal protein S15	NA	NA	NA	NA	NA
WP_002297086.1|158569_160696_+	polyribonucleotide nucleotidyltransferase	NA	NA	NA	NA	NA
WP_002289280.1|161205_161472_+	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002321207.1|161648_163607_+	KUP/HAK/KT family potassium transporter	NA	M1HZV6	Acanthocystis_turfacea_Chlorella_virus	34.0	1.6e-63
WP_002294228.1|163960_165262_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002326809.1|165637_166933_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289277.1|168525_169896_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_002289744.1|170077_170401_-	DUF960 domain-containing protein	NA	NA	NA	NA	NA
WP_002299254.1|170725_171334_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_002348768.1|171663_172380_+	pseudouridine synthase	NA	NA	NA	NA	NA
WP_002289749.1|172392_173088_+	noncanonical pyrimidine nucleotidase, YjjG family	NA	NA	NA	NA	NA
WP_002289751.1|173171_173801_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.2	3.1e-34
WP_086953915.1|174315_175654_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002294220.1|175723_176326_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	30.6	3.6e-19
WP_002296548.1|176347_176836_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002294217.1|177156_178530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294214.1|178513_178981_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_002329999.1|179229_180975_-	AarF/ABC1/UbiB kinase family protein	NA	M4R0M8	Ostreococcus_lucimarinus_virus	28.1	1.3e-40
WP_002293424.1|181170_182247_+	D-alanine--D-alanine ligase	NA	NA	NA	NA	NA
WP_002317074.1|182399_183752_+	UDP-N-acetylmuramoyl-tripeptide--D-alanyl-D- alanine ligase	NA	NA	NA	NA	NA
WP_002294211.1|184073_185585_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	36.2	6.6e-62
WP_002294209.1|185714_186065_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_002294207.1|186080_187202_+	alanine racemase	NA	NA	NA	NA	NA
WP_002289874.1|187212_187575_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A291I9M9	Lactobacillus_phage	37.8	7.6e-09
WP_002293413.1|187750_188020_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002294206.1|188209_189157_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016171130.1|189302_190598_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.2	1.1e-09
WP_002301399.1|190864_191824_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002294203.1|192049_194755_+	YhgE/Pip domain-containing protein	NA	NA	NA	NA	NA
WP_002294202.1|195351_197175_+	APC family permease	NA	NA	NA	NA	NA
WP_002348885.1|197316_197502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294199.1|197976_198240_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002301121.1|198239_198506_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002301116.1|199736_200408_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002301114.1|200404_201322_-	osmoprotectant ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002293405.1|201318_201960_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002348889.1|201963_203139_-|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	Q6GZ03	Mycoplasma_phage	32.9	1.0e-17
WP_002350806.1|203331_204363_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_002341590.1|206039_206993_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002319878.1|207083_208379_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.2	1.5e-54
WP_002326809.1|208540_209836_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002289743.1|210545_213185_+	cation-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	31.2	1.6e-84
WP_002294185.1|213352_214051_-	DUF975 family protein	NA	NA	NA	NA	NA
WP_002341590.1|214153_215107_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002294183.1|215335_216481_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	40.9	2.5e-82
WP_002300794.1|216577_216958_+	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_010782512.1|217262_219860_+	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_010782513.1|219767_221378_-|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	8.4e-124
WP_002300788.1|223655_224135_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_086953915.1|224760_226099_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_126145175.1|226143_226350_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_002300046.1|226331_226637_+	5-dehydro-4-deoxy-D-glucuronate isomerase	NA	NA	NA	NA	NA
WP_033582433.1|226656_227460_+	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_002300048.1|227708_228773_-	type 2 isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_002288233.1|228769_229855_-	phosphomevalonate kinase	NA	NA	NA	NA	NA
WP_002300050.1|229867_230845_-	diphosphomevalonate decarboxylase	NA	NA	NA	NA	NA
WP_002288231.1|230837_231782_-	mevalonate kinase	NA	NA	NA	NA	NA
WP_002298301.1|232097_232757_+	deoxynucleoside kinase	NA	C1KFI3	Lactobacillus_virus	51.8	4.3e-58
WP_002300052.1|232841_233747_+	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002300053.1|233748_234381_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_002293357.1|234700_235225_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.3	1.4e-14
WP_002289309.1|235296_235497_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_002289310.1|235549_235909_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002348846.1|236260_237499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002341584.1|237546_239676_+	hydantoinase/oxoprolinase	NA	NA	NA	NA	NA
WP_002348844.1|239650_240340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289316.1|240747_241434_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002315615.1|241569_241764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301667.1|241813_242254_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_002301666.1|242257_243103_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_002294157.1|243251_244670_+	dipeptidase PepV	NA	NA	NA	NA	NA
WP_002299302.1|244745_245948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299301.1|245934_247722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299300.1|247734_248688_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_002309710.1|248872_249223_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_002294156.1|249422_250502_+	glutamyl aminopeptidase	NA	NA	NA	NA	NA
WP_002292632.1|250644_250965_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_002345012.1|250986_251451_+	universal stress protein	NA	NA	NA	NA	NA
WP_002313997.1|251646_252252_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_002290101.1|252290_253580_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IT49	uncultured_Mediterranean_phage	30.2	5.7e-22
WP_002345011.1|254007_254487_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_000420682.1|254839_255154_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_000985015.1|255169_255556_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_002297361.1|257444_259304_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_000398284.1|259860_261066_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_002286940.1|261849_263760_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_032509114.1|263863_264088_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	97.1	8.5e-27
WP_002345010.1|264204_264702_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	97.6	1.3e-88
WP_002345009.1|264788_265181_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	99.2	4.6e-68
WP_002298631.1|267414_269241_+	group II intron reverse transcriptase/maturase	NA	H7BVW2	unidentified_phage	26.8	3.7e-11
WP_002345008.1|270294_272478_+	membrane protein	NA	A0A1S5SF30	Streptococcus_phage	82.3	2.9e-305
WP_002345007.1|272474_273476_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	95.5	1.3e-183
WP_002345006.1|273490_274405_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	92.1	4.7e-156
WP_001814923.1|274649_274766_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_076005168.1|274781_276698_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	96.4	0.0e+00
WP_002345004.1|276795_278169_+	tetracycline efflux MFS transporter Tet(L)	NA	NA	NA	NA	NA
WP_000119405.1|278732_279995_+	plasmid recombination protein	NA	NA	NA	NA	NA
WP_025480875.1|280239_280722_+	protein rep	NA	NA	NA	NA	NA
WP_001015311.1|280755_281436_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 2
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	825036	900461	2802604	protease,head,portal,capsid,tail,holin,transposase,tRNA,integrase,terminase	Enterococcus_phage(25.64%)	94	880598:880613	883951:883966
WP_002286621.1|825036_827835_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2H4UVG0	Bodo_saltans_virus	26.4	1.6e-74
WP_002286618.1|827883_829410_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	35.3	8.9e-75
WP_002286616.1|829424_830072_-	metal-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286678.1|830255_830585_-	DUF4828 domain-containing protein	NA	NA	NA	NA	NA
WP_002286614.1|830761_831490_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_002286612.1|831505_832519_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002286608.1|832518_833796_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	28.8	5.8e-35
WP_002286607.1|833858_836561_+	sigma-54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_002286606.1|836712_837030_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002286604.1|837059_837380_+	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002286601.1|837465_838926_+	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002286598.1|838993_839215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286596.1|839245_839428_+	DUF3188 domain-containing protein	NA	NA	NA	NA	NA
WP_002286592.1|839427_839841_+	DUF3284 domain-containing protein	NA	NA	NA	NA	NA
WP_002286589.1|839963_841145_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002286676.1|841215_841380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286587.1|841675_842815_-|integrase	site-specific integrase	integrase	Q9AZR0	Lactococcus_phage	47.1	2.6e-95
WP_002296617.1|843113_843749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296616.1|843861_844497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303013.1|844530_844992_-	SHOCT domain-containing protein	NA	A0A0F6N4L7	Staphylococcus_phage	34.8	4.5e-06
WP_002348715.1|845121_845553_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002296612.1|845570_845891_-	helix-turn-helix transcriptional regulator	NA	A0A1S5SDR1	Streptococcus_phage	40.2	2.0e-13
WP_002290310.1|846189_846966_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	53.8	1.1e-73
