The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	979200	1005779	4916040	protease,plate	uncultured_Mediterranean_phage(33.33%)	24	NA	NA
WP_000520789.1|979200_979521_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	4.5e-13
WP_000934064.1|979551_981828_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.3	6.2e-165
WP_052318438.1|982325_982856_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001659428.1|982824_983592_-	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_078054916.1|984774_985494_-	immunity 52 family protein	NA	NA	NA	NA	NA
WP_023219434.1|985496_986252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023219435.1|986245_986596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_176146312.1|986697_987201_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_076741492.1|987678_988740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076741493.1|988736_989762_-	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_023219440.1|989951_990623_-	DUF2931 family protein	NA	NA	NA	NA	NA
WP_076741494.1|990619_992527_-	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_001659436.1|992550_992787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001659437.1|992797_994057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076741495.1|994074_996036_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	23.7	1.0e-22
WP_039591387.1|996257_996776_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_039591385.1|997357_997855_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_076741496.1|997875_999351_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001659444.1|999356_999782_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_076741497.1|999787_1001623_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_039591390.1|1001589_1002624_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_076741498.1|1002628_1003918_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001659451.1|1003914_1004433_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_061380303.1|1004435_1005779_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 2
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	1866443	1966398	4916040	lysis,transposase,plate,head,protease,tRNA,tail,integrase	Salmonella_phage(16.67%)	113	1907704:1907726	1966529:1966551
WP_001221017.1|1866443_1867139_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_023209838.1|1867196_1869107_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.7	5.9e-92
WP_000029550.1|1869237_1869582_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|1869587_1869767_-	YoaH family protein	NA	NA	NA	NA	NA
WP_076741594.1|1869847_1871212_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.8	7.3e-44
WP_000381544.1|1871215_1871794_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_000624281.1|1872057_1873422_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_001192519.1|1873559_1875161_+	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_000421820.1|1875182_1876742_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.4	9.5e-40
WP_000150521.1|1877214_1878183_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_000406918.1|1878235_1879036_+	PTS mannose transporter subunit IIC	NA	NA	NA	NA	NA
WP_001518647.1|1879048_1879900_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_000156280.1|1879957_1880416_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_001518359.1|1880825_1881392_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_000010923.1|1881388_1882198_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_000730326.1|1882263_1884009_-	peptidoglycan glycosyltransferase FtsI	NA	NA	NA	NA	NA
WP_001062678.1|1884228_1884438_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
WP_001537930.1|1884450_1884594_-	YobF family protein	NA	NA	NA	NA	NA
WP_001000660.1|1885242_1885530_-	YebO family protein	NA	NA	NA	NA	NA
WP_000714547.1|1885600_1885744_-	PhoP/PhoQ regulator MgrB	NA	NA	NA	NA	NA
WP_001236777.1|1885901_1886141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001262195.1|1886352_1887144_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_000416131.1|1887319_1888693_+	MFS transporter	NA	NA	NA	NA	NA
WP_000502119.1|1888800_1889259_-|transposase	IS200/IS605-like element IS200F family transposase	transposase	NA	NA	NA	NA
WP_000984498.1|1889451_1890333_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001091237.1|1890525_1892574_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	8.0e-87
WP_000431401.1|1892593_1893280_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001518229.1|1893377_1893875_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207294.1|1894003_1895287_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001529852.1|1895255_1897889_+	PqiB family protein	NA	NA	NA	NA	NA
