The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	27282	70036	4110589	tRNA,transposase	Synechococcus_phage(50.0%)	41	NA	NA
WP_010930363.1|27282_28233_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023995007.1|28314_28650_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929578.1|28674_29109_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_019247164.1|29141_30359_-	thiolase family protein	NA	NA	NA	NA	NA
WP_010929580.1|30364_30862_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_019247165.1|31069_32005_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929582.1|32214_33006_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010929583.1|33048_34470_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010929584.1|34625_35576_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814398.1|35572_36763_-	MFS transporter	NA	NA	NA	NA	NA
WP_010929585.1|37012_37924_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_010929586.1|37925_40064_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_003814404.1|40060_40600_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_003814405.1|40603_41332_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
WP_010929587.1|41318_42212_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_019247766.1|42282_42678_+	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_003814412.1|42687_43218_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	35.4	3.7e-12
WP_010929588.1|43663_44614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929589.1|45200_45749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815265.1|45720_45957_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815255.1|46084_46978_+	AEC family transporter	NA	NA	NA	NA	NA
WP_010929590.1|48147_49395_+	homoserine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003817748.1|49391_50006_+	methionine biosynthesis protein MetW	NA	NA	NA	NA	NA
WP_010929591.1|50141_51092_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_029443813.1|51134_52391_+	muropeptide transporter	NA	NA	NA	NA	NA
WP_010929592.1|53622_54357_-	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_019247224.1|54362_54953_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.2e-20
WP_003817737.1|54977_55667_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_023852650.1|55663_56425_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010929594.1|56504_57404_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|57497_58448_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929595.1|59248_60475_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_047122776.1|60474_60888_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010929597.1|61077_62019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248755.1|62442_63417_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929599.1|63473_64055_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010929600.1|64067_64370_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_029443770.1|64488_65547_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_019247832.1|65581_66853_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010929603.1|67482_68664_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929584.1|69085_70036_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	77634	123122	4110589	tRNA,transposase	Planktothrix_phage(25.0%)	44	NA	NA
WP_005012067.1|77634_78585_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_041166334.1|78659_79604_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929608.1|79600_81475_-	O-antigen biosynthesis protein WlbL	NA	A0A2P1ELS8	Moumouvirus	26.9	2.0e-23
WP_003807102.1|82822_83527_-	O-antigen biosynthesis protein WlbI	NA	NA	NA	NA	NA
WP_010929609.1|83523_84696_-	O-antigen biosynthesis protein WlbH	NA	NA	NA	NA	NA
WP_010929610.1|84891_85485_-	O-antigen biosynthesis protein WlbG	NA	NA	NA	NA	NA
WP_010929611.1|85481_86714_-	O-antigen biosynthesis protein WlbF	NA	NA	NA	NA	NA
WP_010929612.1|86731_87991_-	O-antigen biosynthesis protein WlbE	NA	NA	NA	NA	NA
WP_010929613.1|88014_89103_-	O-antigen biosynthesis protein WlbD	NA	A0A0N9R0B2	Chrysochromulina_ericina_virus	36.3	4.8e-46
WP_010929614.1|89110_90211_-	O-antigen biosynthesis protein WlbC	NA	A0A2K9L0G1	Tupanvirus	29.7	3.3e-31
WP_003807114.1|90214_90790_-	O-antigen biosynthesis protein WlbB	NA	NA	NA	NA	NA
WP_003807115.1|90793_91846_-	O-antigen biosynthesis protein WlbA	NA	NA	NA	NA	NA
WP_010929615.1|91976_92984_+	lipopolysaccharide heptosyltransferase I	NA	NA	NA	NA	NA
WP_010929616.1|92985_94272_+	3-deoxy-D-manno-octulosonic acid transferase	NA	NA	NA	NA	NA
WP_003807124.1|94288_94444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929617.1|94468_95272_-	type III pantothenate kinase	NA	NA	NA	NA	NA
WP_010929618.1|95268_96135_-	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_010929619.1|96209_97340_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003807131.1|97339_98179_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	32.4	9.1e-21
WP_010929620.1|99111_99714_+	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_010929621.1|99743_100397_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003807138.1|100529_101786_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	40.5	6.2e-66
WP_010929622.1|101833_102733_+	D-amino acid aminotransferase	NA	NA	NA	NA	NA
WP_003818417.1|102808_103084_+	YbeD family protein	NA	NA	NA	NA	NA
WP_010929623.1|103091_103754_+	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_003807146.1|103815_104817_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_003807148.1|104831_105380_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	53.4	3.7e-47
WP_010929624.1|105437_106334_-	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_010929625.1|106330_107392_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.8	1.6e-78
WP_010929626.1|107427_108378_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929627.1|109277_110471_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_010929628.1|110552_111182_-	thiol:disulfide interchange protein DsbA/DsbL	NA	NA	NA	NA	NA
WP_010927242.1|111243_111927_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_023853376.1|111936_113619_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003815933.1|113906_114254_+	DUF1840 domain-containing protein	NA	NA	NA	NA	NA
WP_003815930.1|114344_114662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931363.1|114944_115961_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003815929.1|116036_116837_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003815927.1|116833_117709_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_010929633.1|117719_119012_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929634.1|119054_120095_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.7	6.0e-22
WP_010929635.1|120200_121022_-	phosphodiesterase	NA	NA	NA	NA	NA
WP_005012067.1|121122_122073_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|122171_123122_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	165942	226448	4110589	protease,tRNA,transposase	Diachasmimorpha_longicaudata_entomopoxvirus(11.11%)	51	NA	NA
WP_005015810.1|165942_166893_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929659.1|168336_169239_-	YgcG family protein	NA	NA	NA	NA	NA
WP_003815889.1|169216_169846_-	LemA family protein	NA	NA	NA	NA	NA
WP_010929660.1|170128_171559_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	29.8	5.8e-44
WP_010929661.1|171592_172222_+	LysE family transporter	NA	NA	NA	NA	NA
WP_003815895.1|172270_173878_+	peptide chain release factor 3	NA	A0A2K9L6L3	Tupanvirus	37.8	9.3e-14
WP_010929663.1|173902_174586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815898.1|174667_175144_-	bacterioferritin	NA	NA	NA	NA	NA
WP_010929591.1|175350_176301_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929664.1|177416_177944_+	META domain-containing protein	NA	NA	NA	NA	NA
WP_010929665.1|178035_178851_+	META and DUF4377 domain-containing protein	NA	NA	NA	NA	NA
WP_003808370.1|178911_179646_+	sulfurtransferase	NA	NA	NA	NA	NA
WP_010929666.1|179683_181762_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	23.6	1.5e-27
WP_003808374.1|182011_182284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033446322.1|182385_183471_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010929668.1|183474_185379_+	BamA/TamA family outer membrane protein	NA	NA	NA	NA	NA
WP_014486044.1|185375_189050_+	translocation/assembly module TamB domain-containing protein	NA	NA	NA	NA	NA
WP_010929670.1|189110_189674_+	dCTP deaminase	NA	S5VM63	Pseudomonas_phage	75.3	2.6e-72
WP_003808385.1|189681_190104_-	VOC family protein	NA	NA	NA	NA	NA
WP_010929671.1|190131_190551_-	VOC family protein	NA	NA	NA	NA	NA
WP_076879599.1|190579_191053_-	GNAT family N-acetyltransferase	NA	Q9AZG4	Lactococcus_phage	31.1	2.2e-11
WP_003808391.1|191152_191650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003808393.1|191804_194075_+	arginine/lysine/ornithine decarboxylase	NA	NA	NA	NA	NA
WP_010929672.1|194118_195351_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929591.1|195449_196400_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929673.1|196502_197138_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	73.8	2.8e-83
WP_019248671.1|197134_198028_+	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_010929675.1|198422_199523_+	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_010929676.1|199604_199979_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_010929677.1|200038_202903_+	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	51.4	1.2e-261
WP_010929678.1|203047_203788_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929679.1|203857_205069_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929680.1|205097_206066_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931070.1|206679_207630_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929699.1|207786_208110_+	phosphate starvation-inducible protein	NA	NA	NA	NA	NA
WP_023853200.1|208214_209255_-	cyclase family protein	NA	NA	NA	NA	NA
WP_010929697.1|209260_210040_-	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_003807672.1|210085_210382_-	YciI family protein	NA	NA	NA	NA	NA
WP_003807674.1|210407_210683_-	muconolactone Delta-isomerase	NA	NA	NA	NA	NA
WP_003819086.1|210739_211384_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010929696.1|211383_212070_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_010929695.1|212199_213051_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929694.1|213101_213827_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010929693.1|213858_215208_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929692.1|215319_216252_-	3-hydroxyacyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_033455792.1|216709_219505_-|protease	serine protease autotransporter SphB1	protease	NA	NA	NA	NA
WP_010929690.1|220098_223041_-	phosphoenolpyruvate carboxylase	NA	NA	NA	NA	NA
WP_010929689.1|223112_223832_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A0A0RPC6	Escherichia_phage	43.9	8.0e-50
WP_010929688.1|223870_224419_-	N-acetyltransferase	NA	A0A2H4J136	uncultured_Caudovirales_phage	41.7	1.2e-21
WP_010929687.1|224573_225473_+	virginiamycin B lyase	NA	NA	NA	NA	NA
WP_005012808.1|225497_226448_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	234380	287968	4110589	protease,tRNA,transposase	Bacillus_phage(25.0%)	48	NA	NA
WP_005012067.1|234380_235331_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|235417_236368_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930742.1|236364_237315_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929700.1|237413_238211_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003814363.1|239160_239571_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003814358.1|240592_241336_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814356.1|241379_242423_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814355.1|242593_244696_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_003814351.1|246106_247063_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929701.1|247081_247573_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_010929702.1|247569_248925_-	polynucleotide adenylyltransferase PcnB	NA	A0A1B1IVF3	uncultured_Mediterranean_phage	36.8	3.4e-25
