The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1005017	1018200	4670066		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|1005017_1005779_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|1005772_1006399_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272590.1|1006538_1007678_+	lipoprotein NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1007740_1008733_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|1008826_1010191_-	permease	NA	NA	NA	NA	NA
WP_001136934.1|1010279_1011056_-	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_001278994.1|1011060_1011699_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|1011695_1012958_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|1012954_1013863_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001300386.1|1014058_1014826_+	DeoR family transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_001141322.1|1014876_1015533_-	serine/threonine protein phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272898.1|1015638_1018200_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1360042	1411731	4670066	holin,lysis,transposase,portal,coat,tail,protease,head,terminase	Enterobacteria_phage(54.39%)	67	NA	NA
WP_047627448.1|1360042_1361581_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	3.8e-283
WP_001355656.1|1361928_1365522_-	two-component system sensor histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_000991370.1|1365526_1366141_-	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_000435167.1|1366556_1367720_+	multidrug resistance protein EmrK	NA	NA	NA	NA	NA
WP_001018731.1|1367719_1369258_+	multidrug resistance protein EmrY	NA	NA	NA	NA	NA
WP_000426426.1|1369365_1370694_-	D-serine dehydratase	NA	NA	NA	NA	NA
WP_063502022.1|1370711_1372049_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_001300996.1|1372266_1373202_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_001163428.1|1373385_1373586_-	transcriptional regulator	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_071447824.1|1373643_1373811_-	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	96.4	1.4e-26
WP_000022062.1|1373899_1374181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071447823.1|1374295_1374817_-	DUF551 domain-containing protein	NA	K7P7E3	Enterobacteria_phage	72.2	1.6e-63
WP_071447822.1|1374819_1375011_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	4.7e-26
WP_071447821.1|1375012_1375420_-	hypothetical protein	NA	A0A125RPT9	Escherichia_phage	97.8	1.9e-69
WP_000118152.1|1375421_1375721_-	hypothetical protein	NA	Q716F3	Shigella_phage	100.0	1.5e-58
WP_062810260.1|1375717_1375885_-	DUF2737 domain-containing protein	NA	G9L664	Escherichia_phage	98.2	5.6e-23
WP_071447820.1|1375895_1376189_-	DUF2856 domain-containing protein	NA	Q687G7	Enterobacteria_phage	97.9	9.4e-50
WP_071447819.1|1376202_1376709_-	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	99.4	1.2e-79
WP_071447818.1|1376709_1377417_-	recombinase	NA	K7PKU3	Enterobacteria_phage	99.1	5.0e-137
WP_001243355.1|1377671_1377824_-	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000638547.1|1377808_1377940_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_071447817.1|1377964_1378933_-	cell envelope biogenesis protein TolA	NA	K7P7J7	Enterobacteria_phage	99.7	7.7e-56
WP_021549877.1|1379121_1379310_-	hypothetical protein	NA	K7PMF8	Enterobacteria_phage	90.9	1.1e-16
WP_000340008.1|1379318_1379645_-	antitermination protein	NA	A4KWR0	Enterobacteria_phage	100.0	2.7e-53
WP_001519589.1|1380137_1380833_-	helix-turn-helix domain-containing protein	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_071447816.1|1380909_1381125_+	XRE family transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	1.1e-34
WP_000536662.1|1381241_1381523_+	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	100.0	1.9e-44
WP_071447815.1|1381705_1382527_+	replication of DNA	NA	K7PJZ3	Enterobacterial_phage	99.3	1.3e-152
WP_000806596.1|1382523_1383900_+	DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.3e-253
WP_077249208.1|1383955_1384414_+	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.3e-81
WP_000153270.1|1384410_1384938_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_000566866.1|1385113_1385284_+	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_001279421.1|1385276_1385546_+	hypothetical protein	NA	K7PHK7	Enterobacteria_phage	100.0	7.1e-44
WP_071447814.1|1385545_1386157_+	recombination protein NinG	NA	K7P6N9	Enterobacteria_phage	98.5	1.1e-97
WP_000144614.1|1386153_1386360_+	protein ninH	NA	Q716C0	Shigella_phage	100.0	7.3e-33
WP_071447813.1|1386337_1387003_+	serine/threonine protein phosphatase	NA	K7P721	Enterobacteria_phage	98.6	1.5e-130
WP_053530305.1|1386999_1387623_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	99.5	8.9e-114
WP_015966862.1|1388295_1388619_+|holin	phage holin, lambda family	holin	K7PH31	Enterobacteria_phage	100.0	2.2e-52
WP_000229392.1|1388602_1389079_+	lysozyme	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_076751376.1|1389075_1389543_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	96.1	1.8e-74
WP_071447763.1|1389530_1389683_+	hypothetical protein	NA	Q716B2	Shigella_phage	98.0	4.7e-21
WP_071447764.1|1389885_1390410_+	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	93.6	1.3e-86
WP_071447765.1|1390641_1390998_+	hypothetical protein	NA	Q716B1	Shigella_phage	74.6	3.0e-42
WP_000807788.1|1391101_1391344_+	DUF2560 domain-containing protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_000091987.1|1391345_1391525_+	hypothetical protein	NA	A0A088CPS9	Enterobacteria_phage	100.0	3.7e-25
WP_001436504.1|1391548_1391971_+	hypothetical protein	NA	Q716H4	Shigella_phage	100.0	7.2e-75
WP_071447766.1|1391967_1393383_+|terminase	PBSX family phage terminase large subunit	terminase	A0A088CQ06	Enterobacteria_phage	99.6	1.3e-277
WP_021499317.1|1393384_1395583_+|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	97.3	0.0e+00
WP_000372575.1|1395673_1396567_+	scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	99.0	4.3e-130
WP_071447767.1|1396585_1397839_+|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	98.3	1.3e-233
WP_001389518.1|1397880_1398069_+	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_071447768.1|1398049_1398511_+|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	99.3	1.6e-83
WP_071447769.1|1398520_1399939_+	hypothetical protein	NA	A0A2D1GM00	Escherichia_phage	99.2	3.5e-275
WP_071447770.1|1399938_1400640_+|tail	phage tail protein	tail	A5VW68	Enterobacteria_phage	97.4	2.3e-118
WP_071447771.1|1400639_1401095_+	DUF2824 domain-containing protein	NA	A0A2D1GLX4	Escherichia_phage	98.7	3.3e-86