WP_001670762.1|1897966_1899406_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131167.1|1899523_1899760_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457836.1|1899870_1900062_+	YebW family protein	NA	NA	NA	NA	NA
WP_000986176.1|1900080_1900731_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.1e-58
WP_001134856.1|1900954_1901119_-	membrane protein	NA	NA	NA	NA	NA
WP_023240423.1|1901403_1902126_-	SPI-1 type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000422879.1|1902809_1903205_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	33.1	1.6e-15
WP_000030945.1|1903532_1904009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354407.1|1904381_1904801_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001752421.1|1905170_1905440_+	hypothetical protein	NA	Q6UAV5	Klebsiella_phage	39.0	1.5e-06
WP_001617922.1|1905605_1905746_+	hypothetical protein	NA	NA	NA	NA	NA
1907704:1907726	attL	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
WP_001233445.1|1908872_1909787_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000480735.1|1909919_1910078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000848069.1|1910087_1910702_+	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001520350.1|1911189_1911336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001652642.1|1911849_1911975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010989029.1|1912544_1912745_+	phage virulence factor PagK family protein	NA	NA	NA	NA	NA
WP_000275418.1|1912841_1913723_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	76.0	2.2e-65
WP_000789530.1|1914448_1914616_+	lytic enzyme	NA	NA	NA	NA	NA
WP_001050883.1|1914872_1915406_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	43.0	5.4e-11
WP_076741595.1|1915720_1916827_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	Q9QF34	Lambdoid_phage	64.4	1.2e-52
WP_076741596.1|1916823_1917903_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	52.2	3.3e-100
WP_076741598.1|1918685_1920227_+	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_000207938.1|1920295_1921150_-	protein YibB	NA	NA	NA	NA	NA
WP_076741599.1|1921299_1921869_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	89.4	9.9e-96
WP_076741600.1|1921868_1923320_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	70.2	7.3e-42
WP_076741601.1|1923309_1923912_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	38.4	2.8e-32
WP_001293657.1|1923913_1925155_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	1.2e-101
WP_001191860.1|1925151_1925508_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	48.1	3.6e-19
WP_058679902.1|1925520_1926198_-	hypothetical protein	NA	A0A077KAY0	Edwardsiella_phage	36.0	1.2e-31
WP_000122817.1|1926178_1927048_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.7	5.3e-32
WP_000890115.1|1927044_1927347_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_023219641.1|1927346_1928057_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	6.5e-28
WP_058215126.1|1928053_1930225_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	67.1	1.4e-49
WP_000228830.1|1930208_1930391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058116333.1|1930432_1930837_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	45.7	4.8e-20
WP_000016414.1|1930836_1931283_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	40.4	4.8e-21
WP_076741602.1|1931283_1932768_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	40.6	1.5e-95
WP_076741603.1|1932748_1933294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001048637.1|1933278_1933644_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	40.5	3.0e-21
WP_076741604.1|1933640_1934225_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.6	5.5e-17
WP_076741605.1|1934218_1934674_-	DUF4054 domain-containing protein	NA	H9C0W0	Aeromonas_phage	45.3	9.6e-17
WP_076741606.1|1934680_1935028_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	38.1	1.9e-09
WP_076741607.1|1935031_1936060_-	DUF2184 domain-containing protein	NA	A0A219YBB0	Aeromonas_phage	48.7	1.7e-82
WP_001091405.1|1936059_1936542_-	hypothetical protein	NA	A0A1X9SFC3	Acinetobacter_phage	49.4	3.2e-26
WP_076741608.1|1936543_1937890_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	37.4	2.5e-68
WP_023209775.1|1937886_1938576_-|head	phage head morphogenesis protein	head	A0A077KGU5	Edwardsiella_phage	46.7	7.6e-50
WP_076741609.1|1938616_1940137_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	43.9	2.4e-104
WP_076741610.1|1940136_1941756_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.2	2.5e-261
WP_076741611.1|1941758_1942388_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.6	3.3e-108
WP_001113128.1|1942458_1942641_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_076741612.1|1943048_1943564_-|lysis	lysis protein	lysis	Q56118	Enterobacteria_phage	77.6	6.1e-60