WP_010929703.1|248925_249624_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_010929704.1|249620_250322_-	DnaA regulatory inactivator Hda	NA	NA	NA	NA	NA
WP_003814339.1|250574_251624_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	43.6	5.6e-68
WP_003814337.1|251729_252671_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_010929705.1|252667_254557_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	32.8	3.3e-79
WP_003814332.1|254643_255282_+	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_019247543.1|255424_256810_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A2H4JCM7	uncultured_Caudovirales_phage	30.3	4.5e-17
WP_010929706.1|256740_257277_-|tRNA	bifunctional alanine racemase/tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_010929707.1|257428_258820_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_010929708.1|258836_259817_-	AEC family transporter	NA	NA	NA	NA	NA
WP_003814324.1|259952_260936_+	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_010929709.1|261000_261900_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814321.1|262006_263761_+	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_010929710.1|263768_264893_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929711.1|264906_265887_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012067.1|266617_267568_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929712.1|268127_268673_+	GbsR/MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929713.1|268756_270376_+	cytochrome d ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_004567834.1|270391_271546_+	cytochrome d ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_003817696.1|271559_271685_+	cytochrome bd-I oxidase subunit CydX	NA	NA	NA	NA	NA
WP_010929714.1|271681_273433_+	thiol reductant ABC exporter subunit CydD	NA	W8CYL7	Bacillus_phage	23.8	3.4e-09
WP_010929715.1|273429_275109_+	thiol reductant ABC exporter subunit CydC	NA	W8CYL7	Bacillus_phage	27.6	3.6e-16
WP_010929716.1|275171_275720_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.1	1.3e-28
WP_010929717.1|276862_277141_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|278184_279135_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_173651708.1|279152_279299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929718.1|279412_279574_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_010929719.1|279581_279722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815821.1|280240_280690_-|protease	ClpXP protease specificity-enhancing factor	protease	NA	NA	NA	NA
WP_003815819.1|280699_281311_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_019247426.1|281469_282324_-	cytochrome c1	NA	NA	NA	NA	NA
WP_003815816.1|282343_283726_-	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_003815815.1|283790_284432_-	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_010929721.1|284571_285030_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_010927226.1|285054_285831_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_014906092.1|285884_287021_+	trypsin-like peptidase domain-containing protein	NA	W5SAB9	Pithovirus	31.2	1.2e-07
WP_005015810.1|287017_287968_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	355962	415430	4110589	tRNA,transposase	Streptococcus_phage(50.0%)	56	NA	NA
WP_010929969.1|355962_356913_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929759.1|357024_357747_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003815420.1|357845_358589_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_010929760.1|358819_360328_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003815418.1|360447_361179_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_010929761.1|361223_362684_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929762.1|362708_363188_+	heme-binding protein	NA	NA	NA	NA	NA
WP_003817846.1|363206_364217_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010929763.1|364431_365172_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023997839.1|365378_366389_+	beta-propeller fold lactonase family protein	NA	NA	NA	NA	NA
WP_010929765.1|366348_367299_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929766.1|368347_368986_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_010929767.1|369022_370366_-	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_010929768.1|370788_371577_-	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	25.7	1.2e-19
WP_010929769.1|371714_372389_+	orotate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_010929770.1|372502_373957_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatB	tRNA	NA	NA	NA	NA
WP_010929771.1|373959_375498_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_010929772.1|375500_375809_-|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatC	tRNA	NA	NA	NA	NA
WP_003815204.1|376039_377083_+	rod shape-determining protein	NA	NA	NA	NA	NA
WP_010929773.1|377171_378056_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_003815202.1|378042_378606_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_003815201.1|378619_380572_+	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_003815198.1|380568_381705_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_010929775.1|381730_382786_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_010929776.1|382796_384290_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_010927138.1|384502_385078_-	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_010929777.1|385127_385874_-	pyrimidine 5'-nucleotidase	NA	NA	NA	NA	NA
WP_010929778.1|385873_386776_-	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_010929779.1|387037_387826_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003815191.1|387966_388458_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_003815190.1|388454_389198_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_033446211.1|389194_389788_-	phosphoheptose isomerase	NA	A0A067XQR2	Caulobacter_phage	34.8	5.6e-17
WP_100208326.1|389796_390273_-	YraN family protein	NA	NA	NA	NA	NA
WP_010929780.1|390397_391336_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	NA	NA	NA	NA
WP_010929781.1|391332_391905_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.5	3.2e-25
WP_005012067.1|391901_392852_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|392950_393901_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927231.1|394037_394955_+	reductase	NA	NA	NA	NA	NA
WP_003815842.1|394951_395200_+	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_003815840.1|395196_396402_+	CoA transferase	NA	NA	NA	NA	NA
WP_014486045.1|396474_397470_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486046.1|397492_398713_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486047.1|398709_399354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019248476.1|401084_401894_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486048.1|402198_403152_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	42.5	5.6e-59
WP_014486049.1|403250_404234_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486050.1|404160_404862_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_014486051.1|404910_405681_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_019247259.1|405677_406856_-	CoA transferase	NA	NA	NA	NA	NA
WP_014486052.1|407023_408730_-	thiamine pyrophosphate-requiring protein	NA	NA	NA	NA	NA
WP_014486053.1|408726_409623_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_014486054.1|409663_411253_-	rhodanese homology domain-containing protein	NA	NA	NA	NA	NA
WP_003807867.1|411302_412295_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003807865.1|412363_412963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014486055.1|413423_414404_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010929577.1|414479_415430_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	423241	478215	4110589	transposase	Bradyrhizobium_phage(20.0%)	44	NA	NA
WP_022997984.1|423241_424219_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929785.1|424414_425620_+	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_010929786.1|425616_427128_+	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_003814726.1|427143_428457_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_003814728.1|428647_428827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814730.1|429236_429971_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	43.8	1.4e-41
WP_010929577.1|432415_433366_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247421.1|433497_433896_-	GTP-binding protein	NA	E4ZFJ7	Streptococcus_phage	44.3	9.0e-19
WP_003814701.1|434306_434777_-	universal stress protein	NA	NA	NA	NA	NA
WP_003820700.1|434865_435210_-	TIGR01244 family phosphatase	NA	NA	NA	NA	NA
WP_010929788.1|435309_436710_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010929789.1|438498_439017_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.9	2.1e-12
WP_003814694.1|439127_439883_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	40.8	2.9e-42
WP_003814691.1|440078_441311_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929791.1|441303_442089_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_003814685.1|442155_443127_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003814681.1|443137_444115_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247419.1|444240_445413_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929793.1|445439_446468_+	acyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_003814674.1|446533_447727_+	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_005012067.1|449508_450459_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|450557_451508_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929794.1|451606_452512_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929795.1|452687_452891_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	5.8e-14
WP_010929796.1|453401_453842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929797.1|453871_454531_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019248869.1|454616_456233_-	L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010929799.1|456253_457717_-	short-chain fatty acid transporter	NA	NA	NA	NA	NA
WP_010929800.1|457747_461134_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010929801.1|461275_461680_-	RidA family protein	NA	NA	NA	NA	NA
WP_010929802.1|461823_462810_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247316.1|462796_463078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010929803.1|463823_465056_-	CoA transferase	NA	NA	NA	NA	NA
WP_010929804.1|465055_465550_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010929805.1|465681_466644_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010929806.1|466621_467875_-	CoA transferase	NA	NA	NA	NA	NA
WP_005013747.1|467996_468947_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003821340.1|468943_469606_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_010929831.1|469613_470573_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_010929830.1|470729_471401_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_023853155.1|471403_472369_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_019247670.1|472876_476005_+	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_010929827.1|476080_477148_-	linear amide C-N hydrolase	NA	NA	NA	NA	NA
WP_005012067.1|477264_478215_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	592513	653704	4110589	protease,transposase	uncultured_Mediterranean_phage(40.0%)	56	NA	NA