WP_071447772.1|1401097_1401790_+	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.0	1.1e-112
WP_071447773.1|1401799_1403185_+	acyltransferase	NA	I6RSG0	Salmonella_phage	94.8	1.2e-243
WP_071447780.1|1403592_1405434_+	hypothetical protein	NA	A0A2D1GLK8	Escherichia_phage	92.8	4.7e-296
WP_108933409.1|1405451_1405583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071447774.1|1405622_1406108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000151196.1|1406379_1406565_+	hypothetical protein	NA	I6RSG3	Salmonella_phage	100.0	1.1e-08
WP_100250204.1|1406586_1406958_-	hypothetical protein	NA	I6S5X4	Salmonella_phage	90.9	1.0e-56
WP_032274930.1|1406991_1407327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071447776.1|1407323_1407578_-	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	90.0	2.4e-33
WP_000677939.1|1407668_1407830_+	Arc family DNA-binding protein	NA	A8CG91	Salmonella_phage	98.1	2.7e-22
WP_071447781.1|1407898_1408777_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	78.5	3.1e-96
WP_071447778.1|1410582_1411731_-	DUF4102 domain-containing protein	NA	Q716F9	Shigella_phage	99.2	4.0e-221
>prophage 3
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1655250	1664692	4670066		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569315.1|1655250_1656177_+	ABC transporter ATPase	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
WP_000783120.1|1656181_1656913_+	osmoprotectant uptake system permease	NA	NA	NA	NA	NA
WP_001216963.1|1656893_1657001_-	membrane protein	NA	NA	NA	NA	NA
WP_001240401.1|1657060_1657792_-	transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1658013_1659699_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1659695_1660415_+	DNA-binding response regulator	NA	NA	NA	NA	NA
WP_001295430.1|1660461_1660932_+	DUF1456 domain-containing protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001373589.1|1660972_1661434_-	hypothetical protein	NA	Q9EYF5	Enterobacteria_phage	98.7	1.6e-75
WP_001423058.1|1661558_1663559_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.6	0.0e+00
WP_001333512.1|1663555_1664692_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.9e-162
>prophage 4
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1759255	1767556	4670066		Enterobacteria_phage(28.57%)	8	NA	NA
WP_071447894.1|1759255_1760650_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.5	8.3e-19
WP_000183060.1|1760824_1761718_+	UTP--glucose-1-phosphate uridylyltransferase	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_071447893.1|1762091_1763177_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	9.7e-100
WP_071447892.1|1763176_1764076_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	3.7e-28
WP_000857502.1|1764133_1765012_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	5.1e-107
WP_001100800.1|1765016_1765562_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	58.7	4.9e-52
WP_032167161.1|1765551_1766736_+	O149 family O-antigen flippase	NA	NA	NA	NA	NA
WP_000532600.1|1766719_1767556_+	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	32.5	2.5e-26
>prophage 5
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	1972682	1995341	4670066	tail,tRNA,plate,integrase	Shigella_phage(61.11%)	25	1982988:1983008	2000485:2000505
WP_001025322.1|1972682_1974416_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
WP_001295504.1|1974631_1975198_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185727.1|1975211_1975958_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_063091549.1|1976345_1977446_+	cytochrome C	NA	NA	NA	NA	NA
WP_000176796.1|1977470_1979900_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_063091550.1|1980064_1981036_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1981032_1981776_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1981816_1982212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050582975.1|1982264_1983044_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	4.7e-72
1982988:1983008	attL	CACGCAGTTAAAGTGGCGGGC	NA	NA	NA	NA
WP_071447991.1|1983040_1984102_-|integrase	site-specific integrase	integrase	A0A286S1S8	Klebsiella_phage	88.4	8.4e-181
WP_000779294.1|1984157_1984718_+	hypothetical protein	NA	Q8SBH4	Shigella_phage	99.5	1.8e-105
WP_000497749.1|1984726_1984894_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	96.3	8.6e-24
WP_076751445.1|1984880_1986374_+|tail	phage tail protein	tail	S5FKL0	Shigella_phage	98.2	7.7e-273
WP_000090998.1|1986373_1986730_+	hypothetical protein	NA	U5P076	Shigella_phage	100.0	5.3e-63
WP_000661054.1|1986729_1986999_+|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_071840190.1|1986965_1987154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807197.1|1987140_1988976_+|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_076751444.1|1988994_1990365_+	DNA circularization protein	NA	S5FUX4	Shigella_phage	98.0	2.4e-252
WP_032301265.1|1990361_1991441_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	3.4e-206
WP_001259088.1|1991440_1991989_+|plate	phage baseplate assembly protein V	plate	U5P081	Shigella_phage	98.4	3.3e-96
WP_001310202.1|1991985_1992414_+	hypothetical protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_071447973.1|1992400_1993459_+|plate	phage baseplate protein	plate	M1FQW3	Enterobacteria_phage	98.9	2.8e-200
WP_016236826.1|1993449_1994034_+	DUF2313 domain-containing protein	NA	O22003	Shigella_phage	99.5	1.8e-113
WP_076751443.1|1994037_1994739_+|integrase	integrase	integrase	U5P0I1	Shigella_phage	93.5	2.7e-50
WP_071448062.1|1994738_1995341_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.4	1.5e-94
2000485:2000505	attR	CACGCAGTTAAAGTGGCGGGC	NA	NA	NA	NA
>prophage 6
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	2282087	2355036	4670066	holin,transposase,portal,tail,protease,terminase	Enterobacteria_phage(47.73%)	76	NA	NA
WP_001260865.1|2282087_2282909_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2283008_2283092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|2283184_2283520_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|2283916_2285170_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|2285276_2286170_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|2286304_2287525_+	protein mlc	NA	NA	NA	NA	NA
WP_000919231.1|2287649_2288345_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_001315626.1|2288297_2289590_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2289748_2290363_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|2290405_2291260_-	dimethylsulfoxide reductase	NA	NA	NA	NA	NA
WP_000213028.1|2291261_2291879_-	dimethylsulfoxide reductase	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072643462.1|2291889_2294313_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