WP_164177434.1|1943565_1943703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076741613.1|1943931_1944471_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	71.2	7.5e-77
WP_076741614.1|1944737_1945142_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	97.0	1.8e-67
WP_000612626.1|1945138_1945486_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_076741615.1|1945534_1947073_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.8	1.3e-278
WP_052938913.1|1947731_1948268_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	3.5e-66
WP_000861020.1|1948264_1948546_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.1	1.7e-35
WP_058679884.1|1948733_1949171_-	recombination protein NinB	NA	G8C7V3	Escherichia_phage	68.8	5.2e-52
WP_001597144.1|1949747_1949903_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_000687976.1|1950106_1950379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000089419.1|1950375_1950771_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	4.4e-18
WP_076741616.1|1950788_1951541_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	76.1	1.1e-102
WP_076741617.1|1951547_1952417_-	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	6.9e-32
WP_076741618.1|1952461_1952956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072209360.1|1952952_1953210_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	48.1	3.2e-17
WP_071645512.1|1953314_1953704_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	47.9	7.9e-20
WP_072156734.1|1953871_1954027_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_058679873.1|1954462_1954705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613374.1|1955153_1955438_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	53.2	1.7e-08
WP_000799629.1|1955512_1955848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741620.1|1955988_1959018_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	44.2	1.8e-228
WP_000107767.1|1959030_1960125_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.9	2.9e-91
WP_076741621.1|1960160_1960481_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	61.6	3.6e-34
WP_000066251.1|1960473_1960806_+	hypothetical protein	NA	S4TNP2	Salmonella_phage	81.8	8.8e-20
WP_077946289.1|1960802_1961972_+	DUF550 domain-containing protein	NA	A0A1R3Y5Q8	Salmonella_virus	77.5	1.1e-85
WP_058679864.1|1961959_1962139_+	DUF1187 family protein	NA	NA	NA	NA	NA
WP_076741622.1|1962232_1962490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741623.1|1962486_1964580_+	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	51.5	1.8e-195
WP_057519946.1|1964576_1965005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603794.1|1965065_1965338_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	1.8e-10
WP_076741624.1|1965318_1966398_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	50.8	9.7e-100
1966529:1966551	attR	AAAAAGAGACCGAATACGATTCC	NA	NA	NA	NA
>prophage 3
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	2073272	2080520	4916040		Morganella_phage(33.33%)	8	NA	NA
WP_001157305.1|2073272_2074703_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	57.4	1.0e-104
WP_001659668.1|2074776_2075472_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	26.6	1.8e-06
WP_000107437.1|2075551_2075863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001080661.1|2076512_2077706_+	porin OmpS1	NA	Q1MVN1	Enterobacteria_phage	56.2	3.0e-110
WP_024131109.1|2077963_2078152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001659666.1|2078162_2078375_-	cold shock domain-containing protein	NA	A0A1W6JNX5	Morganella_phage	70.0	3.9e-21
WP_000457658.1|2078829_2080098_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	92.2	1.4e-227
WP_000394196.1|2080100_2080520_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	60.5	8.5e-36
>prophage 4
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	2178193	2187351	4916040		Paramecium_bursaria_Chlorella_virus(14.29%)	8	NA	NA
WP_001660385.1|2178193_2179360_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	53.5	3.1e-112
WP_000043532.1|2179595_2181002_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
WP_076741646.1|2181172_2182543_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.5	1.3e-32
WP_058107096.1|2182539_2183304_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	34.7	1.3e-10
WP_001606058.1|2183406_2184801_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.2	7.4e-60
WP_001606059.1|2184810_2185257_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001618438.1|2185266_2186229_-	GDP-L-fucose synthase	NA	M1I5W5	Acanthocystis_turfacea_Chlorella_virus	51.1	6.4e-87
WP_001660388.1|2186232_2187351_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.8	9.3e-130
>prophage 5
