The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP023395	Corynebacterium pseudotuberculosis strain MB278 chromosome, complete genome	2369898	1754982	1832397	2369898	bacteriocin,tRNA,integrase,protease	Agrobacterium_phage(14.29%)	59	1807148:1807175	1813057:1813084
WP_041478401.1|1754982_1757718_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	38.9	8.3e-140
WP_013242455.1|1757884_1758865_-	malate dehydrogenase	NA	NA	NA	NA	NA
WP_014367460.1|1759467_1760226_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014367461.1|1760284_1761571_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.4	1.8e-132
WP_014523534.1|1761731_1764536_-	aminodeoxychorismate synthase component I	NA	A0A0B5J984	Pandoravirus	34.5	2.8e-82
WP_013242459.1|1764612_1765242_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	43.5	1.4e-37
WP_013242460.1|1765257_1765857_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	48.3	1.3e-42
WP_014524025.1|1766067_1767420_-	trigger factor	NA	NA	NA	NA	NA
WP_014300878.1|1768209_1768452_+	hypothetical protein	NA	A0A1W6JRB8	Corynebacterium_phage	48.4	3.9e-09
WP_014523535.1|1768588_1769365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367466.1|1769451_1770462_-	pirin family protein	NA	NA	NA	NA	NA
WP_013242465.1|1770579_1771053_-	ribose-5-phosphate isomerase	NA	NA	NA	NA	NA
WP_014367467.1|1771119_1771740_-	DSBA oxidoreductase	NA	NA	NA	NA	NA
WP_014367469.1|1772073_1774689_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	29.7	5.9e-42
WP_014523536.1|1775110_1775689_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_014367472.1|1775807_1776200_+	globin	NA	NA	NA	NA	NA
WP_088428654.1|1776211_1777108_+	DMT family transporter	NA	NA	NA	NA	NA
WP_013242473.1|1777111_1777720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242474.1|1777725_1778154_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_014522869.1|1778361_1780032_-	energy-dependent translational throttle protein EttA	NA	A0A2K9L0W2	Tupanvirus	27.9	1.3e-47
WP_014367473.1|1780221_1780782_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_014367476.1|1781308_1783063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367477.1|1783059_1784598_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014523541.1|1784624_1786103_+	nitroreductase	NA	NA	NA	NA	NA
WP_014367479.1|1786099_1788703_+	lantibiotic dehydratase	NA	NA	NA	NA	NA
WP_014367480.1|1788702_1789716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367481.1|1789712_1790693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014367482.1|1790731_1790902_+|bacteriocin	thiazolylpeptide-type bacteriocin	bacteriocin	NA	NA	NA	NA
WP_014733038.1|1790975_1792427_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_014367484.1|1792448_1793207_-	permease	NA	NA	NA	NA	NA
WP_014367485.1|1793203_1794127_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	26.1	4.2e-19
WP_014367486.1|1794217_1796263_-	bifunctional copper resistance protein CopD/cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_014367488.1|1796855_1799141_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_014367489.1|1799160_1799361_+	YbdD/YjiX family protein	NA	NA	NA	NA	NA
WP_014367490.1|1799701_1801528_-	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	31.8	6.8e-29
WP_014733040.1|1801803_1802799_+	oxidoreductase	NA	NA	NA	NA	NA
WP_014523547.1|1802925_1803729_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_014523548.1|1803794_1804454_+	oligoribonuclease	NA	M4M9I5	Vibrio_phage	35.0	8.4e-22
WP_014367495.1|1804633_1805461_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_014523549.1|1805514_1806705_-	L,D-transpeptidase	NA	NA	NA	NA	NA
1807148:1807175	attL	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_050494099.1|1807322_1808000_+	hypothetical protein	NA	A0A1X9SFC1	Mycobacterium_phage	34.0	5.1e-22
WP_075140840.1|1808113_1808455_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_032802512.1|1808904_1809909_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_052399380.1|1809905_1810343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367498.1|1811795_1812353_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	46.2	4.0e-33
WP_014367502.1|1813396_1814395_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
1813057:1813084	attR	TTCGGGGTTCAAGTCCCTGATGGCGCAC	NA	NA	NA	NA
WP_014655718.1|1814594_1815149_+	isochorismatase family protein	NA	A0A2K9L2K0	Tupanvirus	32.6	5.2e-17
WP_014800825.1|1815157_1815502_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_013242498.1|1815623_1815899_-	DUF3618 domain-containing protein	NA	NA	NA	NA	NA
WP_013242499.1|1815987_1816467_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_013242500.1|1816504_1817158_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_013242501.1|1817170_1817560_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_014367505.1|1817690_1826789_-	type I polyketide synthase	NA	NA	NA	NA	NA
WP_014523551.1|1827013_1827319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014655722.1|1827479_1828595_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_014367508.1|1828591_1829218_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_014367509.1|1829261_1830293_+	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_014524035.1|1830474_1831233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367511.1|1831731_1832397_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP023395	Corynebacterium pseudotuberculosis strain MB278 chromosome, complete genome	2369898	1986921	1995382	2369898	holin	Pandoravirus(33.33%)	11	NA	NA
WP_014367621.1|1986921_1988670_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	31.5	4.9e-61
WP_014367622.1|1988647_1989316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367623.1|1989323_1989710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014367624.1|1989706_1990222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_013242641.1|1990232_1990679_-	DUF3180 domain-containing protein	NA	NA	NA	NA	NA
WP_014367625.1|1990675_1991131_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	S4W084	Pandoravirus	33.8	1.1e-09
WP_014655799.1|1991132_1991474_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_014523608.1|1991460_1992243_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.2	6.5e-21
WP_014367628.1|1992244_1992808_-	GTP cyclohydrolase I FolE	NA	A0A1W7AF02	Streptococcus_virus	57.8	2.6e-48
WP_088428658.1|1992800_1994756_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQU5	Bathycoccus_sp._RCC1105_virus	50.3	7.6e-111
WP_014300955.1|1994800_1995382_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	31.4	3.0e-15