WP_076751434.1|2294373_2296800_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.1	5.9e-214
WP_001300836.1|2296998_2297304_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2297411_2298122_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2298124_2298685_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2298719_2299061_-	DUF1283 domain-containing protein	NA	NA	NA	NA	NA
WP_000598292.1|2299195_2299522_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_071524890.1|2299558_2299747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295394.1|2299727_2300942_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_076751433.1|2300953_2301814_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	28.6	2.0e-15
WP_100250240.1|2302554_2302749_+	alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_001360138.1|2302806_2302917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001466366.1|2303761_2304142_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	4.2e-66
WP_000612591.1|2304138_2304486_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_047627448.1|2304535_2306074_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	94.3	3.8e-283
WP_000005552.1|2306701_2306953_-	DNA-binding protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_077880228.1|2307025_2308963_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.5e-58
WP_063501605.1|2309759_2310719_+	DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_071607221.1|2310723_2310912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077880202.1|2311116_2311839_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000839587.1|2312029_2312245_+|holin	holin	holin	A5LH82	Enterobacteria_phage	94.4	2.9e-32
WP_000165360.1|2312249_2312468_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	63.8	1.6e-17
WP_001013163.1|2312492_2312789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029364068.1|2312916_2313450_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	2.6e-98
WP_001071774.1|2313446_2313944_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
WP_000066495.1|2314307_2314520_+	cold-shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071528545.1|2314530_2314719_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|2314866_2315022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101780548.1|2315079_2315205_-	nitrite extrusion protein 2	NA	NA	NA	NA	NA
WP_085947917.1|2315170_2316443_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.4e-177
WP_001019207.1|2316530_2316704_+	protein GnsB	NA	NA	NA	NA	NA
WP_085947771.1|2317106_2318269_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000421825.1|2318876_2319416_+	DUF1441 domain-containing protein	NA	A5LH26	Enterobacteria_phage	100.0	1.8e-94
WP_023281932.1|2319424_2321524_+|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	97.1	0.0e+00
WP_001072975.1|2321520_2321733_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000985944.1|2321732_2323241_+|portal	phage portal protein	portal	A0A291AWU2	Escherichia_phage	100.0	1.6e-289
WP_072663991.1|2323089_2325213_+	peptidase S14	NA	K7PGT6	Enterobacteria_phage	100.0	0.0e+00
WP_076751430.1|2325254_2325623_+	DUF2190 domain-containing protein	NA	A0A291AWX2	Escherichia_phage	99.1	3.7e-51
WP_001283153.1|2325615_2325891_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677131.1|2325902_2326481_+|tail	tail protein	tail	A5LH33	Enterobacteria_phage	99.5	6.1e-101
WP_001079419.1|2326477_2326879_+|tail	tail protein	tail	A5LH34	Enterobacteria_phage	99.2	1.9e-72
WP_000211096.1|2326889_2327633_+|tail	tail protein	tail	K7PGT7	Enterobacteria_phage	99.2	2.0e-133
WP_063501734.1|2327693_2328080_+|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	96.1	1.1e-61
WP_001161009.1|2328088_2328418_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_063501729.1|2328389_2331455_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.3	0.0e+00
WP_000447253.1|2331454_2331784_+|tail	tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_072666924.1|2331793_2332492_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.3e-133
WP_064732705.1|2332497_2333241_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	7.3e-147
WP_001399694.1|2333138_2333786_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.7	1.2e-110
WP_076751429.1|2333845_2337259_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	98.4	0.0e+00
WP_072666922.1|2337329_2337929_+	Ail/Lom family protein	NA	A0A0P0ZCF6	Stx2-converting_phage	97.5	1.1e-108
WP_063501714.1|2337993_2341299_+|tail	phage tail protein	tail	K7PGT9	Enterobacteria_phage	69.0	5.0e-280
WP_072144121.1|2341353_2341473_+	hypothetical protein	NA	K7PMH7	Enterobacteria_phage	84.6	3.1e-12
WP_000086527.1|2341570_2342161_-	Rac prophage; site-specific recombinase	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|2342477_2342711_-	hypothetical protein	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000347482.1|2343496_2344780_+	MFS transporter	NA	NA	NA	NA	NA
WP_063091469.1|2344868_2346329_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.4	2.1e-41
WP_000214712.1|2346363_2346567_-	protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000215549.1|2346743_2347430_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000636571.1|2347518_2348265_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_076751428.1|2348401_2350447_+	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001024558.1|2350490_2351009_-	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_000671737.1|2351286_2351679_+	TIGR00156 family protein	NA	NA	NA	NA	NA
WP_000901367.1|2353818_2353914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072651383.1|2354112_2355036_+|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	2.4e-171
>prophage 7
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	2452808	2522740	4670066	transposase	Escherichia_phage(18.75%)	60	NA	NA
WP_100881881.1|2452808_2453900_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000939263.1|2456131_2456614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108933417.1|2456597_2460821_-	RHS element protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.8	2.6e-23
WP_108933419.1|2460887_2462996_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	2.4e-25
WP_000226995.1|2463815_2464028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000598857.1|2464880_2465498_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_001300590.1|2465764_2467264_+	L-asparagine permease	NA	NA	NA	NA	NA
WP_000550695.1|2467376_2468438_-	YncE family protein	NA	NA	NA	NA	NA
WP_072095361.1|2468520_2468646_+	tonB-dependent receptor yncD	NA	NA	NA	NA	NA