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	2192252	2200197	4916040		Enterobacteria_phage(33.33%)	6	NA	NA
WP_031605502.1|2192252_2193356_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	30.3	1.0e-40
WP_001660400.1|2194205_2195075_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.2e-109
WP_001660401.1|2195076_2196150_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.7	1.2e-102
WP_076741648.1|2196526_2197420_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	41.7	1.4e-43
WP_076741649.1|2197646_2198642_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	1.5e-09
WP_001660404.1|2198793_2200197_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	26.5	3.1e-21
>prophage 6
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	2268474	2277645	4916040	tRNA	Enterobacteria_phage(66.67%)	10	NA	NA
WP_000195330.1|2268474_2270508_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
WP_000703137.1|2270748_2271207_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	72.5	8.4e-53
WP_001197951.1|2271378_2271909_+	YehR family lipoprotein	NA	NA	NA	NA	NA
WP_000950413.1|2271965_2272433_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.3	3.9e-74
WP_000598637.1|2272479_2273199_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_076741656.1|2273195_2274881_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	91.1	1.4e-278
WP_001240417.1|2275103_2275835_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|2275894_2276002_+	protein YohO	NA	NA	NA	NA	NA
WP_000824854.1|2275982_2276714_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569166.1|2276697_2277645_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	31.2	1.7e-23
>prophage 7
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	2539736	2603556	4916040	lysis,plate,head,tail,terminase,tRNA,holin,capsid,integrase,portal	Enterobacteria_phage(58.54%)	75	2545758:2545773	2590481:2590496
WP_000695630.1|2539736_2541152_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000438882.1|2541966_2542851_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000658727.1|2542902_2543061_-	DUF1427 family protein	NA	NA	NA	NA	NA
WP_000513243.1|2543119_2544376_-	nucleoside permease	NA	NA	NA	NA	NA
WP_001119750.1|2544430_2545264_-	xanthosine phosphorylase	NA	NA	NA	NA	NA
WP_001660574.1|2545519_2546281_+	outer membrane protein	NA	NA	NA	NA	NA
2545758:2545773	attL	ACAATGGCCGCCACGC	NA	NA	NA	NA
WP_001660575.1|2546342_2547281_-	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	25.5	1.5e-08
WP_000765569.1|2547357_2548356_+	bile acid:sodium symporter	NA	NA	NA	NA	NA
WP_001519708.1|2548352_2548571_-	DUF3820 family protein	NA	NA	NA	NA	NA
WP_020437489.1|2548572_2550588_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.9	2.0e-146
WP_076741678.1|2550659_2551607_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000255006.1|2551838_2552600_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000036904.1|2552763_2553735_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	7.4e-75
WP_000487600.1|2554118_2554376_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_001660581.1|2554424_2556152_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_000522253.1|2556192_2556702_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000844541.1|2556851_2557091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000529613.1|2557087_2557954_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_001660582.1|2558036_2559329_+	transcriptional regulator PtsJ	NA	NA	NA	NA	NA
WP_001263753.1|2559343_2560063_+	GMP synthase	NA	NA	NA	NA	NA
WP_000710731.1|2560121_2560499_+	YfeK family protein	NA	NA	NA	NA	NA
WP_001093888.1|2560531_2561443_-	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	41.8	1.7e-57
WP_000021076.1|2561510_2562608_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	32.7	2.1e-25
WP_000852705.1|2562597_2563473_-	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_000881746.1|2563472_2564306_-	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_001660584.1|2564305_2565322_-	thiosulfate/sulfate ABC transporter substrate-binding protein CysP	NA	NA	NA	NA	NA
WP_000517460.1|2565479_2566271_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.6	1.5e-17
WP_000084583.1|2566508_2567408_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	33.3	3.8e-25
WP_076741679.1|2567521_2568529_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7NQ69	Enterobacteria_phage	75.8	2.1e-149
WP_076741680.1|2568592_2568889_-	helix-turn-helix transcriptional regulator	NA	A0A0A7NPW3	Enterobacteria_phage	64.1	8.7e-27
WP_076741681.1|2569005_2569413_+	hypothetical protein	NA	A0A0A7NPS5	Enterobacteria_phage	61.7	9.4e-40
WP_076741682.1|2569664_2570063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024154181.1|2570134_2570377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058647275.1|2570382_2570586_+	LapA family protein	NA	NA	NA	NA	NA