WP_005013747.1|592513_593464_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023998122.1|593960_594830_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_010931496.1|594826_595648_+	phosphonate ABC transporter, permease protein PhnE	NA	NA	NA	NA	NA
WP_019247235.1|595847_596339_+	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_019247236.1|596357_597431_+	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_023853086.1|597477_598581_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_003808577.1|598656_599277_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_003808574.1|599297_599807_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.1	1.2e-28
WP_003808570.1|599861_600113_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.4	1.6e-18
WP_010931494.1|600176_601310_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_003808567.1|601317_601704_-	MOSC N-terminal beta barrel domain-containing protein	NA	NA	NA	NA	NA
WP_010931493.1|601700_604220_-	AsmA family protein	NA	NA	NA	NA	NA
WP_003808563.1|604648_604987_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003808562.1|604983_605490_+	SRPBCC family protein	NA	NA	NA	NA	NA
WP_010931492.1|605551_606352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931491.1|606462_607404_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931490.1|607497_609033_-	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931489.1|610712_612563_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	1.6e-17
WP_003808549.1|612566_613400_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931488.1|613399_614341_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931487.1|614592_615564_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931486.1|615705_617994_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003808542.1|618300_619209_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010931485.1|619263_620229_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931484.1|620303_621965_+	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_010931483.1|622036_622747_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154698388.1|622713_622878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|622895_623846_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814152.1|624544_624928_+	membrane protein	NA	NA	NA	NA	NA
WP_010927005.1|624985_625588_+	DUF2946 family protein	NA	NA	NA	NA	NA
WP_003820995.1|625605_626007_-	DoxX family protein	NA	NA	NA	NA	NA
WP_003814158.1|626140_627034_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931481.1|627030_627612_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003814165.1|628406_629141_+	arginyltransferase	NA	NA	NA	NA	NA
WP_010931480.1|629181_630231_+	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_003814172.1|630378_630957_-	TIGR01841 family phasin	NA	NA	NA	NA	NA
WP_010931479.1|631343_632321_+	tripartite tricarboxylate transporter substrate binding protein BugD	NA	NA	NA	NA	NA
WP_010931478.1|632414_636809_-	dermonecrotic toxin	NA	NA	NA	NA	NA
WP_003814178.1|637009_637858_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077069241.1|638016_638829_-	competence/damage-inducible protein A	NA	NA	NA	NA	NA
WP_005015810.1|638884_639835_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931453.1|639933_640734_-	EI24 domain-containing protein	NA	NA	NA	NA	NA
WP_003814185.1|640795_641179_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_010931454.1|641190_642624_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	34.4	1.5e-52
WP_003814188.1|642830_643160_-	AzlD domain-containing protein	NA	NA	NA	NA	NA
WP_010931455.1|643162_643912_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010931456.1|644094_645015_+	branched-chain amino acid transaminase	NA	NA	NA	NA	NA
WP_003814195.1|645061_645274_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_010931457.1|645296_645719_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_010931458.1|645735_646836_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010931459.1|646932_648450_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_003814203.1|648525_649365_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	48.9	1.1e-66
WP_003814205.1|649386_650268_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_003814206.1|650349_651444_-	porin	NA	NA	NA	NA	NA
WP_076879617.1|651737_652688_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_041166340.1|652762_653704_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	659028	705219	4110589	tail,tRNA,terminase,transposase	uncultured_Caudovirales_phage(18.18%)	51	NA	NA
WP_023995141.1|659028_660054_+|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_003814221.1|660094_660334_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_010931464.1|660403_661993_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.2	8.7e-65
WP_010931465.1|661992_662541_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003814226.1|662621_663194_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010927008.1|663212_664124_-	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_003814230.1|664197_665166_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_010931466.1|665288_666362_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.7	2.3e-08
WP_010931467.1|666366_668187_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.3	3.1e-74
WP_010930800.1|668263_669214_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_033446132.1|669302_669638_+	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_003819076.1|669771_670422_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_010931468.1|670443_671862_-	amidase	NA	NA	NA	NA	NA
WP_019248554.1|671931_672687_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019247734.1|672655_673414_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931471.1|673424_674306_+	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931472.1|674322_675030_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.4	8.2e-07
WP_010931473.1|675032_675791_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	4.4e-14
WP_010931474.1|676000_677743_+	nitrite/sulfite reductase	NA	NA	NA	NA	NA
WP_010925795.1|677735_678260_+	DUF934 domain-containing protein	NA	NA	NA	NA	NA
WP_010931475.1|678299_679094_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248926.1|679261_680335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|680433_681384_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247378.1|681635_681842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931451.1|681913_682525_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_023853179.1|683079_683331_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_161633094.1|683323_684013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853183.1|684030_684252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|684269_685220_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247942.1|685859_686345_+|transposase	transposase	transposase	C7U0W1	Enterobacteria_phage	61.5	7.3e-39
WP_010931447.1|686331_687609_+|terminase	terminase large subunit	terminase	A0A1B1P9C9	Acinetobacter_phage	64.7	2.4e-150
WP_010931446.1|687611_689030_+	DUF4055 domain-containing protein	NA	R9TF43	Synechococcus_phage	42.1	2.2e-99
WP_010931445.1|689058_690114_+	hypothetical protein	NA	A0A0H5BBX3	Pseudomonas_phage	50.6	2.6e-97
WP_010931444.1|690119_690362_+	hypothetical protein	NA	A0A0H5AUE5	Pseudomonas_phage	53.2	5.6e-16
WP_010931443.1|690484_691087_+	hypothetical protein	NA	R9TF81	Synechococcus_phage	43.6	7.9e-27
WP_005012808.1|691515_692466_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931442.1|693140_693392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247789.1|693454_693937_+	hypothetical protein	NA	A0A2H4JE38	uncultured_Caudovirales_phage	37.1	1.8e-13
WP_010931440.1|693938_694139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931439.1|694138_694534_+	hypothetical protein	NA	A0A2D2W284	Stenotrophomonas_phage	35.0	7.8e-07
WP_010931438.1|694530_694929_+	hypothetical protein	NA	I6PCW1	Cronobacter_phage	38.0	4.2e-16
WP_010931437.1|694925_695348_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_010931436.1|695355_695856_+	HNH endonuclease	NA	A0A1I9SEX5	Klebsiella_phage	45.1	4.4e-31
WP_010931435.1|696110_696629_+|tail	phage tail protein	tail	A0A1S5R1H0	Pseudomonas_phage	38.3	5.4e-24
WP_003813412.1|696638_696968_+|tail	phage tail assembly chaperone	tail	A0A2H4J121	uncultured_Caudovirales_phage	44.0	2.9e-15
WP_010931434.1|696985_697276_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	45.2	3.7e-14
WP_010931433.1|697301_699914_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	38.6	4.9e-105
WP_010931432.1|699923_700283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931431.1|700350_700884_+	DUF1833 family protein	NA	A5A3Q9	Burkholderia_phage	46.9	1.1e-40
WP_010931430.1|700880_701270_+	C40 family peptidase	NA	A0A0G3EYJ9	Achromobacter_phage	50.0	3.0e-35
WP_010931429.1|701262_705219_+	DUF1983 domain-containing protein	NA	A0A0B5A1N2	Achromobacter_phage	40.8	3.9e-215
>prophage 9
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	711385	765315	4110589	tRNA,transposase	Planktothrix_phage(50.0%)	46	NA	NA
WP_003814636.1|711385_713116_+|tRNA	proline--tRNA ligase	tRNA	A0A2K9L3R9	Tupanvirus	29.4	4.6e-11
WP_010931419.1|713168_713597_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003814641.1|713599_714280_+	protein TolQ	NA	NA	NA	NA	NA
WP_003814643.1|714279_714738_+	protein TolR	NA	NA	NA	NA	NA
WP_010931418.1|714774_715749_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_010931417.1|715765_717082_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_003814650.1|717113_717611_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003814652.1|717697_718387_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_010931416.1|718386_719436_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_003814657.1|719432_720227_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	2.4e-15
WP_019247923.1|720395_720746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247922.1|720721_721279_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005012808.1|722408_723359_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929184.1|725496_726726_+	spore maturation protein	NA	NA	NA	NA	NA
WP_003814419.1|726728_728171_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_010931414.1|728275_729421_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.7e-41
WP_010931413.1|729452_730250_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_010931412.1|730274_731834_-	chaperone SurA	NA	NA	NA	NA	NA
WP_010931411.1|731830_734203_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010931410.1|734312_735416_+	phosphotransferase	NA	NA	NA	NA	NA
WP_010931409.1|735415_736108_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003814436.1|736251_736953_+	membrane protein	NA	NA	NA	NA	NA
WP_003814437.1|736937_737315_-	4a-hydroxytetrahydrobiopterin dehydratase	NA	NA	NA	NA	NA
WP_010929591.1|738046_738997_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814441.1|739156_740029_-	oxaloacetate decarboxylase	NA	NA	NA	NA	NA
WP_003814443.1|740369_740588_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_019247242.1|740627_742007_-	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010929976.1|742048_743446_-	amidase family protein	NA	NA	NA	NA	NA
WP_010927038.1|743485_745138_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	6.0e-16
WP_010929977.1|745141_746026_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929978.1|746025_746967_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010929979.1|747045_748665_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010929980.1|748831_749647_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003814459.1|749714_750284_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005013747.1|750284_751235_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814461.1|751889_752987_+	carboxynorspermidine decarboxylase	NA	NA	NA	NA	NA