WP_071524874.1|2468585_2468765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000689363.1|2468679_2470782_+	TonB-dependent siderophore receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
WP_001299369.1|2470817_2471483_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000531453.1|2471680_2472718_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001351727.1|2472897_2473416_+	L-amino acid N-acyltransferase MnaT	NA	NA	NA	NA	NA
WP_001076535.1|2473412_2473862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018633.1|2473862_2474096_-	DUF2526 domain-containing protein	NA	NA	NA	NA	NA
WP_000148775.1|2474181_2474403_-	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_065189873.1|2474373_2474553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303494.1|2474549_2474645_+	stress response membrane protein YncL	NA	NA	NA	NA	NA
WP_001163875.1|2474741_2476166_-	gamma-aminobutyraldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_071447910.1|2476187_2476982_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001251313.1|2476971_2477913_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000220399.1|2477913_2478927_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	55.4	1.1e-25
WP_000047424.1|2478944_2480090_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000760585.1|2480334_2481741_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001270286.1|2481819_2482236_-	antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000813794.1|2482281_2482458_-	mRNA interferase HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_000494244.1|2482679_2482910_+	DUF2554 domain-containing protein	NA	NA	NA	NA	NA
WP_071447912.1|2483001_2484963_-	U32 family peptidase	NA	Q6DW11	Phage_TP	28.3	2.7e-23
WP_000429133.1|2485035_2485572_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_076751422.1|2485624_2486839_+	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_077252248.1|2486878_2488087_-|transposase	transposase	transposase	A0A077SL42	Escherichia_phage	92.8	4.6e-207
WP_001342382.1|2488156_2488279_+|transposase	transposase	transposase	A0A1S5RHE3	Helicobacter_phage	55.0	3.8e-05
WP_108933421.1|2488279_2488558_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	64.6	1.9e-23
WP_001261013.1|2488618_2489287_-	lipoprotein	NA	NA	NA	NA	NA
WP_000587030.1|2489589_2490183_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001300478.1|2490179_2491172_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001234023.1|2491295_2492276_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000140873.1|2492267_2492807_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|2492869_2493094_-	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_001303281.1|2493109_2493313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000375956.1|2493233_2494889_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_000013741.1|2495113_2496457_-	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_000414567.1|2496673_2497597_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001098559.1|2497634_2499275_-	methyl-accepting chemotaxis protein III	NA	NA	NA	NA	NA
WP_001309484.1|2499673_2499823_+	type I toxin-antitoxin system hok family toxin	NA	NA	NA	NA	NA
WP_000731833.1|2499894_2500068_-	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_000428998.1|2500312_2500843_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000048679.1|2501031_2502033_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115937.1|2502074_2503514_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027942.1|2503710_2504511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139565.1|2504782_2508685_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048951.1|2508885_2509491_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_001400307.1|2509541_2510834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|2513448_2514153_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|2514394_2515255_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_032623598.1|2515663_2517394_+	peptidoglycan synthetase FtsI	NA	NA	NA	NA	NA
WP_012477595.1|2517458_2518316_+	class A beta-lactamase LAP-2	NA	Q1MVP3	Enterobacteria_phage	61.1	2.0e-92
WP_001516695.1|2519912_2520569_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|2521348_2522740_-|transposase	ISKra4 family transposase ISKpn19	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	2768733	2774845	4670066		Enterobacteria_phage(50.0%)	8	NA	NA
WP_001295666.1|2768733_2769057_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_000539894.1|2769159_2769312_-	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.0	1.4e-20
WP_063091313.1|2771172_2771391_-	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	81.4	3.6e-14
WP_001291105.1|2771383_2772175_-	transcriptional regulator	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001328753.1|2772092_2772374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097895.1|2772312_2773770_-	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001228696.1|2773966_2774152_-	Spanin from lambdoid prophage Rac, outer membrane subunit	NA	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_032217964.1|2774368_2774845_-	lysozyme	NA	K7PKV2	Enterobacteria_phage	96.8	1.7e-85
>prophage 9
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	3064206	3127209	4670066	tail,tRNA,integrase,protease	Salmonella_phage(28.57%)	60	3057169:3057184	3130154:3130169
3057169:3057184	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_000886683.1|3064206_3065499_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067755.1|3065589_3066933_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3066943_3067555_-	outer membrane lipoprotein carrier protein LolA	NA	NA	NA	NA	NA
WP_000077052.1|3067709_3071738_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3071872_3072367_-	leucine-responsive regulatory protein	NA	NA	NA	NA	NA
WP_000537418.1|3072911_3073877_+	thioredoxin reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_071447862.1|3073999_3075766_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	F2Y302	Organic_Lake_phycodnavirus	28.3	9.2e-15
WP_001202201.1|3075766_3077488_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	4.9e-21
WP_001241677.1|3077529_3078234_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3078518_3078737_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_072643430.1|3079410_3079686_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000934034.1|3079600_3081877_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.1e-166