WP_088137047.1|2570555_2570747_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741683.1|2570822_2571263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023207951.1|2571259_2571517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020844109.1|2571504_2572038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741684.1|2572034_2572274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741685.1|2572270_2573236_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1B2IH14	Erwinia_phage	42.8	1.2e-56
WP_078060660.1|2573229_2573733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741687.1|2573729_2574848_+	DNA cytosine methyltransferase	NA	A0A0M3ULA1	Salmonella_phage	65.1	5.1e-136
WP_076741688.1|2574844_2577349_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	47.3	3.5e-177
WP_076741689.1|2577341_2577752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045900642.1|2578591_2579641_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	73.4	3.3e-153
WP_045900644.1|2579640_2581374_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	75.1	1.7e-263
WP_000534194.1|2581530_2582367_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	65.5	5.7e-100
WP_076741691.1|2582390_2583476_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	68.4	9.9e-137
WP_023207937.1|2583522_2584353_+|terminase	terminase small subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	65.8	4.8e-91
WP_045900648.1|2584454_2584949_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	60.1	2.2e-51
WP_076741692.1|2584948_2585149_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	78.8	1.3e-21
WP_001658928.1|2585178_2585517_+|holin	phage holin, lambda family	holin	NA	NA	NA	NA
WP_058112086.1|2585513_2585957_+	lysozyme	NA	A0A075B8L0	Enterobacteria_phage	63.9	1.6e-45
WP_078060669.1|2585963_2586455_+|lysis	lysis protein	lysis	S4TNN7	Salmonella_phage	56.1	2.1e-33
WP_076741694.1|2586441_2586918_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	51.0	6.5e-40
WP_076741695.1|2586914_2587550_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	60.9	3.8e-64
WP_076741696.1|2587546_2588137_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	68.1	1.8e-68
WP_076741697.1|2588133_2588502_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	70.4	8.5e-40
WP_076741698.1|2588488_2589385_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	69.5	5.2e-107
WP_076741699.1|2589377_2589905_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	61.2	7.1e-56
WP_076741700.1|2589910_2591527_+|tail	phage tail protein	tail	A0A0M3ULF6	Salmonella_phage	69.3	7.0e-195
2590481:2590496	attR	ACAATGGCCGCCACGC	NA	NA	NA	NA
WP_076741701.1|2591523_2592348_+	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	96.0	5.2e-154
WP_076741702.1|2592337_2592913_+|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.8	3.3e-91
WP_076741703.1|2592953_2594096_-	lipopolysaccharide N-acetylglucosaminyltransferase	NA	NA	NA	NA	NA
WP_000980424.1|2594379_2594868_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.5	1.5e-71
WP_076741704.1|2594881_2597842_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	51.6	2.2e-255
WP_001627826.1|2597828_2597987_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	79.6	2.4e-15
WP_033904327.1|2597992_2598292_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	52.6	1.7e-17
WP_000115856.1|2598391_2598904_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.0	7.6e-63
WP_058111674.1|2598904_2600092_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	81.7	3.7e-185
WP_076741705.1|2600250_2601381_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	73.7	1.6e-150
WP_076741706.1|2601426_2601687_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_048590853.1|2601920_2602061_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	69.6	4.1e-11
WP_076741707.1|2602214_2602967_-	type VI secretion protein	NA	NA	NA	NA	NA
WP_076741708.1|2603415_2603556_+	Hok/Gef family protein	NA	S5M7Q0	Escherichia_phage	71.7	2.2e-12
>prophage 8
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	2844078	2853684	4916040	integrase	Enterobacteria_phage(66.67%)	11	2841449:2841464	2848892:2848907
2841449:2841464	attL	GCAGCAGGTGAAAGCG	NA	NA	NA	NA
WP_024792747.1|2844078_2845290_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.4	2.4e-107
WP_024792746.1|2845317_2846676_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	29.2	3.0e-21
WP_024792745.1|2847120_2847495_+	hypothetical protein	NA	B2ZY70	Ralstonia_phage	45.5	3.1e-13
WP_024792744.1|2847871_2848438_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	62.7	7.7e-56
WP_000984210.1|2848454_2848700_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	1.4e-30