WP_003814462.1|753020_754286_+	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010929591.1|754443_755394_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929982.1|755637_756228_+	polyisoprenoid-binding protein	NA	NA	NA	NA	NA
WP_010929983.1|756243_758688_-	TonB-dependent siderophore receptor	NA	NA	NA	NA	NA
WP_003814467.1|758807_759779_-	FecR family protein	NA	NA	NA	NA	NA
WP_023852739.1|759910_760435_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_005012067.1|760394_761345_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929984.1|761566_763762_-	DUF1156 domain-containing protein	NA	NA	NA	NA	NA
WP_010929985.1|763834_764263_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012808.1|764364_765315_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	857242	906506	4110589	holin,transposase	Vibrio_phage(33.33%)	40	NA	NA
WP_010929591.1|857242_858193_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247352.1|858210_858765_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813949.1|858766_859201_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003813951.1|859197_859632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003813952.1|859615_860419_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_003813954.1|860435_861251_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_019248500.1|861247_862063_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_010930033.1|862209_862911_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003813960.1|862938_864897_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	30.3	8.0e-28
WP_005013747.1|864979_865930_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930032.1|866150_866819_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_010930031.1|866942_868049_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930030.1|868061_871175_+	MexW/MexI family multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.5	4.5e-57
WP_010930029.1|871171_872665_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010926969.1|872679_873351_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_003813974.1|873394_873889_-	azurin	NA	NA	NA	NA	NA
WP_010930027.1|874029_874677_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023853163.1|874780_876829_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930025.1|876825_878838_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_010930024.1|878863_880198_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003813981.1|880306_881299_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813982.1|881365_883450_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_010930023.1|883474_884446_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930022.1|884574_885606_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_010930021.1|885609_886761_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_076879542.1|886931_887855_+	transcriptional regulator LrhA	NA	NA	NA	NA	NA
WP_003813987.1|887932_888757_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023994644.1|888953_889970_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003813988.1|890166_891150_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930019.1|892748_894137_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003813991.1|894167_895157_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003813992.1|895267_896500_-	methylaspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_003813993.1|896781_897582_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930018.1|897604_899836_-|holin	choline BCCT transporter BetT	holin	NA	NA	NA	NA
WP_010930017.1|900623_901070_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_003813996.1|901091_901838_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_003813997.1|901981_902959_-	NAD(P)H-quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010930016.1|903592_904204_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	32.5	3.3e-12
WP_003813999.1|904197_905415_-	threonine ammonia-lyase	NA	NA	NA	NA	NA
WP_005013747.1|905555_906506_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	916118	981058	4110589	transposase	Bacillus_phage(18.18%)	58	NA	NA
WP_005012067.1|916118_917069_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930051.1|917065_918898_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.4	1.3e-27
WP_010930052.1|919296_919956_+	thiopurine S-methyltransferase	NA	NA	NA	NA	NA
WP_023852837.1|920049_920196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809770.1|920304_920472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930054.1|920483_921164_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_010930055.1|921445_922162_+	flagellar brake protein	NA	NA	NA	NA	NA
WP_010930056.1|922176_923478_-	phospholipase A	NA	NA	NA	NA	NA
WP_029444137.1|925622_928511_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_010930057.1|928734_930087_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_004568140.1|930115_930637_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_003819989.1|930633_932088_+	carboxylase	NA	NA	NA	NA	NA
WP_023852826.1|932122_932371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247557.1|932476_933352_+	amidohydrolase	NA	NA	NA	NA	NA
WP_010930060.1|933377_934433_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930061.1|934445_935237_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930062.1|935269_936640_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_005012067.1|937816_938767_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930064.1|938819_939041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810832.1|939200_939413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003810835.1|939532_940651_+	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_003810839.1|941156_941408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930066.1|941520_942471_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810840.1|942467_942851_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_023852913.1|942905_944720_-	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.9	5.7e-44
WP_010930068.1|944869_945697_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	47.4	1.7e-67
WP_010930069.1|945742_946723_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003810850.1|946719_946932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003810851.1|946928_948110_-	PepSY domain-containing protein	NA	NA	NA	NA	NA
WP_019248496.1|948273_949008_+	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.2	1.9e-62
WP_010930071.1|949009_951622_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_003810859.1|951757_953671_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_010930072.1|954286_954697_-	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003810865.1|954794_955880_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_005012067.1|955978_956929_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930088.1|956925_957900_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003821497.1|958024_958936_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	27.6	4.4e-05
WP_004566317.1|959212_959605_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	45.0	4.8e-25
WP_005012808.1|959734_960685_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930090.1|960714_960897_-	type II toxin-antitoxin system HicA family toxin	NA	A0A1L2JY37	Aeribacillus_phage	56.1	3.7e-12
WP_010930091.1|961669_962851_-	MFS transporter	NA	NA	NA	NA	NA
WP_010930092.1|963066_963744_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_010930093.1|963740_964466_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_010930094.1|964591_965173_-	OmpA family protein	NA	NA	NA	NA	NA
WP_010930095.1|965543_968225_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.5	3.2e-104
WP_010930096.1|968224_969358_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	44.0	6.4e-78
WP_010930097.1|969350_970436_+	prephenate dehydratase	NA	NA	NA	NA	NA
WP_010930098.1|970522_971422_+	prephenate dehydrogenase/arogenate dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010930099.1|971418_972747_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_010930100.1|972761_973433_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_010930101.1|973620_975336_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_010930102.1|975337_975697_+	integration host factor subunit beta	NA	NA	NA	NA	NA
WP_010930103.1|975888_976203_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_010930104.1|976245_977466_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_010930105.1|977462_978404_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	28.1	1.5e-16
WP_003821513.1|978400_979390_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SJ87	Synechococcus_phage	34.4	2.2e-26
WP_033446303.1|979424_980009_+	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|980107_981058_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	1000458	1063609	4110589	transposase	Enterococcus_phage(16.67%)	54	NA	NA
WP_005012067.1|1000458_1001409_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930118.1|1001513_1002563_+	NADP(H)-dependent aldo-keto reductase	NA	NA	NA	NA	NA
WP_010929632.1|1002700_1003717_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010926548.1|1005225_1005798_-	chorismate lyase	NA	NA	NA	NA	NA
WP_010930119.1|1005857_1006589_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_029443805.1|1006640_1007558_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930121.1|1008365_1011545_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_014486063.1|1011541_1012924_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_010930123.1|1012993_1013245_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_010930124.1|1013390_1014005_-	SCO family protein	NA	NA	NA	NA	NA
WP_019248379.1|1014191_1016306_-	M3 family metallopeptidase	NA	NA	NA	NA	NA
WP_003811948.1|1016381_1017233_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	39.8	2.1e-33
WP_010930126.1|1017229_1017856_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003817147.1|1017852_1019607_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010930127.1|1019899_1022605_+	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_010930128.1|1022617_1024279_+	dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_010930129.1|1024291_1026082_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.2	2.4e-39
WP_003817151.1|1026303_1027479_-	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_010929584.1|1027521_1028472_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930130.1|1028570_1029311_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_010930131.1|1029505_1031542_+	transketolase	NA	NA	NA	NA	NA
WP_010930132.1|1031559_1032570_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_010930133.1|1032687_1033881_+	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_010930134.1|1033910_1034684_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010930135.1|1034680_1035871_-	acetate kinase	NA	NA	NA	NA	NA
WP_003809454.1|1035896_1036835_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_010930136.1|1036831_1039180_-	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_010930137.1|1039334_1039976_-	glutathione transferase	NA	NA	NA	NA	NA
WP_023853531.1|1040079_1041213_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994624.1|1041305_1041458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930138.1|1041489_1042038_-	DinB family protein	NA	NA	NA	NA	NA
WP_003819814.1|1042056_1042542_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930139.1|1042719_1043658_+	DnaJ domain-containing protein	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	24.1	5.6e-11
WP_003809467.1|1043660_1043978_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247197.1|1044023_1044968_+	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_010930141.1|1046648_1047299_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_003809479.1|1047352_1047688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930142.1|1047684_1048545_+	M23 family metallopeptidase	NA	A0A292GJG6	Xanthomonas_phage	36.1	2.6e-15