WP_002296611.1|846980_847184_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002286573.1|847199_847538_+	DUF771 domain-containing protein	NA	NA	NA	NA	NA
WP_002296610.1|847524_847704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|847746_848217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|848303_849002_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|849179_849521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|849513_850185_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_002286553.1|850190_850877_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	69.1	3.2e-88
WP_002286552.1|850879_851629_+	helix-turn-helix domain-containing protein	NA	A0A1L2BY83	Clostridium_phage	54.0	1.7e-31
WP_002286696.1|851640_851910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296607.1|851914_852079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286695.1|852071_852374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296606.1|852370_852532_+	antitoxin	NA	NA	NA	NA	NA
WP_002286694.1|852528_852834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286550.1|852833_853190_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	37.4	3.1e-10
WP_002322165.1|853176_853395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286547.1|853391_853811_+	YopX family protein	NA	D2IZL0	Enterococcus_phage	54.3	4.1e-30
WP_002286545.1|853807_854365_+	DUF1642 domain-containing protein	NA	A0A0C5KKV2	Enterococcus_phage	36.2	2.8e-10
WP_002286693.1|854361_854658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286542.1|854734_855148_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.5e-56
WP_002296602.1|855456_855609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300143.1|855605_855881_-	hypothetical protein	NA	A0A2H4JEH2	uncultured_Caudovirales_phage	45.7	9.9e-17
WP_002311723.1|856334_856541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296600.1|856736_856904_+	thymidylate synthase	NA	NA	NA	NA	NA
WP_002286540.1|856929_857274_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	57.1	3.8e-26
WP_002296599.1|857278_857560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|857662_857977_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|857954_859649_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|859668_860847_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_002286527.1|860809_861496_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|861495_862656_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|862665_863541_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|863537_863849_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|863838_864192_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|864181_864583_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|864575_864980_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|864991_865600_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002286510.1|865619_865982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348716.1|866183_869615_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	44.4	3.1e-67
WP_002286500.1|869665_870403_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002286497.1|870412_872704_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	30.0	9.6e-89
WP_002286495.1|872727_874854_+	hypothetical protein	NA	A0A060AI60	Enterococcus_phage	40.1	1.4e-62
WP_002290627.1|874870_875020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|875016_875463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|875464_875602_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|875639_875933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|875929_876154_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002349643.1|876150_877176_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.8e-64
WP_087046766.1|878115_879277_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|880200_880608_+	hypothetical protein	NA	NA	NA	NA	NA
880598:880613	attL	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002296902.1|880621_881023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|881024_881396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286680.1|881431_881734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076005172.1|881982_882183_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9AZR0	Lactococcus_phage	75.7	4.6e-08
WP_002348827.1|882487_883720_-	aminopeptidase	NA	NA	NA	NA	NA
WP_002286467.1|883976_884546_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
883951:883966	attR	AAAAAAATTAAGGAGA	NA	NA	NA	NA
WP_002297963.1|884723_885164_-	flavodoxin	NA	NA	NA	NA	NA
WP_002294533.1|885321_886086_+	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_002286461.1|886117_887041_+	YihY/virulence factor BrkB family protein	NA	NA	NA	NA	NA
WP_002286457.1|887116_888256_+	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_002286455.1|888248_889049_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002286453.1|889048_889876_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_002321540.1|889853_890588_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_002286449.1|890687_891554_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.5	3.7e-102
WP_002286442.1|891567_892140_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	49.2	8.3e-42
WP_002294532.1|892161_893190_+	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	42.9	6.4e-69
WP_002286428.1|893287_894139_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	39.0	1.7e-38
WP_002348826.1|894172_896206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348825.1|896249_897530_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002297185.1|897626_898922_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_010782578.1|899186_900461_-|transposase	ISL3-like element IS1476 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	8.6e-55
>prophage 3
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	1069104	1076438	2802604	transposase	uncultured_Mediterranean_phage(33.33%)	7	NA	NA
WP_002289497.1|1069104_1070946_+	DNA primase	NA	A0A1S5RH70	Helicobacter_phage	32.1	1.2e-49
WP_002289498.1|1070969_1072079_+	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	9.8e-39
WP_002297218.1|1072289_1073585_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294386.1|1073840_1074728_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002294387.1|1074746_1075118_+	protein RibT	NA	NA	NA	NA	NA
WP_002305297.1|1075087_1075885_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002296975.1|1075868_1076438_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
>prophage 4
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	1184843	1193904	2802604		Gordonia_phage(16.67%)	9	NA	NA
WP_002288023.1|1184843_1186139_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
WP_002297115.1|1186318_1186696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288021.1|1186951_1187680_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002295474.1|1187679_1187934_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288017.1|1187935_1188607_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002288015.1|1188607_1190830_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288013.1|1190814_1192254_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288011.1|1192276_1193329_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288010.1|1193325_1193904_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
>prophage 5
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	1474287	1523305	2802604	protease,transposase	Streptococcus_phage(23.08%)	57	NA	NA
WP_010729485.1|1474287_1475823_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	1.4e-123
WP_002295142.1|1476046_1476418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002291278.1|1476673_1476916_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_002296679.1|1476947_1477850_-	Asp23/Gls24 family envelope stress response protein	NA	NA	NA	NA	NA
WP_002291274.1|1477862_1478051_-	DUF2273 domain-containing protein	NA	NA	NA	NA	NA
WP_002296677.1|1478064_1478628_-	alkaline shock response membrane anchor protein AmaP	NA	NA	NA	NA	NA
WP_002300977.1|1478665_1479559_-	SDR family oxidoreductase	NA	A0A2N9QUX2	Trichoplusia_ni_ascovirus	46.0	5.2e-59
WP_002303839.1|1479636_1480560_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002296672.1|1480608_1480959_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_002296671.1|1480991_1481894_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002296670.1|1481886_1482744_-	glycosyltransferase family 8 protein	NA	A0ZYL4	Archaeal_BJ1_virus	27.1	1.3e-19
WP_002348903.1|1483077_1483887_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002296667.1|1483926_1484424_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002321681.1|1485068_1485392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296665.1|1485555_1485810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296663.1|1485879_1486125_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002348902.1|1486221_1486566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303842.1|1486626_1487190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293303.1|1487757_1487958_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	77.3	3.9e-23
WP_002296658.1|1488353_1488503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302440.1|1488580_1489882_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002296656.1|1490210_1490924_-	HAD family phosphatase	NA	A0A1D8KPI1	Synechococcus_phage	23.0	5.4e-06
WP_002296654.1|1490916_1492002_-	mannonate dehydratase	NA	NA	NA	NA	NA
WP_002296653.1|1492018_1492462_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002321678.1|1492495_1492849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296650.1|1492960_1493362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296648.1|1493398_1493908_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002303107.1|1493929_1494787_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002296646.1|1494804_1495638_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303106.1|1495651_1496449_-	iron-containing alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_002321677.1|1496481_1496766_-	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002296641.1|1496762_1497764_-	2-hydroxyacid dehydrogenase	NA	M1H9J0	Paramecium_bursaria_Chlorella_virus	29.0	2.8e-24
WP_002321675.1|1497765_1498833_-	decarboxylating 6-phosphogluconate dehydrogenase	NA	A0A1D8KGX1	Synechococcus_phage	35.3	3.9e-53
WP_002296639.1|1498831_1499680_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296638.1|1500325_1500532_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_002296637.1|1500733_1501735_-	alpha/beta hydrolase	NA	M1PGN2	Moumouvirus	31.8	2.5e-09
