The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP026501	Corynebacterium pseudotuberculosis strain MB295 chromosome, complete genome	2369254	1753138	1830558	2369254	bacteriocin,tRNA,integrase,protease	Agrobacterium_phage(14.29%)	58	1805308:1805335	1811218:1811245
WP_041478401.1|1753138_1755874_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.9	8.3e-140
WP_013242455.1|1756040_1757021_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014367460.1|1757623_1758382_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014367461.1|1758440_1759727_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.8e-132
WP_014523534.1|1759887_1762692_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1762768_1763398_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1763413_1764013_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014367463.1|1764223_1765576_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1766366_1766609_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1766745_1767522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1767608_1768619_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1768736_1769210_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1769276_1769897_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014367469.1|1770230_1772846_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_014523536.1|1773267_1773846_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1773964_1774357_+	globin	NA	NA	NA	NA	NA
WP_104960510.1|1774368_1775265_+	DMT family transporter	NA	NA	NA	NA	NA
WP_013242473.1|1775268_1775877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1775882_1776311_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1776518_1778189_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014367473.1|1778378_1778939_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014367476.1|1779467_1781222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1781218_1782757_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367478.1|1782783_1784262_+	nitroreductase	NA	NA	NA	NA	NA
WP_014367479.1|1784258_1786862_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1786861_1787875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1787871_1788852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367482.1|1788890_1789061_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014733038.1|1789134_1790586_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1790607_1791366_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1791362_1792286_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367486.1|1792376_1794422_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_104960511.1|1795014_1797300_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014367489.1|1797319_1797520_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367490.1|1797860_1799687_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_104960512.1|1799962_1800958_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014523547.1|1801084_1801888_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1801953_1802613_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014367495.1|1802792_1803620_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1803673_1804864_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1805308:1805335	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_052661840.1|1805482_1806616_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A249XT84	Mycobacterium_phage	30.6	2.4e-32
WP_032802512.1|1807064_1808069_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_052399380.1|1808065_1808503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367498.1|1809956_1810514_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_014367502.1|1811557_1812556_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1811218:1811245	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1812755_1813310_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1813318_1813663_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013242498.1|1813784_1814060_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1814148_1814628_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1814665_1815319_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242501.1|1815331_1815721_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014367505.1|1815851_1824950_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1825174_1825480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104960514.1|1825640_1826759_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014367508.1|1826755_1827382_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014367509.1|1827425_1828457_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014524035.1|1828638_1829397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050859096.1|1829895_1830558_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP026501	Corynebacterium pseudotuberculosis strain MB295 chromosome, complete genome	2369254	1985342	1993803	2369254	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014367621.1|1985342_1987091_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
WP_014367622.1|1987068_1987737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1987744_1988131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1988127_1988643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1988653_1989100_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367625.1|1989096_1989552_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1989553_1989895_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1989881_1990664_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1990665_1991229_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_088428658.1|1991221_1993177_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.6e-111
WP_014300955.1|1993221_1993803_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