WP_003819817.1|1048561_1048843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003809486.1|1048916_1049180_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_005012067.1|1049423_1050374_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811933.1|1050672_1051410_-	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_010930143.1|1051845_1052169_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_003811929.1|1052203_1052764_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_003811927.1|1052884_1053760_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_003817154.1|1053772_1054720_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_019247393.1|1054821_1055115_+	response regulator	NA	NA	NA	NA	NA
WP_010930144.1|1055141_1057199_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_003811919.1|1057213_1057714_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_010930145.1|1057787_1059494_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.7	1.4e-12
WP_010930146.1|1060357_1061410_+	chemotaxis response regulator protein-glutamate methylesterase	NA	NA	NA	NA	NA
WP_003811911.1|1061462_1061852_+	chemotaxis response regulator CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	33.3	5.7e-10
WP_003817162.1|1061860_1062493_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_010931363.1|1062592_1063609_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 13
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	1069593	1129656	4110589	protease,holin,tRNA,transposase	uncultured_Mediterranean_phage(37.5%)	51	NA	NA
WP_015041211.1|1069593_1071021_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_010929632.1|1071958_1072975_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003809411.1|1073307_1074243_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.5	3.0e-41
WP_010930154.1|1074292_1076173_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003809416.1|1076239_1076584_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	40.4	1.0e-10
WP_010930155.1|1076728_1077865_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.4	1.9e-85
WP_023853534.1|1077861_1078935_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_003809423.1|1079092_1080529_+	D-alanyl-D-alanine carboxypeptidase/D-alanyl-D-alanine-endopeptidase	NA	NA	NA	NA	NA
WP_010930157.1|1080619_1081261_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023853536.1|1081596_1082613_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_019248433.1|1082945_1085693_+	pertactin autotransporter	NA	NA	NA	NA	NA
WP_010930160.1|1085759_1087181_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003809431.1|1087444_1088161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003809432.1|1088245_1088563_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_003819794.1|1088603_1089017_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_010930161.1|1089018_1089378_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023853525.1|1089420_1090965_-	4-hydroxy-3-polyprenylbenzoate decarboxylase	NA	NA	NA	NA	NA
WP_010930163.1|1091048_1091879_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_010930164.1|1091913_1093068_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_010930165.1|1093110_1093983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014486065.1|1094099_1096388_+	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_003809441.1|1097594_1098059_+	barstar family protein	NA	NA	NA	NA	NA
WP_005013747.1|1098085_1099036_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|1099134_1100085_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_154698393.1|1100102_1100240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930167.1|1100452_1101229_-	phosphate ABC transporter ATP-binding protein PstB	NA	G9BWD6	Planktothrix_phage	28.7	4.3e-17
WP_003809638.1|1101273_1102131_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_010930169.1|1102152_1103169_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_014486066.1|1103303_1104344_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	40.2	2.1e-51
WP_010930171.1|1104538_1106620_-	polyphosphate kinase 1	NA	NA	NA	NA	NA
WP_010930172.1|1106855_1108349_+	exopolyphosphatase	NA	NA	NA	NA	NA
WP_003809629.1|1108579_1109374_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003819875.1|1109594_1110953_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_010930173.1|1110949_1111792_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	32.5	3.2e-26
WP_010930174.1|1111810_1113697_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	M4QMW8	Micromonas_pusilla_virus	41.5	1.4e-109
WP_162096758.1|1113638_1113890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930175.1|1113934_1114567_-	RlmE family RNA methyltransferase	NA	NA	NA	NA	NA
WP_003809618.1|1114585_1115188_+	YhbY family RNA-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|1115339_1116290_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_161633091.1|1116870_1117578_+	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_003812707.1|1117936_1118923_-	homoserine kinase	NA	NA	NA	NA	NA
WP_010930178.1|1119062_1120076_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_005012067.1|1120072_1121023_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_155120815.1|1121040_1121181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003812703.1|1121135_1121594_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_003812701.1|1121630_1122944_-	YihY family inner membrane protein	NA	NA	NA	NA	NA
WP_010930180.1|1122961_1123333_+	DUF2069 domain-containing protein	NA	NA	NA	NA	NA
WP_019248549.1|1123329_1124793_+	YdiU family protein	NA	A0A075BSJ0	Microcystis_phage	32.5	1.7e-43
WP_010930182.1|1124933_1125662_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010930183.1|1125643_1128493_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010929591.1|1128705_1129656_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	1321100	1386529	4110589	transposase	Planktothrix_phage(33.33%)	55	NA	NA
WP_005012808.1|1321100_1322051_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930283.1|1322819_1323458_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_019247793.1|1324347_1324794_+	aspartate/glutamate racemase family protein	NA	NA	NA	NA	NA
WP_010930284.1|1324875_1325577_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.4	1.3e-17
WP_003811277.1|1325577_1326345_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	1.2e-14
WP_010930285.1|1326341_1327580_-	high-affinity branched-chain amino acid ABC transporter permease LivM	NA	NA	NA	NA	NA
WP_003811272.1|1327579_1328506_-	high-affinity branched-chain amino acid ABC transporter permease LivH	NA	NA	NA	NA	NA
WP_010930286.1|1328608_1329724_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005015810.1|1329739_1330690_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930287.1|1331043_1331625_-	queuosine precursor transporter	NA	A0A2I7SAW6	Vibrio_phage	37.3	9.4e-17
WP_003811267.1|1331621_1332455_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_010930288.1|1332665_1333979_+	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_003811262.1|1334155_1335037_+	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_003811259.1|1335056_1335908_+	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_010930289.1|1335960_1337049_+	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	31.2	2.2e-19
WP_010930290.1|1337159_1338287_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003811244.1|1338521_1339133_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010929584.1|1339231_1340182_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811293.1|1340403_1340781_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_003811295.1|1340928_1341426_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_010930291.1|1341422_1341950_+	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_003811298.1|1342083_1342899_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930292.1|1342911_1344093_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003811301.1|1344140_1345034_-	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_010930293.1|1345160_1345631_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930294.1|1345756_1346584_-	DUF3298 domain-containing protein	NA	NA	NA	NA	NA
WP_003811306.1|1346612_1347389_-	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_023852802.1|1347385_1347661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930295.1|1347675_1348140_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_010930296.1|1348151_1348853_-	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003811310.1|1348962_1349463_-	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	38.4	4.7e-25
WP_010930297.1|1349545_1350724_-	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_003811313.1|1352351_1352687_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010930298.1|1352874_1354323_+	CoA transferase	NA	NA	NA	NA	NA
WP_023852799.1|1354380_1354725_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	58.4	3.0e-31
WP_003811316.1|1354831_1355371_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_005012067.1|1355463_1356414_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|1356512_1357463_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023999972.1|1357480_1357720_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247530.1|1358201_1358633_-	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_010930300.1|1358814_1359219_-	DoxX family protein	NA	NA	NA	NA	NA
WP_010930301.1|1360455_1360779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247533.1|1360781_1361669_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_003811322.1|1361701_1362127_-	universal stress protein	NA	NA	NA	NA	NA
WP_019247534.1|1362198_1362552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811324.1|1362791_1363298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930302.1|1363336_1364668_-	transcriptional regulator PtsJ	NA	NA	NA	NA	NA
WP_003811326.1|1364727_1365543_+	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_010930303.1|1365539_1366394_+	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_010930304.1|1369456_1372000_-	malto-oligosyltrehalose synthase	NA	NA	NA	NA	NA
WP_010930305.1|1373366_1375121_-	malto-oligosyltrehalose trehalohydrolase	NA	NA	NA	NA	NA
WP_010930306.1|1375117_1377238_-	glycogen debranching protein GlgX	NA	NA	NA	NA	NA
WP_010930307.1|1377242_1379438_-	1,4-alpha-glucan branching protein GlgB	NA	NA	NA	NA	NA
WP_010930308.1|1379434_1382776_-	maltose alpha-D-glucosyltransferase	NA	NA	NA	NA	NA
WP_010930208.1|1385578_1386529_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	1451127	1506614	4110589	protease,transposase	Mollivirus(16.67%)	56	NA	NA
WP_005012067.1|1451127_1452078_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811846.1|1453279_1453726_-	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_019247562.1|1453718_1455194_-	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_010930338.1|1455190_1455946_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_003817203.1|1455938_1456949_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_010930339.1|1456938_1458615_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_010930340.1|1458927_1459260_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_010930341.1|1459273_1459669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930342.1|1459678_1460005_-	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_019247563.1|1460001_1460328_-	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_023997203.1|1460254_1460668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930343.1|1461272_1461623_-	flagellar protein FliT	NA	NA	NA	NA	NA
WP_010930344.1|1461670_1462099_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_010930345.1|1462106_1463480_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_003817216.1|1463620_1463998_-	flagellar protein FlaG	NA	NA	NA	NA	NA