WP_002311095.1|1501739_1503653_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_002296634.1|1503820_1504327_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_002296633.1|1504486_1504927_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002296632.1|1504952_1506110_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296631.1|1506112_1506469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296629.1|1506766_1507741_-	LPXTG-anchored fibrinogen/nidogen-binding adhesin SgrA	NA	NA	NA	NA	NA
WP_002296628.1|1507936_1508776_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002296627.1|1508960_1509848_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002311093.1|1510431_1511127_-	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296624.1|1511110_1511509_-	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002287107.1|1511917_1513168_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002289425.1|1513309_1514305_-	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002289423.1|1514322_1514877_-	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002348790.1|1514864_1515356_-	transcriptional regulator GutM	NA	NA	NA	NA	NA
WP_002348791.1|1515348_1517217_-	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1517235_1518036_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002305631.1|1518228_1518474_+	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002303864.1|1518612_1519098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289415.1|1519553_1519967_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_000997695.1|1521017_1522196_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_000222572.1|1522351_1523305_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	1671791	1863339	2802604	tRNA,protease,transposase	Streptococcus_phage(26.53%)	172	NA	NA
WP_002294137.1|1671791_1673501_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002294136.1|1673568_1674837_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_002294135.1|1674997_1675798_-	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_002294134.1|1675794_1676607_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	46.8	2.0e-25
WP_002287107.1|1677015_1678266_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002293875.1|1678584_1679142_-	ribosome recycling factor	NA	NA	NA	NA	NA
WP_002293877.1|1679144_1679867_-	UMP kinase	NA	NA	NA	NA	NA
WP_002293878.1|1680002_1680884_-	elongation factor Ts	NA	NA	NA	NA	NA
WP_002293880.1|1680982_1681765_-	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_002293881.1|1682123_1682603_+	ArgR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326698.1|1682819_1683911_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_002326699.1|1683903_1684032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288430.1|1684035_1684581_+	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_002288432.1|1685033_1686725_-|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.6	2.9e-74
WP_002288434.1|1687144_1688092_-	carbamate kinase	NA	NA	NA	NA	NA
WP_002288437.1|1688206_1689226_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_002288439.1|1689316_1690546_-	arginine deiminase	NA	NA	NA	NA	NA
WP_002288442.1|1691006_1691708_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002326809.1|1691879_1693175_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002301319.1|1693838_1694855_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	41.0	5.4e-60
WP_002288445.1|1694851_1695316_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002348676.1|1695322_1695865_-	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288447.1|1695848_1696673_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_002288449.1|1696761_1697742_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.9	5.8e-19
WP_002288451.1|1697765_1699250_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_002288452.1|1699261_1700251_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	36.8	2.1e-48
WP_002288457.1|1700498_1700666_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_002288458.1|1700727_1702539_-	FAD/NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_002288459.1|1702535_1702901_-	DUF488 family protein	NA	NA	NA	NA	NA
WP_002288461.1|1703063_1703459_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_002288462.1|1703476_1704439_-	ROK family glucokinase	NA	NA	NA	NA	NA
WP_002293902.1|1704438_1704651_-	YqgQ family protein	NA	NA	NA	NA	NA
WP_002289885.1|1704671_1705370_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_002289886.1|1705389_1705932_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_002301321.1|1706063_1707068_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_080497136.1|1707064_1708054_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002293905.1|1708050_1708857_-	ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	32.1	1.0e-13
WP_010782564.1|1709022_1709979_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002296121.1|1710055_1710574_-	dihydrofolate reductase	NA	G3MBI7	Bacillus_virus	39.1	7.1e-24
WP_002296119.1|1710661_1710811_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002288531.1|1711038_1711485_+	DUF2188 domain-containing protein	NA	NA	NA	NA	NA
WP_002288533.1|1711679_1713575_-	asparagine synthase (glutamine-hydrolyzing)	NA	F2Y2L7	Organic_Lake_phycodnavirus	26.2	6.0e-20
WP_002303934.1|1713899_1714874_-	choloylglycine hydrolase family protein	NA	M1H001	Paramecium_bursaria_Chlorella_virus	29.7	3.0e-23
WP_002296332.1|1715439_1716006_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348678.1|1716261_1717593_+	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|1717558_1717909_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296337.1|1718420_1718765_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002301399.1|1719030_1719990_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002287776.1|1720179_1720776_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002287775.1|1720899_1722699_+	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002297633.1|1722976_1723189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293931.1|1723650_1723800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311774.1|1724052_1725012_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002326704.1|1725224_1726133_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002288573.1|1726181_1726568_+	YxeA family protein	NA	NA	NA	NA	NA
WP_000122610.1|1726871_1728164_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002288574.1|1728382_1729729_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288575.1|1729840_1731190_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288577.1|1732629_1733115_-|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002288579.1|1733137_1733896_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.4	1.9e-25
WP_002288581.1|1733911_1735090_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	3.9e-102
WP_002303943.1|1735319_1737440_+	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.0	8.2e-220
WP_002296838.1|1737662_1738388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288586.1|1738377_1738887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288588.1|1738956_1740405_-	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288590.1|1740404_1741121_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288595.1|1741101_1741452_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002288592.1|1741595_1742369_+	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002302293.1|1743125_1743428_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|1743866_1745045_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002321266.1|1745381_1745621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289617.1|1745982_1746243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289618.1|1746427_1746925_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289619.1|1747054_1747765_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289620.1|1747777_1749442_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_002300930.1|1749646_1750309_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002303949.1|1750318_1751134_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288989.1|1751395_1751839_-	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_002321036.1|1751972_1752311_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002302962.1|1752298_1752676_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002322902.1|1752899_1754093_+	MFS transporter	NA	NA	NA	NA	NA
WP_002288984.1|1754258_1754681_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002303955.1|1755269_1755725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288982.1|1755886_1757059_-	class C sortase	NA	NA	NA	NA	NA
WP_002303963.1|1760189_1762517_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002296840.1|1762788_1763976_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288970.1|1764833_1765127_-	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002286913.1|1765384_1765732_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_002293717.1|1765867_1766629_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002293716.1|1766618_1767140_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002297190.1|1767309_1768101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002290277.1|1768225_1768477_-	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002290274.1|1768488_1768764_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002293714.1|1769016_1769571_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002297192.1|1769649_1770171_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293710.1|1770174_1770753_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002293709.1|1770864_1772283_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293708.1|1772303_1772642_-	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002297194.1|1772601_1773105_-	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293705.1|1773235_1773940_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002303966.1|1773936_1775673_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002297196.1|1775775_1778247_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002326707.1|1778519_1779794_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002289807.1|1780080_1780971_-	phosphate ABC transporter substrate-binding protein PstS family protein	NA	NA	NA	NA	NA
WP_002300070.1|1781167_1781650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289810.1|1781857_1782223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326708.1|1782313_1782631_-	SdpI family protein	NA	NA	NA	NA	NA