WP_000520781.1|3081907_3082228_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_001351689.1|3082550_3082775_+	cold shock domain protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188180.1|3082847_3084794_-	macrolide ABC transporter permease/ATP-binding protein MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|3084790_3085906_-	MacA family efflux pump subunit	NA	NA	NA	NA	NA
WP_000241049.1|3086020_3087013_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_063501685.1|3087009_3088668_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001298299.1|3089093_3089789_+	aquaporin	NA	NA	NA	NA	NA
WP_000491142.1|3090283_3091183_+	transporter	NA	NA	NA	NA	NA
WP_000458809.1|3091326_3092979_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|3092990_3093959_+	hybrid-cluster NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|3094091_3095810_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_071447793.1|3095846_3096848_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_071447794.1|3096858_3098289_+	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_001338420.1|3098387_3099401_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001255167.1|3099397_3100228_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|3100224_3100548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270734.1|3100673_3101189_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|3101406_3102135_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|3102152_3102884_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|3102890_3103607_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|3103606_3104275_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295339.1|3104565_3105297_+	ABC transporter arginine-binding protein 1	NA	NA	NA	NA	NA
WP_001149756.1|3105495_3106623_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|3106663_3107152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063501849.1|3107211_3108057_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|3108053_3109007_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|3109016_3110150_-	putrescine transport ATP-binding protein PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126073.1|3110244_3111357_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001303977.1|3111340_3111502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000203025.1|3111707_3112184_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|3112271_3113174_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_023149811.1|3113234_3113957_-	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_001201560.1|3113940_3114228_-	DUF1418 domain-containing protein	NA	NA	NA	NA	NA
WP_001195240.1|3114387_3114645_+	glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_000681108.1|3114674_3115052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024876.1|3115321_3117007_+	transporter	NA	NA	NA	NA	NA
WP_000972391.1|3117242_3117461_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_076751408.1|3117551_3118652_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.3	3.8e-176
WP_071447925.1|3118648_3119134_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_071447924.1|3119130_3122208_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.3	0.0e+00
WP_000763311.1|3122200_3122320_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_071447923.1|3122334_3122637_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	1.2e-39
WP_064503040.1|3123985_3124282_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460893.1|3124289_3124799_-	hypothetical protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000188450.1|3124863_3125067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346406.1|3125212_3125782_+	hypothetical protein	NA	A0A1S6KZZ7	Salmonella_phage	41.9	3.2e-38
WP_000900883.1|3125797_3125989_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_000290952.1|3126177_3127209_+|integrase	integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	9.5e-105
3130154:3130169	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 10
NZ_CP019213	Escherichia coli strain WCHEC050613 chromosome, complete genome	4670066	3666064	3717577	4670066	holin,integrase,transposase	Shigella_phage(45.0%)	53	3703337:3703392	3713666:3713721
WP_000131044.1|3666064_3668098_-|holin	choline transporter	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_071525187.1|3668094_3668310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001335745.1|3668226_3668814_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000089110.1|3668827_3670300_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3670313_3671984_+|holin	oxygen-dependent choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3672196_3672865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001340870.1|3672836_3673034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323769.1|3672940_3673153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000370307.1|3673107_3673803_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3673795_3675223_-	ferredoxin-like LutB family protein; electron transport chain YkgEFG component	NA	NA	NA	NA	NA
WP_001102108.1|3675233_3675953_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339594.1|3676479_3677334_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001046307.1|3677559_3678885_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474084.1|3678993_3679230_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001299021.1|3679241_3679835_+	protein RclC	NA	NA	NA	NA	NA
WP_001268213.1|3680391_3681276_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000662258.1|3687360_3687462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3687825_3688089_+	50S ribosomal protein L31 type B	NA	NA	NA	NA	NA
WP_000866436.1|3688088_3688229_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3688263_3688491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323481.1|3688552_3688732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076751399.1|3689266_3689857_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000730972.1|3689931_3690519_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3690576_3691245_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_071447808.1|3691270_3693796_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001310578.1|3693785_3695429_+	fimbria adhesin EcpD	NA	NA	NA	NA	NA
WP_001350485.1|3695397_3696108_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3696420_3696750_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001323476.1|3696744_3696924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296889.1|3697722_3697848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071447809.1|3698027_3698717_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643332.1|3698713_3699670_+	xanthine dehydrogenase	NA	NA	NA	NA	NA