WP_010930346.1|1464260_1465568_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_023852965.1|1465628_1466459_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_003811815.1|1466455_1466944_+	CvpA family protein	NA	NA	NA	NA	NA
WP_003811814.1|1466985_1468506_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	43.7	4.8e-97
WP_003811812.1|1468549_1469026_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_010930348.1|1469829_1472427_-	[protein-PII] uridylyltransferase	NA	NA	NA	NA	NA
WP_003811806.1|1472456_1473278_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_003811803.1|1474004_1474754_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_010926570.1|1474937_1475816_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_010930349.1|1475913_1476630_+	UMP kinase	NA	NA	NA	NA	NA
WP_003811796.1|1476644_1477205_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_010930350.1|1477371_1478136_+	di-trans,poly-cis-decaprenylcistransferase	NA	R9W0U9	Flavobacterium_phage	36.1	1.7e-18
WP_010930351.1|1478155_1479013_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003811788.1|1479009_1480209_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_010930352.1|1480248_1481583_+|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_010930353.1|1481635_1483972_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_003811782.1|1484097_1484661_+	OmpH family outer membrane protein	NA	NA	NA	NA	NA
WP_010930354.1|1484669_1485761_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_003811776.1|1485832_1486288_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_010930355.1|1486288_1487083_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_010930356.1|1487079_1488261_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_003811770.1|1488247_1488853_+	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	40.2	8.8e-26
WP_003811768.1|1488849_1489623_+	RNA methyltransferase	NA	NA	NA	NA	NA
WP_010930357.1|1489634_1490462_-	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_010930358.1|1490623_1492987_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	35.9	2.2e-165
WP_010930359.1|1493054_1493774_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_003811761.1|1493897_1494323_+	NfeD family protein	NA	NA	NA	NA	NA
WP_005012067.1|1494357_1495308_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811759.1|1495425_1496352_+	paraslipin	NA	NA	NA	NA	NA
WP_010930360.1|1496417_1497575_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.2	2.3e-14
WP_003811754.1|1497555_1498023_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.1	6.2e-27
WP_010930800.1|1498170_1499121_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003811752.1|1499137_1499572_+	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_003811750.1|1499561_1499912_+	RnfH family protein	NA	NA	NA	NA	NA
WP_003811748.1|1500108_1501263_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_003811746.1|1501259_1502432_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003811743.1|1502479_1503373_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003811741.1|1503418_1503856_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_010930362.1|1503915_1504605_+	VIT family protein	NA	NA	NA	NA	NA
WP_010930363.1|1504614_1505565_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879624.1|1505663_1506614_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	1601311	1669393	4110589	tRNA,transposase	Streptococcus_virus(11.11%)	59	NA	NA
WP_010930416.1|1601311_1601800_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_019248504.1|1601917_1602496_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_010930418.1|1602601_1602970_+	ribbon-helix-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005012067.1|1603068_1604019_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994932.1|1604025_1605138_-	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_010930419.1|1605824_1607027_+	MFS transporter	NA	NA	NA	NA	NA
WP_004568212.1|1607062_1607209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930420.1|1607230_1609891_+	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_010930421.1|1609903_1613308_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_023995689.1|1613975_1616201_+	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	38.5	1.2e-43
WP_010930423.1|1616247_1616574_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_010930424.1|1616624_1617233_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_005013747.1|1617331_1618282_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930425.1|1618351_1619116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930426.1|1619112_1619712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930427.1|1619815_1620667_-	neutral zinc metallopeptidase	NA	A0A1I9SA48	Rhodococcus_phage	35.3	7.0e-37
WP_010928449.1|1620726_1621353_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_005012067.1|1621349_1622300_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019249265.1|1622398_1623511_-	DUF1513 domain-containing protein	NA	NA	NA	NA	NA
WP_019248041.1|1623500_1624502_-	imelysin family protein	NA	NA	NA	NA	NA
WP_019247498.1|1624607_1626119_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_023853587.1|1626115_1627420_-	imelysin	NA	NA	NA	NA	NA
WP_010930431.1|1627531_1628092_-	membrane protein	NA	NA	NA	NA	NA
WP_010930432.1|1628359_1628914_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL82	Lactobacillus_phage	32.0	1.7e-15
WP_010930433.1|1629369_1629585_-	dodecin domain-containing protein	NA	NA	NA	NA	NA
WP_033446228.1|1629839_1632437_+	DNA mismatch repair protein MutS	NA	A0A1V0SDQ0	Indivirus	22.6	1.5e-21
WP_010930435.1|1632433_1633621_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010930436.1|1634275_1634890_+	serotype 3 fimbrial subunit	NA	NA	NA	NA	NA
WP_010930437.1|1634978_1636106_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_033446216.1|1636117_1637023_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_005012067.1|1637915_1638866_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930439.1|1639047_1639800_+	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_003811112.1|1639868_1640528_+	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_003811113.1|1640524_1641253_+	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	39.3	3.3e-35
WP_010930440.1|1641265_1643545_-	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	32.1	5.9e-06
WP_010930441.1|1643569_1643773_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_010930442.1|1643814_1644447_-	guanylate kinase	NA	A0A218KC48	Bacillus_phage	33.9	2.4e-13
WP_010930443.1|1644582_1645500_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_010930444.1|1645496_1646210_-	c-type cytochrome	NA	NA	NA	NA	NA
WP_003811135.1|1646447_1647218_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003811137.1|1647222_1647822_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	41.6	1.4e-20
WP_003811138.1|1648066_1649557_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_010926696.1|1649615_1649900_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930445.1|1650037_1650193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003811148.1|1650465_1651392_-	YicC family protein	NA	NA	NA	NA	NA
WP_003811149.1|1651528_1652269_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_010930446.1|1652435_1653812_-	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_003811152.1|1653993_1654899_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930448.1|1656550_1658353_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_010930449.1|1658479_1659121_+	RdgB/HAM1 family non-canonical purine NTP pyrophosphatase	NA	NA	NA	NA	NA
WP_005012808.1|1659219_1660170_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930450.1|1660191_1661412_+	oxygen-independent coproporphyrinogen III oxidase-like protein	NA	NA	NA	NA	NA
WP_003811164.1|1661597_1663010_+	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_003811167.1|1663073_1664141_+	PAS domain-containing protein	NA	Q8QKV7	Ectocarpus_siliculosus_virus	23.5	1.1e-05
WP_010930451.1|1664140_1665628_+	nitrogen regulation protein NR(I)	NA	NA	NA	NA	NA
WP_010930452.1|1665637_1666582_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811176.1|1666741_1667440_+	pirin family protein	NA	NA	NA	NA	NA
WP_010930453.1|1667517_1668423_+	pirin family protein	NA	NA	NA	NA	NA
WP_005012067.1|1668442_1669393_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	1705342	1760933	4110589	transposase	Brazilian_cedratvirus(25.0%)	47	NA	NA
WP_005013747.1|1705342_1706293_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930486.1|1706351_1707125_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486074.1|1707117_1708674_+	LTA synthase family protein	NA	NA	NA	NA	NA
WP_005013747.1|1708670_1709621_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003810741.1|1710947_1711550_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003810743.1|1711789_1712491_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003816696.1|1712484_1713267_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	25.8	2.0e-09
WP_005012808.1|1713451_1714402_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930483.1|1714500_1715238_-	TerC family protein	NA	A0A0S4KZH7	Pseudomonas_phage	46.6	4.1e-41
WP_010926609.1|1715427_1716186_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930482.1|1716232_1717222_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930481.1|1717399_1718368_-	transporter	NA	NA	NA	NA	NA
WP_010930480.1|1719907_1720876_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_010930479.1|1720884_1721826_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_010930478.1|1722299_1723310_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930477.1|1723300_1724815_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010930476.1|1724811_1726158_+	BatD family protein	NA	NA	NA	NA	NA
WP_010930475.1|1726160_1727195_+	haloacid dehalogenase-like hydrolase	NA	NA	NA	NA	NA
WP_023852967.1|1727244_1728870_+	arylsulfatase	NA	A0A2P0VMN7	Tetraselmis_virus	52.2	2.0e-149
WP_005012067.1|1729422_1730373_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930487.1|1730477_1731425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247865.1|1731478_1733293_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_010930489.1|1733285_1733960_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023995112.1|1734089_1737164_+	autotransporter SphB2	NA	NA	NA	NA	NA
WP_019247905.1|1737177_1737477_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010930492.1|1737791_1738415_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_010930493.1|1738658_1739528_+	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_010930494.1|1739505_1740450_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247909.1|1740535_1741462_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019247910.1|1741574_1742354_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930497.1|1742344_1743541_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_010930498.1|1743571_1744522_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_010930499.1|1744743_1745433_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930500.1|1745497_1746253_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930501.1|1746304_1747297_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930502.1|1747306_1748260_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811538.1|1748375_1749338_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_019249376.1|1750739_1751168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|1751164_1752115_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_170954298.1|1752408_1753146_-	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	68.2	1.3e-87
WP_010930504.1|1753569_1754757_-	MFS transporter	NA	NA	NA	NA	NA