WP_002297218.1|1783237_1784533_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_010782561.1|1784894_1785854_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_000122610.1|1786002_1787295_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002301623.1|1787483_1788458_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	7.1e-25
WP_002297404.1|1788867_1790118_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1790403_1790661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305693.1|1790892_1791324_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_002326711.1|1791562_1792741_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_016252743.1|1792992_1793811_-|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_099098442.1|1794112_1795275_-|transposase	IS3-like element ISEfa8 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	1.8e-80
WP_099745852.1|1795379_1796718_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	3.4e-78
WP_002301695.1|1796758_1797451_-	hypothetical protein	NA	Q9MCC6	Lactobacillus_phage	43.4	4.0e-30
WP_002294835.1|1797887_1798457_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|1798530_1798854_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|1799007_1799820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1800173_1801022_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002304699.1|1801166_1802108_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002299539.1|1805902_1808074_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002312937.1|1808093_1810280_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	5.3e-121
WP_002289040.1|1810279_1810489_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002294855.1|1810501_1810942_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002304690.1|1811015_1811555_-	topology modulation protein	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002288779.1|1812169_1813636_-	amino acid permease	NA	NA	NA	NA	NA
WP_002304688.1|1813946_1816028_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.6	2.4e-115
WP_002288776.1|1816551_1816911_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002326717.1|1816940_1817282_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304684.1|1817278_1817953_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1819005_1820304_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002304682.1|1820343_1821534_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002348809.1|1821554_1822082_-	DUF5590 domain-containing protein	NA	NA	NA	NA	NA
WP_002304681.1|1822128_1824918_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.1e-89
WP_002288762.1|1825064_1825265_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002323868.1|1825716_1826037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1826314_1827610_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002288760.1|1828061_1829180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304680.1|1829650_1830958_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002340453.1|1831076_1832276_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002289547.1|1832302_1833571_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	31.1	2.2e-42
WP_002348853.1|1834787_1835291_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|1835413_1836178_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1836285_1836561_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002312285.1|1836998_1837949_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002312284.1|1838127_1838328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010782560.1|1839132_1840092_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002312282.1|1840957_1841488_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312281.1|1841484_1842102_-	VanZ family protein	NA	NA	NA	NA	NA
WP_002312280.1|1842683_1842905_-	transferase	NA	NA	NA	NA	NA
WP_002348669.1|1843082_1844615_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002312276.1|1844750_1845836_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002312275.1|1845850_1846570_-	glycosyl transferase	NA	A0A2K9L639	Tupanvirus	25.0	2.6e-08
WP_002312274.1|1846566_1847877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348666.1|1847903_1848494_-	poly-gamma-glutamate biosynthesis protein	NA	NA	NA	NA	NA
WP_002312270.1|1848811_1849873_-	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	36.5	1.5e-12
WP_002312264.1|1850440_1851508_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_002291721.1|1851527_1852007_-	EpsH	NA	NA	NA	NA	NA
WP_002325817.1|1852023_1852485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312259.1|1852498_1853749_-	nucleotide sugar dehydrogenase	NA	M1IB49	Acanthocystis_turfacea_Chlorella_virus	50.4	8.9e-105
WP_002312258.1|1854126_1855578_-	sugar transferase	NA	NA	NA	NA	NA
WP_002312256.1|1855898_1856663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348664.1|1856690_1857389_-	CpsD/CapB family tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	37.1	6.0e-26
WP_002348663.1|1857400_1858180_-	tyrosine protein kinase	NA	NA	NA	NA	NA
WP_002296209.1|1858195_1859140_-	LCP family protein	NA	NA	NA	NA	NA
WP_002348662.1|1859185_1859965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348661.1|1860344_1862420_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010706148.1|1862421_1863339_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
>prophage 7
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	2039836	2113828	2802604	plate,portal,capsid,tail,holin,transposase,tRNA,terminase	Enterococcus_phage(25.0%)	88	NA	NA
WP_000222572.1|2039836_2040790_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002289406.1|2040823_2042053_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|2042054_2042972_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|2042975_2043713_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|2043803_2044331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|2044510_2045104_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|2045207_2045693_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|2045845_2046043_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|2046137_2047898_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|2047894_2049625_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|2050017_2050230_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|2050231_2051911_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|2052164_2052365_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_002347086.1|2053440_2053839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305550.1|2053831_2054284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002318238.1|2054270_2054777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002324322.1|2054881_2056060_+|transposase	IS256-like element ISEfm2 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2056288_2057628_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002312527.1|2057697_2058723_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	3.6e-64
WP_002286683.1|2058719_2058944_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002286686.1|2058940_2059234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298029.1|2059271_2059409_-	XkdX family protein	NA	NA	NA	NA	NA
WP_002350774.1|2059408_2059816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002342973.1|2059843_2060368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350775.1|2060367_2060817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301866.1|2060820_2061438_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350776.1|2061437_2062346_-|plate	phage baseplate upper protein	plate	A0A1P8BLW0	Lactococcus_phage	25.2	7.8e-10
WP_002347081.1|2062358_2065121_-|tail	phage tail protein	tail	Q9AZX5	Lactococcus_phage	39.1	6.0e-138
WP_002303299.1|2065117_2065858_-|tail	tail protein	tail	NA	NA	NA	NA
WP_076005187.1|2065847_2068637_-	tape measure protein	NA	D7RWD8	Brochothrix_phage	40.2	4.9e-71
WP_002303297.1|2068878_2069220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303295.1|2069219_2069828_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002298045.1|2069828_2070206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298046.1|2070207_2070603_-	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_002298048.1|2070595_2070967_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298050.1|2070966_2071308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002311614.1|2071319_2071535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002312521.1|2071557_2072448_-	DUF5309 domain-containing protein	NA	NA	NA	NA	NA
WP_002312520.1|2072462_2073086_-	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_002304492.1|2073212_2073530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033582200.1|2073531_2074410_-|capsid	minor capsid protein	capsid	NA	NA	NA	NA
WP_002343932.1|2074489_2076025_-|portal	phage portal protein	portal	NA	NA	NA	NA
WP_002304486.1|2076036_2077455_-|terminase	phage terminase large subunit	terminase	A0A090EUA8	Clostridium_phage	51.5	2.5e-124
WP_002304484.1|2077432_2077861_-	hypothetical protein	NA	A0A1P8BMH5	Lactococcus_phage	63.1	2.6e-40
WP_002311618.1|2077878_2078103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304480.1|2078653_2079040_-	hypothetical protein	NA	O34053	Streptococcus_phage	55.2	1.9e-29
WP_002322045.1|2079052_2079466_-	autolysin	NA	C9E2P5	Enterococcus_phage	80.3	2.5e-56
WP_002286693.1|2079542_2079839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304475.1|2079835_2080039_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304474.1|2080045_2080276_-	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	50.7	8.8e-11
WP_002304473.1|2080272_2080584_-	MazG-like family protein	NA	A0A0D3MVS9	Staphylococcus_phage	58.0	5.3e-27
WP_002304472.1|2080722_2081538_-	prohibitin family protein	NA	A0A288TXV9	Enterococcus_phage	69.4	1.8e-82
WP_002350868.1|2081534_2081861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292988.1|2081857_2082019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304469.1|2082033_2082393_-	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	47.5	6.8e-18
WP_002304468.1|2082389_2083241_-	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	30.2	3.0e-27
WP_002303278.1|2083255_2084056_-	hypothetical protein	NA	B4XYS6	Lactobacillus_phage	54.5	8.9e-58
WP_002303277.1|2084098_2084989_-	recombinase RecT	NA	D2IYT9	Enterococcus_phage	84.5	6.2e-137
WP_002303275.1|2084990_2085932_-	YqaJ viral recombinase family protein	NA	D2IZK1	Enterococcus_phage	78.9	2.7e-146