WP_024792742.1|2848696_2849434_-	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	65.7	8.1e-82
2848892:2848907	attR	CGCTTTCACCTGCTGC	NA	NA	NA	NA
WP_003827209.1|2849974_2850241_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.0e-30
WP_024792741.1|2850237_2850795_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	60.3	2.7e-29
WP_024792740.1|2850791_2851019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024792739.1|2851015_2851336_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_024792738.1|2851350_2853684_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
>prophage 9
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	3312942	3369530	4916040	integrase,plate,head,tail,tRNA,terminase,holin,capsid,lysis,portal	Salmonella_phage(50.0%)	64	3310616:3310636	3360309:3360329
3310616:3310636	attL	CCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_076741773.1|3312942_3313956_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3314183_3314399_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918865.1|3314634_3316380_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	2.1e-72
WP_001519776.1|3316529_3318377_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_000237776.1|3318500_3319007_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000468307.1|3319366_3319585_-	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	98.6	9.5e-39
WP_050178744.1|3319651_3320821_-	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	97.4	1.9e-210
WP_000978861.1|3320817_3321303_-|tail	phage tail protein	tail	Q6K1G5	Salmonella_virus	100.0	1.0e-85
WP_057525168.1|3321317_3323759_-|tail	phage tail tape measure protein	tail	S4TP64	Salmonella_phage	90.4	0.0e+00
WP_086127217.1|3323751_3323907_-|tail	GpE family phage tail protein	tail	Q6K1G8	Salmonella_virus	96.1	2.6e-22
WP_001029727.1|3323903_3324239_-|tail	phage tail assembly protein	tail	A0A0M4S5P8	Salmonella_phage	100.0	1.8e-52
WP_001207675.1|3324301_3324820_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	100.0	6.5e-94
WP_050178742.1|3324835_3326023_-|tail	phage tail sheath protein	tail	Q6K1H0	Salmonella_virus	99.2	3.8e-222
WP_077945168.1|3326191_3326812_-|tail	tail fiber assembly protein	tail	A0A1B0VCD0	Salmonella_phage	96.4	1.3e-109
WP_057525184.1|3326781_3328875_-|tail	tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	93.8	2.6e-218
WP_023185411.1|3328885_3329416_-|tail	phage tail protein I	tail	A0A0M4R4W9	Salmonella_phage	99.4	9.2e-104
WP_024157126.1|3329408_3330317_-|plate	baseplate assembly protein	plate	S4TNY7	Salmonella_phage	98.7	2.0e-159
WP_024157127.1|3330323_3330671_-	GPW/gp25 family protein	NA	A0A0M4RE59	Salmonella_phage	100.0	1.9e-57
WP_001534860.1|3330667_3331309_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	99.1	1.6e-113
WP_001293096.1|3331377_3331827_-	phage virion morphogenesis protein	NA	S4TP59	Salmonella_phage	99.3	4.2e-73
WP_001169074.1|3331819_3332287_-|tail	phage tail protein	tail	S4TTA5	Salmonella_phage	100.0	1.1e-84
WP_001394645.1|3332249_3332423_-	hypothetical protein	NA	S4TNY4	Salmonella_phage	98.2	2.8e-25
WP_000866102.1|3332394_3332808_-|lysis	LysB family phage lysis regulatory protein	lysis	S4TRW3	Salmonella_phage	100.0	2.6e-45
WP_001144116.1|3332804_3333302_-	glycoside hydrolase family 104 protein	NA	S4TUB1	Salmonella_phage	99.4	1.2e-92
WP_000134660.1|3333288_3333585_-|holin	phage holin family protein	holin	Q6K1I2	Salmonella_virus	100.0	5.8e-47
WP_000868400.1|3333588_3333792_-|tail	tail protein X	tail	A0A0M3ULF4	Salmonella_phage	100.0	3.6e-32
WP_000214255.1|3333791_3334298_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	100.0	1.3e-91
WP_076741774.1|3334391_3335141_-|terminase	terminase endonuclease subunit	terminase	Q6K1I5	Salmonella_virus	98.8	1.8e-129
WP_001247243.1|3335144_3336212_-|capsid	phage major capsid protein, P2 family	capsid	A0A0M4R4W2	Salmonella_phage	99.7	1.2e-198
WP_076741775.1|3336288_3337143_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0M3UL81	Salmonella_phage	99.6	6.4e-147
WP_000156057.1|3337308_3339081_+|terminase	terminase ATPase subunit family protein	terminase	S4TT96	Salmonella_phage	99.8	0.0e+00
WP_057525165.1|3339077_3339824_+	hypothetical protein	NA	Q6K1I9	Salmonella_virus	97.2	2.3e-140
WP_057525164.1|3339820_3340843_+|portal	phage portal protein	portal	Q6K1J0	Salmonella_virus	99.4	1.6e-197
WP_010835158.1|3341244_3342324_+	hypothetical protein	NA	Q7Y4B3	Escherichia_virus	65.4	1.4e-130
WP_057525163.1|3342326_3343253_+	hypothetical protein	NA	Q7Y4B4	Escherichia_virus	54.2	1.8e-94
WP_010835156.1|3343255_3344191_-	DNA cytosine methyltransferase	NA	Q7Y4B5	Escherichia_virus	84.2	1.5e-160
WP_057525166.1|3344327_3344522_-	hypothetical protein	NA	A0A218M4I0	Erwinia_phage	81.1	1.5e-16
WP_076741776.1|3344639_3346856_-	replication endonuclease	NA	A0A218M4H2	Erwinia_phage	94.6	0.0e+00