WP_019249653.1|1754760_1755141_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930506.1|1756860_1757832_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930507.1|1757845_1758559_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930508.1|1758563_1759481_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003811452.1|1759587_1759884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010929588.1|1759982_1760933_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 18
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	1993697	2063348	4110589	tRNA,transposase	Staphylococcus_phage(16.67%)	55	NA	NA
WP_003818515.1|1993697_1996355_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	39.0	3.3e-173
WP_010930709.1|1996432_1997635_-	MFS transporter	NA	NA	NA	NA	NA
WP_003810260.1|1997631_1998144_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019247822.1|1998266_1998704_-	HU family DNA-binding protein	NA	NA	NA	NA	NA
WP_010931070.1|1998980_1999931_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_062826579.1|2000029_2000980_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930710.1|2001233_2003039_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.5	2.2e-19
WP_010930711.1|2003152_2003320_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_003810297.1|2003383_2003620_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_010930712.1|2003988_2005188_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_010929591.1|2006703_2007654_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003818523.1|2008105_2009107_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003810306.1|2009279_2010137_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_003810308.1|2010133_2011396_+	glycine betaine/L-proline ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	36.6	6.8e-28
WP_003818524.1|2011496_2011871_+	tautomerase family protein	NA	NA	NA	NA	NA
WP_010930713.1|2011943_2013131_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_010930714.1|2013215_2013986_+	spermidine synthase	NA	NA	NA	NA	NA
WP_010930715.1|2014099_2014864_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930716.1|2014814_2016116_+	malonyl-CoA decarboxylase family protein	NA	NA	NA	NA	NA
WP_010930717.1|2016112_2016919_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003818532.1|2018663_2019635_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003818533.1|2019791_2020304_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	52.3	1.8e-43
WP_010930718.1|2020462_2021437_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930719.1|2022437_2023232_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	25.7	5.1e-05
WP_003818535.1|2023257_2024064_-	TOBE domain-containing protein	NA	NA	NA	NA	NA
WP_003810329.1|2024174_2024765_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_010930720.1|2024775_2025954_+	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_010930721.1|2026056_2026431_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_019248531.1|2026683_2028015_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_019247651.1|2028081_2031312_+	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_003810344.1|2032802_2033549_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_010930724.1|2033633_2034095_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_010930725.1|2034132_2035191_+	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_010930726.1|2035153_2036983_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003810356.1|2037022_2037595_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_010930727.1|2039019_2039841_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.6	4.1e-42
WP_010930728.1|2040159_2041482_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_010930729.1|2041840_2042476_+	membrane protein	NA	NA	NA	NA	NA
WP_010930730.1|2042435_2043386_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930731.1|2044256_2045129_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010930732.1|2045206_2046346_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930733.1|2046704_2047961_+	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_003816691.1|2047966_2048494_+	aromatic-ring-hydroxylating dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_003816690.1|2048498_2049317_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003816687.1|2049316_2050039_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930735.1|2050060_2050375_+	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930736.1|2050392_2051541_+	CoA transferase	NA	NA	NA	NA	NA
WP_010930737.1|2051571_2052447_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003816680.1|2052443_2053763_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_014486081.1|2053835_2055032_-	acetyl-CoA acetyltransferase	NA	NA	NA	NA	NA
WP_010930739.1|2055042_2056530_-	hydroxymethylglutaryl-CoA synthase family protein	NA	NA	NA	NA	NA
WP_010930740.1|2059124_2060024_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023852887.1|2060161_2061127_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_005015810.1|2061225_2062176_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2062397_2063348_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 19
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2074844	2124240	4110589	transposase	Erysipelothrix_phage(16.67%)	45	NA	NA
WP_005013747.1|2074844_2075795_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812172.1|2076932_2077229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247707.1|2077403_2078756_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	2.9e-45
WP_010930153.1|2078898_2079915_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_010930748.1|2081894_2082908_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_010930749.1|2082994_2083900_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003812179.1|2084056_2084401_+	exported protein	NA	NA	NA	NA	NA
WP_010930750.1|2084558_2085017_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_010930751.1|2085030_2087247_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003812183.1|2087243_2088305_+	XdhC family protein	NA	NA	NA	NA	NA
WP_010930752.1|2088333_2089308_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930753.1|2089259_2090078_-	hypothetical protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	28.8	2.3e-16
WP_003812191.1|2090090_2090699_-	LON peptidase substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_010930754.1|2090873_2091269_+	VOC family protein	NA	NA	NA	NA	NA
WP_010930755.1|2091287_2092727_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	37.4	7.4e-55
WP_003812199.1|2092755_2093103_+	GFA family protein	NA	NA	NA	NA	NA
WP_010929577.1|2093121_2094072_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|2094724_2095675_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997035.1|2095758_2097576_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.4	2.3e-37
WP_019247659.1|2097649_2098297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930758.1|2098309_2099239_-	ZIP family metal transporter	NA	NA	NA	NA	NA
WP_014905663.1|2099408_2099873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003816977.1|2100120_2100801_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003816975.1|2100849_2102541_+	STAS domain-containing protein	NA	A0A2H4J153	uncultured_Caudovirales_phage	27.3	5.0e-42
WP_010930760.1|2102556_2103108_-	SRPBCC family protein	NA	NA	NA	NA	NA
WP_003816971.1|2103104_2103476_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010930761.1|2103588_2104425_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_029443822.1|2104435_2104960_-	DUF302 domain-containing protein	NA	NA	NA	NA	NA
WP_003812228.1|2105057_2105237_+	DUF3008 family protein	NA	NA	NA	NA	NA
WP_010930763.1|2105366_2106341_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003816964.1|2106471_2106828_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_010930764.1|2106817_2107693_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_010930765.1|2107791_2108676_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930766.1|2108697_2109993_-	DUF445 domain-containing protein	NA	NA	NA	NA	NA
WP_003816959.1|2110941_2111592_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010930767.1|2111679_2113200_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930768.1|2113457_2115323_+	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2116368_2117319_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268681.1|2117336_2117477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930769.1|2118291_2118651_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_010930770.1|2118638_2120075_-	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_010930771.1|2120071_2120725_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010930772.1|2120721_2121915_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_010930773.1|2122018_2123293_+	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	9.6e-14
WP_005012067.1|2123289_2124240_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 20
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2135444	2176135	4110589	protease,tRNA,transposase	Klosneuvirus(25.0%)	37	NA	NA
WP_005013747.1|2135444_2136395_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2136493_2137444_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_047122784.1|2137403_2137817_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	59.0	3.8e-36
WP_003816708.1|2138101_2138401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930783.1|2138810_2141093_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	3.2e-36
WP_124740709.1|2141558_2141753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930784.1|2141778_2143809_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.9	1.0e-65
WP_006218592.1|2143828_2144041_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003810720.1|2144318_2144858_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_023852902.1|2144971_2146267_-	adenylosuccinate synthase	NA	A0A160ER07	Powai_lake_megavirus	33.5	3.0e-63
WP_010930786.1|2146343_2147501_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_010930787.1|2147684_2148584_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_010930788.1|2148602_2149907_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_010930789.1|2149872_2150979_-	GTPase HflX	NA	NA	NA	NA	NA
WP_003810707.1|2151066_2151303_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_010930790.1|2151441_2152512_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	25.7	2.5e-15
WP_003810703.1|2152515_2153871_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_003810701.1|2153897_2155058_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_010930791.1|2155060_2155699_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_023995843.1|2155700_2156987_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010930793.1|2157045_2158341_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_003810693.1|2158347_2158854_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_004568542.1|2158850_2159999_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003810689.1|2160026_2160452_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.2	2.1e-21
WP_010930794.1|2160774_2163657_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.1	3.7e-138
WP_023852900.1|2163749_2164505_-	MipA/OmpV family protein	NA	NA	NA	NA	NA
WP_010930796.1|2165270_2166620_+	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_076879566.1|2166718_2167669_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930048.1|2167767_2168718_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930594.1|2168791_2169265_+	RidA family protein	NA	NA	NA	NA	NA
WP_010930593.1|2169290_2170499_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_003816734.1|2170495_2171269_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_014905757.1|2171268_2171892_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_010926757.1|2172057_2172318_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_010930591.1|2172621_2173203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004568544.1|2173269_2173524_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_010930590.1|2173510_2176135_-|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.4	1.7e-81