WP_002303273.1|2086164_2086500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299325.1|2086766_2086991_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	81.1	2.2e-27
WP_002303270.1|2086987_2087143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002299038.1|2087299_2087455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304464.1|2087526_2087757_+	DUF2188 domain-containing protein	NA	E8ZD70	Streptococcus_phage	49.3	4.4e-10
WP_002303268.1|2087753_2087912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303266.1|2087924_2088191_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JP54	Staphylococcus_phage	52.7	5.4e-12
WP_002303265.1|2088390_2089095_+	LexA family transcriptional regulator	NA	D7RWF2	Brochothrix_phage	42.4	6.2e-39
WP_002303264.1|2089181_2090471_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	74.0	5.6e-46
WP_002303263.1|2090536_2091889_+	recombinase family protein	NA	D2IZV7	Enterococcus_phage	55.3	1.7e-133
WP_002304462.1|2091783_2092455_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_002287951.1|2092509_2093163_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|2093152_2094466_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|2094775_2097421_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|2097813_2098461_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|2099033_2100245_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
WP_002287956.1|2100260_2101403_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287957.1|2101567_2103289_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287958.1|2103487_2104048_-	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287959.1|2104073_2104913_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287960.1|2104946_2105780_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287961.1|2106011_2106980_+	asparaginase	NA	NA	NA	NA	NA
WP_002287962.1|2107134_2107872_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287963.1|2107887_2108721_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002294080.1|2108922_2110251_-	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002296289.1|2110545_2110710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002348865.1|2111340_2111970_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002287966.1|2112083_2112458_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_086956687.1|2112666_2113828_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
>prophage 8
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	2271291	2293845	2802604	bacteriocin,protease,transposase	Bacillus_phage(42.86%)	23	NA	NA
WP_002288860.1|2271291_2271954_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002303458.1|2272029_2273322_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002303461.1|2273491_2274121_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_002288854.1|2274223_2275033_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.6	3.1e-34
WP_002305460.1|2275087_2275957_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_002288852.1|2275957_2277274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294131.1|2277270_2279106_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	37.7	5.2e-37
WP_002288850.1|2279110_2279815_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.6	5.8e-45
WP_002294132.1|2280004_2280865_-	DegV family protein	NA	A0A1X9I5J4	Streptococcus_phage	24.4	4.6e-12
WP_002322652.1|2280851_2281421_-	DUF1836 domain-containing protein	NA	NA	NA	NA	NA
WP_002294609.1|2282369_2282756_-	DUF4064 domain-containing protein	NA	NA	NA	NA	NA
WP_002294608.1|2282752_2283274_-	RDD family protein	NA	NA	NA	NA	NA
WP_002294607.1|2283275_2284310_-	signal peptide peptidase SppA	NA	A0A1C9LW82	Vibrio_phage	29.2	6.6e-13
WP_002348772.1|2284342_2285758_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_002303464.1|2285726_2287880_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	27.8	7.0e-41
WP_002303465.1|2288137_2288374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002294603.1|2288392_2288608_+|bacteriocin	Blp family class II bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002348773.1|2289310_2290000_-	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002348774.1|2290123_2291443_+|transposase	IS1380-like element IS1678 family transposase	transposase	A0A1X9I6F6	Streptococcus_phage	82.7	6.3e-210
WP_002348775.1|2291761_2293009_-	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_002294600.1|2293084_2293231_-|bacteriocin	EntF family bacteriocin induction factor	bacteriocin	NA	NA	NA	NA
WP_002305452.1|2293334_2293646_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002304799.1|2293647_2293845_-|bacteriocin	leucocin A/sakacin P family class II bacteriocin	bacteriocin	NA	NA	NA	NA
>prophage 9
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	2425828	2547303	2802604	tRNA,holin,protease,transposase	Bacillus_phage(22.22%)	87	NA	NA
WP_002297218.1|2425828_2427124_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002294493.1|2427278_2427962_+	rhamnogalacturonan acetylesterase	NA	NA	NA	NA	NA
WP_002285996.1|2427963_2428800_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002302556.1|2428810_2430565_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	4.1e-39
WP_002285994.1|2430840_2431182_-	YlbF family regulator	NA	A0A1X9I5Y8	Streptococcus_phage	34.9	1.3e-10
WP_002294492.1|2431249_2433421_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_002348711.1|2433589_2434489_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_002285988.1|2434559_2435417_-	ROK family protein	NA	NA	NA	NA	NA
WP_002285985.1|2435401_2438104_-	alpha-mannosidase	NA	NA	NA	NA	NA
WP_002294491.1|2438116_2439406_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_002302559.1|2439555_2440602_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002285980.1|2440603_2442757_+	GH92 family glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002304851.1|2443229_2444681_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002285976.1|2444677_2446402_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010782528.1|2446394_2447009_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002285974.1|2447353_2448811_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002285972.1|2448851_2449772_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002285971.1|2449783_2450731_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002285969.1|2451209_2451929_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002304848.1|2451977_2453624_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002285964.1|2453802_2454393_+	YitT family protein	NA	NA	NA	NA	NA
WP_002285962.1|2454484_2455990_+	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--L- lysine ligase	NA	NA	NA	NA	NA
WP_002285961.1|2456073_2457426_-	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002285960.1|2457425_2457944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002285954.1|2457959_2458286_-	PTS cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002285949.1|2458298_2460278_-	BglG family transcription antiterminator	NA	NA	NA	NA	NA
WP_002285948.1|2460298_2460613_-	PTS cellobiose transporter subunit IIB	NA	NA	NA	NA	NA
WP_002285944.1|2460780_2461074_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_002321621.1|2461151_2462264_-	FUSC family protein	NA	NA	NA	NA	NA
WP_002297280.1|2462416_2462641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002285932.1|2462650_2462830_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_104674935.1|2463023_2463194_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_002303189.1|2469761_2470523_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002285920.1|2470622_2472344_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.0	1.7e-37
WP_002285918.1|2472358_2474143_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.2	2.7e-46
WP_002285917.1|2474523_2476077_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_002285916.1|2476424_2478839_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	72.8	0.0e+00
WP_002301403.1|2479265_2481284_-	LysM peptidoglycan-binding domain-containing protein	NA	Q9ZXE4	Bacillus_phage	39.6	5.8e-13
WP_002285911.1|2481653_2482310_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_002285909.1|2482309_2483266_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	57.4	3.3e-43
WP_002285906.1|2483265_2483832_+	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	42.8	2.2e-34
WP_173668954.1|2484270_2484426_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|2484450_2485629_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296840.1|2486036_2487224_-|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_025479400.1|2487320_2487623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303477.1|2488397_2489417_-	peptidoglycan recognition protein	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002301818.1|2489427_2489634_-|holin	phage holin	holin	NA	NA	NA	NA
WP_002301399.1|2489766_2490726_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002304713.1|2490928_2491861_+	DUF4041 domain-containing protein	NA	M1NRY5	Streptococcus_phage	53.8	1.8e-57
WP_002341521.1|2491932_2492289_+	hypothetical protein	NA	U4KJ82	Streptococcus_phage	42.2	9.2e-15
WP_000997695.1|2492386_2493565_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|2494435_2495775_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301355.1|2495900_2497673_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.4	1.2e-54
WP_002285883.1|2497675_2499388_-	ABC transporter ATP-binding protein	NA	F2Y302	Organic_Lake_phycodnavirus	25.4	1.2e-14
WP_002285876.1|2499502_2500171_+	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002295567.1|2500237_2501026_-	esterase family protein	NA	NA	NA	NA	NA
WP_002295566.1|2501108_2502581_-	MFS transporter	NA	NA	NA	NA	NA
WP_002289731.1|2502710_2503904_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	72.0	1.3e-150
WP_002297218.1|2504212_2505508_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296055.1|2513689_2515186_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	40.9	8.7e-91
WP_002290055.1|2515296_2516301_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_002296053.1|2516301_2517189_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_002287418.1|2517405_2519517_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	C7U047	Ostreococcus_tauri_virus	50.3	9.1e-110
WP_002287415.1|2519606_2520152_-	hypoxanthine phosphoribosyltransferase	NA	A0A1V0SEQ1	Hokovirus	25.3	4.1e-06
WP_002287414.1|2520151_2521597_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	E3T4I1	Cafeteria_roenbergensis_virus	24.5	6.8e-08