WP_153259982.1|3346881_3347475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000752604.1|3347496_3347721_-	TraR/DksA family transcriptional regulator	NA	Q6K1F5	Salmonella_virus	100.0	6.5e-35
WP_001246237.1|3347720_3347948_-	DUF2732 domain-containing protein	NA	A0A0M3UL87	Salmonella_phage	100.0	6.8e-32
WP_000085639.1|3348017_3348218_-	hypothetical protein	NA	A0A0M5M7U3	Salmonella_phage	98.5	2.3e-31
WP_057525161.1|3348204_3348432_-	DUF2724 domain-containing protein	NA	A0A0M4RTI3	Salmonella_phage	96.0	1.7e-35
WP_057524527.1|3348439_3348949_-	phage regulatory CII family protein	NA	A0A0M4QWN1	Salmonella_phage	98.2	3.1e-88
WP_057524526.1|3348979_3349243_-	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	89.7	3.3e-38
WP_001217271.1|3349373_3349952_+	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	3.5e-64
WP_000218395.1|3349951_3350989_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	97.1	1.1e-198
WP_000213688.1|3351185_3351953_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_000983439.1|3352184_3352832_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000478471.1|3352828_3354394_-	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.9	1.7e-12
WP_000094645.1|3354781_3356302_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	47.8	8.4e-33
WP_001520281.1|3356731_3358111_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	29.0	2.9e-32
WP_023226575.1|3358281_3360300_+	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_000019985.1|3360380_3361517_-	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
3360309:3360329	attR	CCTGATGGCGCTGCGCTTATC	NA	NA	NA	NA
WP_000202966.1|3361602_3362100_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_000951045.1|3362251_3362944_+	vancomycin high temperature exclusion protein	NA	NA	NA	NA	NA
WP_064047046.1|3363032_3364031_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_001098837.1|3364302_3365271_+	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.9	2.2e-39
WP_000235363.1|3365525_3366770_+	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_000422141.1|3367219_3367882_+	DedA family protein	NA	NA	NA	NA	NA
WP_001661080.1|3367885_3368269_+	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_000877300.1|3368413_3368782_+	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_000031219.1|3368823_3369129_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000785626.1|3369131_3369530_+|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 10
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	3920786	3936148	4916040	integrase	Enterobacteria_phage(75.0%)	13	3920605:3920625	3930947:3930967
3920605:3920625	attL	ACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_076741830.1|3920786_3921959_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	88.9	8.1e-201
WP_071650858.1|3921989_3923849_+	DEAD/DEAH box helicase family protein	NA	Q9G0E6	Lactococcus_phage	25.4	1.0e-11
WP_054175046.1|3923845_3924268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023202907.1|3924648_3925215_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	65.4	7.9e-61
WP_000468231.1|3925230_3925470_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	59.3	2.4e-19
WP_023202908.1|3925473_3926217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556587.1|3926757_3927024_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_023202909.1|3927020_3927569_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	66.7	8.2e-31
WP_023202910.1|3927565_3927793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000743146.1|3927789_3928110_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_023202911.1|3928124_3930458_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.3	0.0e+00
WP_000984806.1|3932588_3933206_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
3930947:3930967	attR	ACTCCTGTGATCTTCCGCCAA	NA	NA	NA	NA
WP_076741832.1|3933280_3936148_+	intestinal colonization autotransporter adhesin MisL	NA	A0A2L1IV18	Escherichia_phage	44.1	1.9e-94
>prophage 11
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	4535771	4585898	4916040	integrase,transposase	Escherichia_phage(45.45%)	46	4532903:4532917	4590307:4590321
4532903:4532917	attL	CCTCAACAGATCGGC	NA	NA	NA	NA
WP_076741615.1|4535771_4537310_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	93.8	1.3e-278
WP_076741881.1|4539178_4539448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076741883.1|4539722_4540358_-	MarC family NAAT transporter	NA	NA	NA	NA	NA
WP_076741884.1|4540772_4541348_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	50.8	9.8e-51
WP_149866876.1|4541639_4542359_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076741886.1|4542355_4542823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741887.1|4543103_4543757_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	51.3	1.2e-49