WP_063501779.1|3699666_3701865_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	A0A0P0I429	Acinetobacter_phage	25.5	9.6e-38
WP_000121346.1|3701874_3702831_+	XdhC family protein	NA	NA	NA	NA	NA
WP_001111348.1|3702809_3703220_+	hypothetical protein	NA	NA	NA	NA	NA
3703337:3703392	attL	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000901952.1|3703457_3703610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001118618.1|3704135_3705059_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_077252259.1|3705173_3706193_-	acyltransferase	NA	NA	NA	NA	NA
WP_072651383.1|3706534_3707458_-|transposase	IS5 family transposase	transposase	Q1MVF0	Enterobacteria_phage	96.4	2.4e-171
WP_071447957.1|3707520_3707967_-	hypothetical protein	NA	U5P096	Shigella_phage	100.0	8.6e-79
WP_076751398.1|3707885_3708230_-	hypothetical protein	NA	U5P0J5	Shigella_phage	96.5	5.3e-60
WP_029379673.1|3708138_3708363_-	hypothetical protein	NA	A0A291AWX8	Escherichia_phage	63.1	3.2e-13
WP_000135682.1|3708435_3708798_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3708863_3709688_+	DUF2303 domain-containing protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3709815_3710352_+	HD family hydrolase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_001242749.1|3710342_3710705_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_071447956.1|3710704_3710989_+	hypothetical protein	NA	U5P0J0	Shigella_phage	95.7	3.4e-44
WP_085947771.1|3711002_3712165_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000433939.1|3712270_3712621_+	DNA-binding protein	NA	U5P4J3	Shigella_phage	100.0	4.9e-61
WP_077252162.1|3712722_3713661_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	99.4	1.8e-182
WP_063091315.1|3713865_3715119_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	7.5e-96
3713666:3713721	attR	TTGATTTTAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3715130_3716234_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749863.1|3716521_3717577_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
>prophage 1
NZ_CP019214	Escherichia coli strain WCHEC050613 plasmid pMCR_WCHEC050613, complete sequence	289112	59734	203661	289112	transposase,integrase	Escherichia_phage(32.0%)	147	172984:173003	191680:191699
WP_012478345.1|59734_60709_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_049589868.1|60904_62530_+	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_077248209.1|62577_63324_+	PAP2 family protein	NA	NA	NA	NA	NA
WP_001805195.1|63349_63694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000795947.1|63715_64891_-	recombinase	NA	NA	NA	NA	NA
WP_001285422.1|65061_65274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001232449.1|65634_66717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284313.1|66883_68383_-	kinase	NA	NA	NA	NA	NA
WP_000081622.1|68408_70046_-	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001253653.1|70045_71086_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001253658.1|71171_71810_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_000116681.1|71809_72451_-	tellurium resistance protein TerX	NA	NA	NA	NA	NA
WP_001388628.1|72473_73112_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_001176767.1|73574_74042_-	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000506887.1|74059_75268_-	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000797366.1|75278_76235_-	citrate lyase subunit beta	NA	NA	NA	NA	NA
WP_042634304.1|76234_77314_-	hypothetical protein	NA	A0A172Q0S8	Acinetobacter_phage	34.1	2.8e-38
WP_001040059.1|77315_78089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285478.1|78081_79224_-	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	35.4	1.7e-30
WP_001035162.1|79233_80292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042634303.1|80615_81197_+	tellurium resistance protein TerZ	NA	K4JRX3	Caulobacter_phage	30.0	6.3e-13
WP_001054787.1|81196_82354_+	tellurium resistance protein TerA	NA	NA	NA	NA	NA
WP_000007448.1|82376_82832_+	Tellurite resistance protein TerB	NA	NA	NA	NA	NA
WP_062914744.1|82854_83895_+	TerC family protein	NA	K7QKE8	Escherichia_phage	48.0	2.2e-77
WP_000116677.1|83943_84522_+	chemical-damaging agent resistance protein C	NA	A0A2P1N0L4	Streptomyces_phage	40.0	3.3e-06
WP_000301242.1|84589_85165_+	TerD family protein	NA	K4JRX3	Caulobacter_phage	41.6	8.7e-31
WP_001053338.1|85593_86835_+	tellurium resistance protein TerF	NA	NA	NA	NA	NA
WP_000077926.1|87397_87679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000398480.1|87728_87920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001371937.1|88011_88383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000341066.1|88725_89118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624349.1|89096_89408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136327.1|89721_90015_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_000088046.1|90019_91345_+	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_000134171.1|91405_91612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985911.1|91713_92124_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053276223.1|92136_92952_+	HNH endonuclease	NA	G0X580	Salmonella_phage	35.4	1.9e-15
WP_001043843.1|93205_93631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001224687.1|94179_94488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000784387.1|94503_95361_+	HNH endonuclease	NA	G0X580	Salmonella_phage	34.2	3.9e-11
WP_071940961.1|95422_95671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077250418.1|96209_96635_-	DUF4158 domain-containing protein	NA	A0A1B0V7H9	Salmonella_phage	47.2	7.6e-08
WP_063120614.1|97334_98468_-	permease	NA	NA	NA	NA	NA
WP_001175593.1|98573_98897_+	ArsR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|99439_100144_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001317540.1|100243_100960_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	2.4e-139
WP_001389365.1|101127_101892_+|transposase	IS6 family transposase IS6100	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_001336397.1|102082_102439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001137892.1|102384_102969_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000004159.1|102968_104207_-	MFS transporter	NA	NA	NA	NA	NA
WP_000219391.1|104203_105109_-	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_001067855.1|105230_105935_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071525219.1|105925_106114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105383.1|106201_107638_+	glutathione synthase	NA	NA	NA	NA	NA
WP_000427623.1|108055_109060_+|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