WP_002287412.1|2521716_2522187_-	RNA-binding protein S1	NA	NA	NA	NA	NA
WP_002287409.1|2522232_2522658_-	septum formation initiator family protein	NA	NA	NA	NA	NA
WP_002287407.1|2522724_2522994_-	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_002287405.1|2523004_2524600_-	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_002287403.1|2524614_2528136_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_002287401.1|2528152_2528713_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_002287399.1|2529065_2530040_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_002287397.1|2530209_2531610_+	peptidoglycan binding domain-containing protein	NA	NA	NA	NA	NA
WP_002287391.1|2531687_2532410_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002287389.1|2532488_2532995_-	VanZ family protein	NA	NA	NA	NA	NA
WP_002322796.1|2533117_2534917_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_002297218.1|2535078_2536374_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002322795.1|2536506_2538045_-	C40 family peptidase	NA	B5LJD6	Mycobacterium_phage	50.5	2.3e-17
WP_002287385.1|2538299_2538809_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_002296044.1|2538812_2539667_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_002287382.1|2539821_2540460_-	thiamine diphosphokinase	NA	NA	NA	NA	NA
WP_002287380.1|2540460_2541111_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002287379.1|2541123_2542023_-	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_002287377.1|2542187_2544257_-	Stk1 family PASTA domain-containing Ser/Thr kinase	NA	A0A1V0SDC3	Indivirus	30.3	3.5e-21
WP_002287376.1|2544253_2544994_-	Stp1/IreP family PP2C-type Ser/Thr phosphatase	NA	NA	NA	NA	NA
WP_002287374.1|2545006_2546365_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_002287372.1|2546364_2547303_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	29.7	5.2e-09
>prophage 10
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	2629833	2638865	2802604		Streptococcus_phage(83.33%)	10	NA	NA
WP_002297366.1|2629833_2630148_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2630160_2630535_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297364.1|2630544_2630880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002343904.1|2630962_2632108_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	62.8	6.0e-132
WP_002297361.1|2632822_2634682_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	26.0	2.8e-30
WP_002297360.1|2634775_2635015_+	hypothetical protein	NA	A0A1S5SFB5	Streptococcus_phage	80.3	2.1e-23
WP_002297358.1|2635092_2635767_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002297357.1|2635759_2635924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297354.1|2637131_2637422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2637680_2638865_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
>prophage 11
NZ_CP018830	Enterococcus faecium strain ISMMS_VRE_9 chromosome, complete genome	2802604	2670126	2703399	2802604	integrase,transposase	Bacillus_phage(37.5%)	36	2687055:2687070	2697300:2697315
WP_002297332.1|2670126_2670321_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077828743.1|2670512_2670668_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2672524_2674141_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_002317220.1|2674258_2674477_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2674671_2675133_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2675325_2675565_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297324.1|2675588_2677112_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|2677129_2677252_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|2677281_2678265_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2678288_2678438_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2678458_2678836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2678867_2679047_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2679061_2679331_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_002321752.1|2679853_2681620_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.5e-30
WP_002297309.1|2681579_2683334_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002297308.1|2683443_2684013_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002297306.1|2684030_2685446_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.8e-20
WP_002297304.1|2685456_2686125_-	cobalt transporter	NA	NA	NA	NA	NA
WP_071858995.1|2686255_2686840_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2687055:2687070	attL	ACCTTTTCTAAAATAA	NA	NA	NA	NA
WP_002297302.1|2687170_2687404_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_073120143.1|2687418_2688366_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002297294.1|2688365_2689208_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_002297293.1|2689529_2690717_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	28.7	4.6e-26
WP_002297292.1|2690808_2691549_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	33.2	5.7e-19
WP_002320809.1|2692236_2692395_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297291.1|2692466_2693693_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002348684.1|2694022_2694643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002364278.1|2694723_2695134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298782.1|2696683_2697460_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
2697300:2697315	attR	TTATTTTAGAAAAGGT	NA	NA	NA	NA
WP_002322873.1|2697557_2698205_-	HAD family phosphatase	NA	M1I5S4	Acanthocystis_turfacea_Chlorella_virus	27.4	4.5e-12
WP_002298780.1|2698204_2699035_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002298779.1|2699034_2699784_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298777.1|2699797_2700262_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002312606.1|2700311_2700773_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002298774.1|2700754_2701729_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010782508.1|2701953_2703399_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.8	2.2e-123
>prophage 1
NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	259837	0	6285	259837	transposase	Brochothrix_phage(25.0%)	9	NA	NA
WP_002305757.1|13_1159_+|transposase	transposase	transposase	D9J0Y9	Brochothrix_phage	74.6	7.7e-164
WP_002287514.1|1396_1660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321032.1|1653_2004_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002318230.1|2027_2642_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	31.9	2.6e-17
WP_002348911.1|3091_4417_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	43.6	1.2e-99
WP_002303114.1|4409_4760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322386.1|4756_4936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002322251.1|4947_5241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305212.1|5466_6285_+	ParA family protein	NA	F0PIG8	Enterococcus_phage	34.6	6.5e-32
>prophage 2
NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	259837	10191	126089	259837	holin,transposase,integrase,bacteriocin	Streptococcus_phage(15.62%)	112	67913:67972	113962:116306
WP_010782601.1|10191_10533_+	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	2.0e-35
WP_002299885.1|10646_10886_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002299886.1|10952_11192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002326711.1|11343_12522_-|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	8.8e-30
WP_002299887.1|12664_13354_+	sortase	NA	NA	NA	NA	NA
WP_002299888.1|13359_14526_+	EpaQ family protein	NA	NA	NA	NA	NA
WP_002302875.1|14607_15279_+	class A sortase	NA	NA	NA	NA	NA
WP_002302873.1|15331_17308_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002302871.1|17320_18073_+	class C sortase	NA	NA	NA	NA	NA
WP_002302869.1|18088_18850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302867.1|18862_19123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305780.1|19119_21210_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002300034.1|21245_23303_-	FIVAR domain-containing protein	NA	NA	NA	NA	NA
WP_002300033.1|23447_23639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300032.1|23826_24282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305782.1|24278_24521_+	DUF5415 family protein	NA	NA	NA	NA	NA
WP_002302862.1|24538_24841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302860.1|24909_26964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302859.1|26963_29576_+	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_002302858.1|29572_31951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302857.1|32011_32554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302856.1|32631_32964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302855.1|32964_33558_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302854.1|33579_35604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302853.1|35603_36803_+	glucosaminidase domain-containing protein	NA	Q6SEC2	Lactobacillus_prophage	38.1	2.5e-32
WP_002302852.1|36818_37463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302851.1|37473_38280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296375.1|38552_39626_+	DUF4199 domain-containing protein	NA	NA	NA	NA	NA
WP_002305788.1|39669_39939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302849.1|40214_40490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302844.1|40531_40954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033582318.1|40973_42566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302842.1|42586_42922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002302840.1|43067_43262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297404.1|43397_44648_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|45057_47430_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002353594.1|47490_48960_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002303486.1|48970_50980_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	52.6	1.6e-111
WP_002295632.1|51095_51245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303484.1|51325_51922_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002303483.1|51934_52834_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002301801.1|52836_52968_+	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	83.3	1.3e-11
WP_002305808.1|52989_53322_+	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	53.2	6.1e-21