WP_076741888.1|4545237_4545789_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076741889.1|4545835_4546363_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076741890.1|4546409_4547114_+	molecular chaperone	NA	NA	NA	NA	NA
WP_076741891.1|4547122_4549633_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_149866872.1|4549649_4550747_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_076741892.1|4550887_4551133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741893.1|4551132_4551864_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_076741894.1|4552524_4553064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_188317880.1|4553262_4553406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076741895.1|4554109_4555291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076741896.1|4556343_4557636_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.3	3.2e-73
WP_000550614.1|4557942_4558857_+	ParA family protein	NA	NA	NA	NA	NA
WP_000203356.1|4558853_4560221_+	replicative DNA helicase	NA	A0A077SK18	Escherichia_phage	54.4	1.0e-122
WP_000073295.1|4560217_4561933_+	ParB family protein	NA	NA	NA	NA	NA
WP_001287846.1|4561925_4562180_+	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_000005470.1|4562172_4562916_+	DUF2786 domain-containing protein	NA	NA	NA	NA	NA
WP_000077899.1|4563000_4563597_+	DUF2857 domain-containing protein	NA	NA	NA	NA	NA
WP_001178480.1|4563596_4563827_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	46.6	2.0e-07
WP_000154859.1|4563905_4565138_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000818555.1|4565479_4566202_+	TIGR03761 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_076741897.1|4566215_4568225_+	DNA topoisomerase III	NA	A0A1V0SCS0	Indivirus	23.2	7.2e-24
WP_000127558.1|4568853_4569345_+	DUF3577 domain-containing protein	NA	NA	NA	NA	NA
WP_000527984.1|4569417_4569621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000168256.1|4569638_4570190_+	single-stranded DNA-binding protein	NA	Q1MVN2	Enterobacteria_phage	62.2	7.2e-51
WP_001144085.1|4570268_4570511_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_000155614.1|4570494_4570743_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_076741898.1|4571009_4572359_+	TcpQ domain-containing protein	NA	NA	NA	NA	NA
WP_000540084.1|4572360_4572804_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_001137388.1|4572823_4574497_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_012219506.1|4574500_4575781_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_001252747.1|4575767_4576265_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000074281.1|4576272_4577847_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_000443232.1|4577836_4578952_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_001276036.1|4578961_4579558_+	type IV prepilin	NA	NA	NA	NA	NA
WP_000945240.1|4579562_4580042_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_000173819.1|4580038_4580707_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_032666787.1|4582056_4582839_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	97.3	1.6e-136
WP_076741899.1|4582835_4583858_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	92.4	2.6e-187
WP_001177102.1|4584776_4585898_+|integrase	site-specific integrase	integrase	W6MYA3	Pseudomonas_phage	44.5	2.9e-46
4590307:4590321	attR	GCCGATCTGTTGAGG	NA	NA	NA	NA
>prophage 12
NZ_CP019417	Salmonella enterica subsp. enterica serovar Wandsworth str. SA20092095 chromosome, complete genome	4916040	4813470	4822418	4916040	integrase	Enterobacteria_phage(83.33%)	11	4813285:4813301	4825179:4825195
4813285:4813301	attL	TTCGAGTCCGGCCTTCG	NA	NA	NA	NA
WP_000772664.1|4813470_4814739_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	5.7e-75
WP_000957221.1|4814761_4815217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775190.1|4815225_4816167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076741914.1|4816605_4817172_-	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	66.5	4.6e-61
WP_001661919.1|4817187_4817427_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	60.5	6.3e-20
WP_001669418.1|4817430_4818174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000556587.1|4818714_4818981_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	71.6	2.6e-30
WP_000979749.1|4818977_4819529_+	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.5	1.2e-29
WP_001604623.1|4819525_4819753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001472077.1|4819749_4820070_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_001750171.1|4820084_4822418_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	85.5	0.0e+00
4825179:4825195	attR	TTCGAGTCCGGCCTTCG	NA	NA	NA	NA