WP_032193599.1|109484_110189_-	RepB family plasmid replication initiator protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_001067855.1|110218_110923_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000090707.1|111841_112684_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000351437.1|112670_114794_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001049180.1|114793_116242_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001324699.1|116282_117839_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000262423.1|117850_118777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001097216.1|119129_119429_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_001239419.1|119992_121819_+	hypothetical protein	NA	E5E3R2	Burkholderia_phage	22.8	4.7e-14
WP_000647571.1|121987_122338_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	50.5	1.8e-18
WP_000790485.1|122485_122917_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000555736.1|123161_124643_-	Cu(+)/Ag(+) sensor histidine kinase	NA	W8CYF6	Bacillus_phage	30.1	1.8e-27
WP_000697968.1|124635_125316_-	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	36.0	2.7e-31
WP_000475507.1|125505_126891_+	Cu(I)/Ag(I) efflux RND transporter outer membrane protein	NA	NA	NA	NA	NA
WP_001246155.1|126918_127272_+	copper ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001381488.1|127385_128678_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_020219104.1|128688_131835_+	CusA/CzcA family heavy metal efflux RND transporter	NA	S5VTK5	Leptospira_phage	22.4	2.1e-62
WP_000758229.1|131921_132362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023138591.1|132489_134937_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	35.4	2.9e-83
WP_000843494.1|134977_135175_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_000287501.1|135208_135946_-	peptidase	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_001023257.1|136234_136684_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925240.1|136918_138736_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001242438.1|138735_139632_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_020219105.1|139671_140052_+	copper resistance system chaperone PcoC	NA	NA	NA	NA	NA
WP_000998778.1|140056_140986_+	copper resistance protein D	NA	NA	NA	NA	NA
WP_001188930.1|141040_141721_+	DNA-binding response regulator	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_001211180.1|141717_143118_+	sensor histidine kinase	NA	W8CYF6	Bacillus_phage	26.6	3.2e-18
WP_000723069.1|143335_143770_+	copper-binding protein	NA	NA	NA	NA	NA
WP_000193209.1|144147_144966_+	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_001572381.1|144962_146168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000121165.1|146231_146435_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000078514.1|146447_147767_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
WP_000833382.1|148017_149445_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	52.3	3.4e-100
WP_001572389.1|149659_150175_+	thermonuclease family protein	NA	A0A1X6WF84	Pacmanvirus	38.6	2.1e-07
WP_000975182.1|150177_151074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015059496.1|151295_151529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046767.1|151574_151829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136338.1|151866_152154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001572393.1|152190_152421_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000185304.1|152757_153219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074418.1|153248_153656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029698059.1|153706_154024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031613424.1|154400_154751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|156440_157145_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001617865.1|157447_158323_+	class A extended-spectrum beta-lactamase CTX-M-14	NA	A0A1B0VBP7	Salmonella_phage	99.6	6.1e-153
WP_014839980.1|158934_159351_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|159355_159874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071448054.1|159873_160620_-	winged helix family transcriptional regulator	NA	NA	NA	NA	NA
WP_001067855.1|160625_161330_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|161443_162220_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000171321.1|162240_162462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602738.1|163770_164523_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_006581703.1|166333_166819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085940648.1|167015_168106_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|168195_169011_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|169097_169400_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|169293_169545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|170469_171174_+|transposase	IS6 family transposase IS1006	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_065800308.1|171258_171648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000427623.1|171912_172917_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
172984:173003	attL	AAATAAAGCACGCTAAGCCG	NA	NA	NA	NA
WP_015344976.1|172995_175947_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
WP_000147567.1|175949_176510_-|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_077249112.1|176635_177250_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845039.1|177188_178202_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001083725.1|178346_178844_+	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001336345.1|178955_179246_+	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001206356.1|179251_180043_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|180304_181564_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|181656_182448_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|182617_182950_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_072078461.1|183089_183275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|184129_184921_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_012478345.1|185400_186375_+|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_001354008.1|186461_186707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000612791.1|186744_187608_-	KR domain-containing protein	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067855.1|187838_188543_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001118618.1|189042_189966_+|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	4.9e-177
WP_001067855.1|190764_191469_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000376616.1|191693_191897_-	hypothetical protein	NA	NA	NA	NA	NA
191680:191699	attR	CGGCTTAGCGTGCTTTATTT	NA	NA	NA	NA