WP_002303482.1|53366_53600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295624.1|53758_53881_-|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002305809.1|54070_54295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305810.1|54737_54944_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300797.1|54943_55195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300799.1|55210_55366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300801.1|55375_55648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002300804.1|56092_56272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002311569.1|56330_56687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000222572.1|57655_58609_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002300807.1|58729_58993_+|bacteriocin	uberolysin/carnocyclin family circular bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000997695.1|59364_60543_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.6	3.0e-30
WP_002332708.1|61074_61983_+|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002300835.1|63927_64383_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002300836.1|64396_65725_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002300838.1|65758_66043_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002300840.1|66044_66560_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_002300841.1|66575_67238_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_002300842.1|67244_67817_+	SIS domain-containing protein	NA	NA	NA	NA	NA
67913:67972	attL	GTAAGCGCCCCATAGAACAGTACCTGTACGTCAAATAACCCGACCTATAGAATAGAATCG	NA	NA	NA	NA
WP_002303202.1|67988_69536_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002287659.1|69637_69991_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002285758.1|69980_70175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300843.1|70356_71877_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	31.6	1.1e-48
WP_002305884.1|72119_72305_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_002300846.1|72288_72471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301839.1|73424_74024_+|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	36.1	1.3e-29
WP_002322465.1|74087_74687_+	bacteriophage abortive infection AbiH family protein	NA	NA	NA	NA	NA
WP_002305879.1|75702_76575_-	ROK family protein	NA	NA	NA	NA	NA
WP_002303302.1|76838_78785_-	PTS beta-glucoside transporter subunit IIBCA	NA	NA	NA	NA	NA
WP_002302078.1|78969_80409_+	sucrose-6-phosphate hydrolase	NA	S6ATV4	Bacillus_phage	25.1	1.4e-16
WP_002302077.1|80410_81373_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	25.8	2.3e-20
WP_086953894.1|81542_82969_-|transposase	IS3-like element ISEfa10 family transposase	transposase	A0A1B1P773	Bacillus_phage	40.2	2.3e-48
WP_002301718.1|83211_83667_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.6	1.3e-13
WP_002289255.1|84252_84483_-	resolvase	NA	NA	NA	NA	NA
WP_002289254.1|84712_85531_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289253.1|85691_86381_+	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_002289252.1|86394_87897_+	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002300328.1|87909_88386_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_086956687.1|88883_90046_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002287870.1|91163_91682_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_002301591.1|93757_94843_+	tyrosine recombinase XerS	NA	NA	NA	NA	NA
WP_000222572.1|94950_95904_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.8	3.7e-34
WP_002301126.1|96034_97285_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_002298736.1|97303_98230_-	PEP phosphonomutase	NA	NA	NA	NA	NA
WP_002301128.1|98308_99304_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|99319_100489_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|100504_101239_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087043335.1|102009_103172_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.2e-79
WP_002301811.1|103740_105033_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|105306_105567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|105817_106996_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_073120200.1|107347_107644_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|108592_108988_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|108997_109846_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|109860_110688_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002285758.1|111758_111953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|111942_112296_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002303202.1|112397_113945_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	2.8e-44
WP_002300493.1|114150_115320_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_010782692.1|115659_116340_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
113962:116306	attR	CGATTCTATTCTATAGGTCGGGTTATTTGACGTACAGGTACTGTTCTATGGGGCGCTTACTAATATCCCATATTTTAAAATAAAAGATAGCGTAAAATATTTTGTGTAAATAGAAATTTAGGGTAGAAAAAAAAGTCCATTCTGTAAAATTAAAGTTACCACACAGAAATTTTATAGGAGGACTTTCTCATGACTAAATTTACTATAGAAATTATGCAAACACTACTCAATAAAGGGGATTTAGATGAATTATTTCAGGATCATTTAGAGCGAGCGATTAATTCACTTCTACAAGCAGAGCTAACTGCTTTTTTAGATTACGAAAAATATGATCGAAATGGATTCAATTCAGGAAATTCCCGTAACGGGAATTATTCACGTACATTTAAAACAGAATATGGCGAGTTGAATTTAACTATTCCTAGAGATCGGAATGGCGAATTTTCTCAACAAACACTACCAGCATATAAGCGAACCAATGATTCATTAGAAACGACCATTATCCAATTATTTCAAAAAGGCATTACTATGGCTGAAATCTCCAAATTAATTGAAAAAATGTATGGTCACCACTATACGCCACAAACAATCTCCAACATGAGTAAATTGGTGGCTGAAGATGTTTTAGCTTTTAAAGAAAGAACGTTAGAAGCCAATTATTCCGTTATATTTATGGATGCGACGCATATCCCTGTGAAGCGACAGACTGTTTCGAAGGAAGCAGTGTATATTACGATTGGTATTCGTTTGGATGGAACCAAAGAAGTTCTTGGGTTTACTATTGCCCCAACTGAGTCTGCTTATATTTGGAAAGAAGTTCTTCAAGATCTTAGAAAACGTGGGTTAGAAGAAGTTTTATTAGTAGTGACAGACGGATTAAGCTGTATTGAAGAAAGTATCCATAGTGTGTATCCGAATGCCCAATTTCAACAATGTTGTGTGCATGTATCTAGAAATATCGCTCATAAAGTTCGTGTTCGAGGTCGAAAAGAAATTTGTGAGGATTTCAAATTGGTTTACCAAGCGAATTCAAAAGAAGAGGCATTGGATCACATCGACTTTATGACTAGGAAATGGAAAAAGCAGTATCCAAGAGTCGTCAATTTACTCTTGAATCCTGCCCTATTAACCTTTTATAATTTCCCTCACGCCATCAGACGAACAATTTATTCGACGAACCTGATTGAAGGCTTTAATAAGCAGCTAAAACGATATACTCGAAGAAAAGAACAATTCCCTAATGAAGAATCTCTAGAGAGATTCTTCATTTCTCAATTTAATCAATATAACCAAAAATTTTTAGGTAGAATTCACAAGGGATTTAAAGAAATTCAGGATACATTAGAGTCGATGATTTAACTGTAATTAACAGAATGGATTTTCCATTTACATATAATTCTTGACGCTACCATAATCTAAATAACCATCATATTCATCTACTACTTATATAATTGAGTTTTATTAAACTTTTTAAGTTTCTATTCTATCAAATATTTAAACAATCTCTGCATCCGAAAAGACTACCTCGTATAGTTTTACTAACAATATTTTTATTAGCGTGTTCAAATCCTGATTTCTTGTATCAATTATTTTCTGTTCACTTTCAATAAGAAAAAAGTCTTTACTTCCATGGATAATAATAAGGGTTCTGTTGCAAAGTTTTAAATAAAGAATAAAATCCCTTACGGTATCTATGATTTAAGCTGGGATTCCCAATAATACCTTGATTTCAGTACAGACCGAAAACCCGAAGAGAGTGCCTTCTTTTCGGGTTTTCTTATATAATCCTCGGATGGCTTCCATGCCTTTAATCGTTGTAGAGGCAGTGCGTAAACTTCGATAGAATTTATTGCGTCTCTTTACTGGACGATGGTCTTGTTCAATCAAATTATTCAGGTATTTAATGGTACGATGTTCTGTCCCTTGATAAAAGCCGTATTCTTTTAGTTTCTTAAAGGCACTTGTAATAGAGGGGGCTTTATCTGTGACTACAACCTTCGGTTCATCAAACTGCTTCACTAACCGCTTAAGAAAAGCATAGGCTGCTTGTGTGTCCCGTTTTTTACTTAACCAAATATCCAAGGTTAAACCATCTGCATCGATGGCTCGATACAAATAATGCCATTTTCCTTTAATTTTGATGTACGTTTCATCCATTTTCCATGAATAAAAGGATTTTTTATTTTTCTTTTTCCAAATTTGATAGAGTAGTTTGCCATATTCTTGCACCCAACGATAAATCGTCGTATGAGAAACGTTAATGCCACGATCATATAAGATTTCTTGAACTTCACGATAGCTAAGGTTATAACGAAGATAGTAGCCCACGGCTACAATAATCACAT	NA	NA	NA	NA
WP_000195429.1|116969_118142_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002303110.1|119972_121010_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002303111.1|121006_121519_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002303113.1|122518_123070_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|123614_124295_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002304893.1|124322_124886_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	34.9	2.2e-18
WP_000824191.1|124930_125098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|125131_125431_-	BRCT domain-containing protein	NA	NA	NA	NA	NA
WP_001224538.1|125471_126089_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
>prophage 3
NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	259837	130650	183419	259837	transposase,integrase	Streptococcus_phage(21.43%)	51	145987:146001	163815:163829
WP_002325565.1|130650_131331_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002348841.1|131949_132153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305972.1|132611_133577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|133656_134337_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|134438_135758_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|135754_136408_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_002348630.1|137117_137834_-	aminotransferase class V-fold PLP-dependent enzyme	NA	Q2XUY6	environmental_halophage	50.0	4.5e-45
WP_016922460.1|137957_138143_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002302261.1|139749_140781_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.6	1.8e-26
WP_002313180.1|140787_141618_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002330693.1|141614_142430_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_002302267.1|142426_143251_-	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_002347701.1|143240_144341_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002302270.1|144518_145304_+	histidinol phosphate phosphatase	NA	NA	NA	NA	NA
WP_002330694.1|145336_145720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077828694.1|145795_145927_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_002322470.1|145895_146132_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
145987:146001	attL	ATGAGGGCTTTTTCG	NA	NA	NA	NA
WP_002302275.1|146209_147181_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002340465.1|147832_149455_+|transposase	IS1182 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	47.5	2.7e-122
WP_002301195.1|149740_151117_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|151116_151773_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|151782_153060_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|153309_154471_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002330699.1|154501_154951_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_002298088.1|155106_155649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099745858.1|155923_157085_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.8	1.2e-79
WP_002313278.1|157710_158190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002326839.1|158259_159168_-|transposase	IS982-like element ISEfm1 family transposase	transposase	NA	NA	NA	NA
WP_002301108.1|159843_160398_-|integrase	tyrosine-type recombinase/integrase	integrase	W8CYP1	Bacillus_phage	46.1	8.6e-36
WP_002307497.1|162032_162845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002316137.1|163518_164691_+|transposase	IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	98.4	1.1e-133
163815:163829	attR	CGAAAAAGCCCTCAT	NA	NA	NA	NA
WP_002303163.1|165970_166834_-	triphosphoribosyl-dephospho-CoA synthase CitG	NA	NA	NA	NA	NA
WP_002305953.1|166826_167384_-	citrate lyase holo-[acyl-carrier protein] synthase	NA	NA	NA	NA	NA
WP_002303161.1|167380_168940_-	citrate lyase subunit alpha	NA	NA	NA	NA	NA
WP_002303160.1|168932_169838_-	citrate (pro-3S)-lyase subunit beta	NA	NA	NA	NA	NA
WP_002303159.1|169842_170136_-	citrate lyase acyl carrier protein	NA	NA	NA	NA	NA
WP_002303158.1|170139_171153_-	[citrate (pro-3S)-lyase] ligase	NA	NA	NA	NA	NA
WP_002303157.1|171178_172483_-	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002303156.1|172463_173651_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002303155.1|173838_174786_+	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002292681.1|175082_175631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|175631_176489_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002300557.1|176774_177062_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|177051_177381_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_002305108.1|177457_177730_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_002303154.1|177729_177993_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_002303153.1|178098_178515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102642289.1|179163_180325_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	50.9	1.5e-77
WP_002303235.1|180797_181697_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_002305107.1|181717_181990_-	DUF3884 family protein	NA	NA	NA	NA	NA
WP_002290548.1|182012_183419_-	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	29.0	3.6e-46
>prophage 4
NZ_CP018832	Enterococcus faecium strain ISMMS_VRE_9 plasmid p1_ISMMS_VRE9, complete sequence	259837	187537	257683	259837	transposase,integrase	Streptococcus_phage(26.92%)	61	191604:191619	201108:201123
WP_002290554.1|187537_188053_-	galactose-6-phosphate isomerase subunit LacB	NA	A0A222YX14	Synechococcus_phage	36.0	3.3e-05
WP_002290555.1|188069_188495_-	galactose-6-phosphate isomerase subunit LacA	NA	NA	NA	NA	NA
WP_002290556.1|188984_189752_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_072538890.1|190886_191219_-	topoisomerase I	NA	A0A1X9I6W8	Streptococcus_phage	96.8	2.2e-42
WP_172820227.1|191312_191858_-	hypothetical protein	NA	F2Y1B5	Organic_Lake_phycodnavirus	31.8	7.0e-14
191604:191619	attL	TCTTTTAAATGTTTTA	NA	NA	NA	NA
WP_002303240.1|192255_192711_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_002303241.1|193228_194179_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_002348634.1|196182_197481_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_010782529.1|197847_198756_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010782535.1|199218_200511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002348758.1|200485_202258_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	36.1	2.1e-19
201108:201123	attR	TCTTTTAAATGTTTTA	NA	NA	NA	NA
WP_002348764.1|203894_204737_-	glycosyltransferase family 8 protein	NA	NA	NA	NA	NA
WP_002348763.1|204873_206253_-	Xaa-Pro aminopeptidase	NA	NA	NA	NA	NA
WP_025480881.1|206402_206858_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.5	2.3e-34
WP_002348761.1|206847_207513_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_002348760.1|207659_208103_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	NA	NA	NA	NA
WP_010782532.1|208151_208502_+	ribonucleotide-diphosphate reductase subunit beta	NA	A0A096XT60	Enterococcus_phage	43.8	6.0e-19
WP_010782694.1|208583_209537_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.1	1.8e-33
WP_010782530.1|209460_210633_-	S8 family serine peptidase	NA	A0A217EQY2	Bacillus_phage	33.5	1.5e-13
WP_002348804.1|210662_211391_-	hypothetical protein	NA	A0A1B0T6A2	Bacillus_phage	26.5	6.3e-10
WP_002292681.1|211650_212199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292680.1|212199_213057_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	30.7	8.1e-33
WP_002313074.1|213342_213630_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002292678.1|213619_213949_-	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_016171159.1|217212_218085_-	ROK family protein	NA	NA	NA	NA	NA
WP_002322556.1|218101_219574_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_002313079.1|219587_220436_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002348858.1|220432_221299_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_016171161.1|221341_222655_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016171162.1|222794_223766_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.4	1.2e-05
WP_002313084.1|224800_225406_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	32.6	3.6e-19
WP_002340501.1|225451_225631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016171164.1|227238_228147_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002342383.1|228205_230008_-	3'-5' exoribonuclease	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_002342384.1|230070_230913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331328.1|230928_231150_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002336713.1|231645_232326_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002339142.1|232383_233604_-	PAS domain-containing protein	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_002339141.1|233623_234235_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002339140.1|234277_235210_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002339139.1|235634_236492_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002336713.1|236638_237319_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002296843.1|237431_237620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|237764_238445_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002290394.1|238920_239238_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_002303208.1|239238_239493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002287522.1|239851_240256_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|240272_241421_+|transposase	transposase	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002348857.1|242127_242322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303636.1|243673_244714_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_002323647.1|245537_245870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002295674.1|246488_246830_+	DUF5406 domain-containing protein	NA	F0PIH7	Enterococcus_phage	62.5	1.5e-35
WP_002297404.1|247066_248317_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002305801.1|248726_251099_+	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002347152.1|251159_252620_+	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002305772.1|252630_254835_+	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002303309.1|254850_255000_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002303311.1|255075_255669_+	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002303312.1|255681_256581_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002321302.1|256583_257057_+	single-stranded DNA-binding protein	NA	Q938M7	Temperate_phage	62.0	5.6e-44
WP_002321303.1|257422_257683_+	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	3.4e-11
>prophage 1
NZ_CP018831	Enterococcus faecium strain ISMMS_VRE_9 plasmid p2_ISMMS_VRE9, complete sequence	46747	0	13545	46747	transposase	Streptococcus_phage(100.0%)	13	NA	NA
WP_000997689.1|663_1704_+	replication initiator protein A	NA	NA	NA	NA	NA
WP_002287920.1|2319_3000_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.6e-127
WP_001814874.1|3145_3229_+	23S rRNA methyltransferase attenuation leader peptide	NA	NA	NA	NA	NA
WP_001038792.1|3353_4091_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(B)	NA	E4ZFQ0	Streptococcus_phage	99.2	7.0e-134
WP_000567888.1|5384_5630_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000228166.1|5732_6602_+	nucleotidyltransferase domain-containing protein	NA	A0A1X9I6C9	Streptococcus_phage	95.8	4.3e-159
WP_000662263.1|6582_7317_+	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	100.0	1.5e-141
WP_001255866.1|7349_8258_+	aminoglycoside nucleotidyltransferase ANT(6)-Ia	NA	E4ZFP8	Streptococcus_phage	100.0	2.8e-177
WP_000627290.1|8254_8797_+	streptothricin N-acetyltransferase Sat4	NA	A0A1B0RXL7	Streptococcus_phage	100.0	8.9e-94
WP_001096887.1|8889_9684_+	aminoglycoside O-phosphotransferase APH(3')-IIIa	NA	E4ZFP6	Streptococcus_phage	100.0	2.3e-154
WP_000122610.1|9826_11119_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_002321977.1|11466_12009_+	HTH domain-containing protein	NA	A0A1B0RXM1	Streptococcus_phage	98.3	2.4e-91
WP_000122610.1|12252_13545_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
>prophage 2
NZ_CP018831	Enterococcus faecium strain ISMMS_VRE_9 plasmid p2_ISMMS_VRE9, complete sequence	46747	19616	25216	46747	transposase	Streptococcus_phage(40.0%)	5	NA	NA
WP_001015311.1|19616_20297_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_001280781.1|20698_21394_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|21371_22526_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_000122610.1|22623_23916_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	38.9	3.2e-57
WP_001059542.1|24247_25216_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
>prophage 3
NZ_CP018831	Enterococcus faecium strain ISMMS_VRE_9 plasmid p2_ISMMS_VRE9, complete sequence	46747	29117	38779	46747	transposase	Streptococcus_phage(57.14%)	9	NA	NA
WP_000754864.1|29117_29447_-	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	44.6	2.6e-16
WP_000629052.1|29751_30081_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000312841.1|30070_30358_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000017403.1|30636_31200_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.4	2.3e-36
WP_000222571.1|31842_32796_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.1	1.3e-34
WP_000443455.1|32773_34249_+	RNA-directed DNA polymerase	NA	Q2P9X6	Enterobacteria_phage	34.8	3.5e-68
WP_001015311.1|36087_36768_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_001015311.1|36885_37566_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002287920.1|38098_38779_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	7.6e-127
>prophage 4
NZ_CP018831	Enterococcus faecium strain ISMMS_VRE_9 plasmid p2_ISMMS_VRE9, complete sequence	46747	42258	44648	46747		Clostridium_phage(50.0%)	2	NA	NA
WP_001261742.1|42258_42873_-	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_000969590.1|43322_44648_+	Y-family DNA polymerase	NA	M1Q231	Streptococcus_phage	44.0	6.3e-101