WP_001993321.1|191915_192095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|192024_192864_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_072644484.1|193044_193209_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|194599_195304_+|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077249982.1|195249_195429_-	hypothetical protein	NA	Q1MVP5	Enterobacteria_phage	85.7	7.3e-05
WP_063102497.1|195497_195884_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_057109146.1|196203_196596_-	NimC/NimA family protein	NA	NA	NA	NA	NA
WP_001067855.1|196930_197635_-|transposase	IS6 family transposase IS15DIV	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063865358.1|197954_199130_+	multidrug efflux RND transporter periplasmic adaptor subunit OqxA2	NA	NA	NA	NA	NA
WP_032495443.1|199153_202306_+	multidrug efflux RND transporter permease subunit OqxB2	NA	NA	NA	NA	NA
WP_000888203.1|202375_202855_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|202956_203661_-|transposase	IS6 family transposase IS15DI	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
>prophage 1
NZ_CP019216	Escherichia coli strain WCHEC050613 plasmid pP_WCHEC050613, complete sequence	78444	0	75861	78444	transposase	Escherichia_phage(60.87%)	58	NA	NA
WP_071595478.1|2337_2469_-	replication protein RepA4	NA	NA	NA	NA	NA
WP_001139206.1|2721_2973_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000222771.1|2969_3257_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	50.5	4.5e-20
WP_000896262.1|3546_3747_-	DUF839 domain-containing protein	NA	NA	NA	NA	NA
WP_071447849.1|4116_7650_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	36.8	3.2e-99
WP_085947771.1|10593_11756_-|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000224043.1|11875_12316_+	hypothetical protein	NA	A0A077SLF0	Escherichia_phage	100.0	1.7e-79
WP_000747845.1|12312_12561_+	hypothetical protein	NA	Q71TG0	Escherichia_phage	98.8	4.0e-41
WP_071447930.1|12597_13725_-	GTP pyrophosphokinase	NA	A0A1B0VBT5	Salmonella_phage	74.4	2.0e-156
WP_001351995.1|13827_14469_-	hypothetical protein	NA	A0A077SK30	Escherichia_phage	95.8	2.3e-109
WP_000207077.1|14624_15374_-	DUF4145 domain-containing protein	NA	A0A1S6L018	Salmonella_phage	49.0	1.3e-66
WP_000848370.1|15460_16021_-	recombinase	NA	Q5QBN4	Enterobacteria_phage	95.7	2.8e-95
WP_001224232.1|16266_16578_-	hypothetical protein	NA	A0A077SK03	Escherichia_phage	97.1	8.8e-46
WP_001323889.1|16814_18392_-	PAS domain S-box protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001161490.1|18701_19262_+|transposase	transposase	transposase	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|19265_22232_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000067537.1|22273_23305_-	Recombinase cre	NA	A0A077SLE7	Escherichia_phage	99.1	1.9e-193
WP_000542338.1|23312_23534_-	hypothetical protein	NA	Q5QBN7	Enterobacteria_phage	97.3	4.2e-34
WP_001312283.1|23945_24059_+	hypothetical protein	NA	Q5XLQ7	Enterobacteria_phage	100.0	3.2e-14
WP_012817944.1|24077_24173_+	hypothetical protein	NA	Q38402	Escherichia_phage	100.0	2.8e-11
WP_000874156.1|24138_24348_+	hypothetical protein	NA	A0A077SK26	Escherichia_phage	100.0	1.8e-31
WP_000611661.1|24458_25310_+	hypothetical protein	NA	A0A077SLM8	Escherichia_phage	99.3	1.0e-157
WP_001351993.1|25342_25654_-	phage antirepressor Ant	NA	A0A077SLR9	Escherichia_phage	98.0	2.9e-49
WP_069067567.1|25956_27000_-	DUF968 domain-containing protein	NA	A0A077SLM1	Escherichia_phage	98.6	1.5e-203
WP_000113018.1|27027_27207_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	98.3	1.2e-23
WP_001216039.1|27211_27592_-	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	99.2	9.7e-63
WP_001190711.1|27591_27813_-	type II toxin-antitoxin system prevent-host-death family antitoxin	NA	A0A222YXU1	Escherichia_phage	98.6	3.3e-31
WP_069067570.1|29190_30453_-	hypothetical protein	NA	Q1MVG4	Enterobacteria_phage	99.0	3.9e-233
WP_000269655.1|30454_30673_-	hypothetical protein	NA	Q71TI9	Escherichia_phage	98.6	2.9e-35
WP_000684873.1|30754_31456_-	hypothetical protein	NA	A0A077SLK3	Escherichia_phage	97.4	4.3e-141
WP_000578338.1|32419_33154_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_076751476.1|34161_37635_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_001351999.1|40763_42914_-	cellulose synthase regulator BcsB	NA	NA	NA	NA	NA
WP_001352000.1|42977_45083_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_072779029.1|45907_47083_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_089586239.1|50464_50818_+	hypothetical protein	NA	A0A1B0V830	Salmonella_phage	94.9	2.0e-38
WP_000007763.1|50857_51280_+	hypothetical protein	NA	Q71TL5	Escherichia_phage	97.1	9.4e-59
WP_001281115.1|51455_51848_+	hypothetical protein	NA	A0A077SLJ1	Escherichia_phage	97.7	7.6e-71
WP_001113742.1|52183_53068_+	RepB family plasmid replication initiator protein	NA	A0A077SLP3	Escherichia_phage	100.0	2.1e-161
WP_001154682.1|53360_54170_+	hypothetical protein	NA	A0A077SK46	Escherichia_phage	97.8	1.6e-155
WP_001285362.1|54338_55535_+	ParA family protein	NA	A0A077SL49	Escherichia_phage	100.0	1.6e-225
WP_000038866.1|55551_56553_+	ParB/RepB/Spo0J family partition protein	NA	Q38420	Escherichia_phage	100.0	1.7e-178
WP_000067707.1|56778_58485_+	hypothetical protein	NA	Q71TM1	Escherichia_phage	99.8	0.0e+00
WP_088177441.1|58900_60173_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.7	2.8e-170
WP_000459149.1|60198_61470_+	hypothetical protein	NA	A0A1B0V7E4	Salmonella_phage	97.9	3.0e-241
WP_000041770.1|61479_62295_+	hypothetical protein	NA	A0A1B0V835	Salmonella_phage	94.8	3.0e-109
WP_000035250.1|62330_62912_+	hypothetical protein	NA	Q71TM4	Escherichia_phage	96.9	1.8e-100
WP_000509940.1|62923_63433_+	hypothetical protein	NA	Q1MVJ9	Enterobacteria_phage	99.4	6.6e-91
WP_001300563.1|63592_64705_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001352007.1|64898_65054_-	type I toxin-antitoxin system hok family toxin	NA	A0A1I9LJU7	Stx_converting_phage	90.2	4.0e-15
WP_088172348.1|65517_66730_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.0	5.1e-166
WP_032187874.1|66696_66894_+	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.5e-06
WP_000794336.1|69235_70108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352013.1|70283_70748_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_108933436.1|70890_71588_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	94.0	5.1e-126
WP_000937735.1|71725_71917_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.2	2.4e-06
WP_077250047.1|72280_73654_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_108933438.1|75163_75861_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	92.7	3.3e-125