>prophage 21
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2203918	2269467	4110589	protease,tRNA,transposase	Lake_Baikal_phage(20.0%)	58	NA	NA
WP_010929577.1|2203918_2204869_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930573.1|2205069_2205879_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_005013747.1|2206003_2206954_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930572.1|2206950_2207844_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_003812452.1|2207968_2208163_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003812453.1|2208162_2208504_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_010930571.1|2208513_2210376_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	42.4	3.0e-101
WP_003812456.1|2210505_2211018_-	Fe-S protein assembly co-chaperone HscB	NA	NA	NA	NA	NA
WP_003812458.1|2211020_2211344_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	52.8	6.8e-25
WP_003812460.1|2211345_2211756_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.0	7.5e-53
WP_010930570.1|2211793_2213005_-	IscS subfamily cysteine desulfurase	NA	NA	NA	NA	NA
WP_003812463.1|2213022_2213535_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_010930569.1|2213750_2214242_-	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_010930568.1|2214494_2216531_-	excinuclease ABC subunit UvrB	NA	NA	NA	NA	NA
WP_019247244.1|2216608_2217811_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_010930566.1|2217939_2218590_+	transcriptional repressor LexA	NA	A0A2H4JG58	uncultured_Caudovirales_phage	50.7	3.3e-10
WP_005012067.1|2220147_2221098_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247934.1|2221668_2221881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247935.1|2221898_2222630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812478.1|2222664_2223306_-	CoA transferase subunit B	NA	NA	NA	NA	NA
WP_010930565.1|2223298_2223967_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_010930564.1|2226179_2226956_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010930563.1|2226977_2228135_-	thiolase	NA	NA	NA	NA	NA
WP_003812491.1|2228131_2228563_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_015063637.1|2228559_2229363_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010930561.1|2229376_2229778_-	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_010930560.1|2229844_2230816_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930559.1|2230881_2232105_-	CoA transferase	NA	NA	NA	NA	NA
WP_019247936.1|2232332_2233283_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930557.1|2233406_2235860_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.0	1.5e-220
WP_010930556.1|2236048_2237353_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	3.2e-129
WP_003812508.1|2237457_2238111_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.5	6.8e-56
WP_010930555.1|2238113_2239424_-	trigger factor	NA	NA	NA	NA	NA
WP_010930554.1|2239620_2240181_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	33.7	1.0e-23
WP_010930553.1|2240292_2240493_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.4	7.4e-14
WP_003812519.1|2240838_2241405_-	DUF924 family protein	NA	NA	NA	NA	NA
WP_010930551.1|2241488_2241692_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	62.1	1.6e-16
WP_003812524.1|2241998_2242319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003812526.1|2242360_2242642_-	membrane protein	NA	NA	NA	NA	NA
WP_010930550.1|2242716_2243973_-	autotransporter Phg	NA	NA	NA	NA	NA
WP_010930549.1|2244355_2244685_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003812536.1|2246255_2247077_+	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_010930548.1|2247076_2248216_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_019247938.1|2248222_2249119_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_010930546.1|2249115_2251041_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.8	1.1e-66
WP_010926400.1|2251400_2254013_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_003812546.1|2254065_2256366_-	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	35.9	9.9e-110
WP_003812548.1|2256362_2257571_-	fatty acid desaturase	NA	NA	NA	NA	NA
WP_010930545.1|2257832_2258207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2258203_2259154_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_076879626.1|2259252_2261247_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.3	4.4e-21
WP_010930543.1|2261306_2262272_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_010930542.1|2262261_2265123_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A1V0SJ93	Klosneuvirus	25.5	1.0e-71
WP_010930541.1|2265125_2265632_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_010930540.1|2265736_2266945_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	30.0	3.8e-36
WP_033446178.1|2266946_2267885_-	membrane protein	NA	NA	NA	NA	NA
WP_010930538.1|2268046_2268520_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012808.1|2268516_2269467_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 22
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2354595	2428783	4110589	protease,transposase	uncultured_Caudovirales_phage(10.0%)	59	NA	NA
WP_010931070.1|2354595_2355546_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003809615.1|2355847_2356324_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_019247142.1|2356947_2358585_+	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.2	8.8e-12
WP_003809610.1|2358615_2359929_-	pyrimidine permease	NA	Q9KX94	Enterobacteria_phage	67.1	2.1e-149
WP_004568205.1|2360062_2360380_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023852827.1|2360480_2361803_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010929591.1|2361799_2362750_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930836.1|2363279_2364302_-	putative 2-aminoethylphosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003820286.1|2364330_2365161_-	phosphonoacetaldehyde hydrolase	NA	NA	NA	NA	NA
WP_029443740.1|2365177_2366875_-	putative 2-aminoethylphosphonate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_010930838.1|2366939_2368016_-	putative 2-aminoethylphosphonate ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.8	1.2e-28
WP_010930839.1|2368175_2369039_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930840.1|2369069_2369639_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_010930841.1|2369655_2370507_-	sulfurtransferase	NA	NA	NA	NA	NA
WP_003813142.1|2371564_2372446_+|protease	protease HtpX	protease	NA	NA	NA	NA
WP_010930842.1|2372520_2373510_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_010930843.1|2373572_2374523_-	DMT family transporter	NA	NA	NA	NA	NA
WP_003813147.1|2374585_2375443_+	DMT family transporter	NA	NA	NA	NA	NA
WP_003813149.1|2375502_2375991_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930844.1|2377563_2378754_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_010930845.1|2378750_2380337_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010930846.1|2380355_2381423_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_010930847.1|2381527_2383072_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	25.4	3.1e-14
WP_010930848.1|2383491_2385066_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930849.1|2385173_2386190_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003813165.1|2386186_2387026_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010930850.1|2387030_2388668_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.6	3.6e-21
WP_005013747.1|2388664_2389615_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268683.1|2389632_2389776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930851.1|2389757_2391032_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.9	1.6e-24
WP_010930852.1|2391061_2391352_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_047122810.1|2391424_2392438_+	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	35.2	1.7e-42
WP_010930854.1|2392457_2393720_+	Zn-dependent hydrolase	NA	NA	NA	NA	NA
WP_010930855.1|2393722_2394646_+	DMT family transporter	NA	NA	NA	NA	NA
WP_010930856.1|2394642_2396136_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010930857.1|2396146_2397079_-	glyoxylate/hydroxypyruvate reductase A	NA	NA	NA	NA	NA
WP_076879554.1|2397260_2398586_+	aspartate aminotransferase family protein	NA	A0A1C9EHH3	Mycobacterium_phage	22.5	1.8e-07
WP_023853659.1|2398620_2399964_-	sodium:alanine symporter family protein	NA	NA	NA	NA	NA
WP_023853666.1|2400036_2401557_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.9	1.7e-78
WP_010930861.1|2401711_2402443_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010930862.1|2402510_2403851_+	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_010930863.1|2403866_2404778_+	oxygen-dependent coproporphyrinogen oxidase	NA	NA	NA	NA	NA
WP_010930864.1|2404768_2405362_+	nicotinate (nicotinamide) nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_003813196.1|2405423_2405810_+	ribosome silencing factor	NA	NA	NA	NA	NA
WP_003813199.1|2405821_2406292_+	23S rRNA (pseudouridine(1915)-N(3))-methyltransferase RlmH	NA	NA	NA	NA	NA
WP_010930865.1|2406303_2406927_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_010930866.1|2406947_2409695_-	autotransporter Vag8	NA	NA	NA	NA	NA
WP_005012808.1|2416173_2417124_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010930867.1|2417167_2418631_+	ribonuclease G	NA	NA	NA	NA	NA
WP_010930868.1|2418664_2419567_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_003813206.1|2419563_2420109_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930869.1|2420192_2421692_+	MFS transporter	NA	NA	NA	NA	NA
WP_010930870.1|2421664_2423536_-	lipid A export permease/ATP-binding protein MsbA	NA	W8CYL7	Bacillus_phage	29.5	4.2e-50
WP_010926806.1|2423551_2424517_+	heptosyltransferase II	NA	NA	NA	NA	NA
WP_010930871.1|2424529_2425294_+	YdcF family protein	NA	NA	NA	NA	NA
WP_003813217.1|2425298_2425571_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_010930872.1|2425695_2426817_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_003813221.1|2426824_2427550_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_010929956.1|2427832_2428783_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 23
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2538321	2604042	4110589	protease,tRNA,transposase	Salmonella_phage(15.38%)	60	NA	NA
WP_005012067.1|2538321_2539272_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004566380.1|2540261_2541182_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930928.1|2541201_2541789_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003813784.1|2541781_2542672_-	GTPase Era	NA	NA	NA	NA	NA
WP_023853248.1|2542668_2543430_-	ribonuclease III	NA	M4QNJ2	Ostreococcus_lucimarinus_virus	33.0	3.1e-20
WP_010930929.1|2543435_2544320_-	signal peptidase I	NA	NA	NA	NA	NA
WP_010930930.1|2544342_2546136_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.5	8.4e-24
WP_004566381.1|2546266_2547754_-|protease	DegQ family serine endoprotease	protease	W5SAB9	Pithovirus	31.5	1.2e-07
WP_010930931.1|2547791_2548850_-	MucB/RseB C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023853242.1|2548849_2549350_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003813797.1|2549362_2549962_-	RNA polymerase sigma factor RpoE	NA	A0A0F6TH34	Sinorhizobium_phage	26.1	2.2e-05
WP_010930933.1|2549958_2550459_-	membrane protein	NA	NA	NA	NA	NA
WP_003813802.1|2550460_2551690_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_003813816.1|2551879_2552119_-	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	46.6	5.4e-11
WP_003813819.1|2552301_2553054_-	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.3	6.9e-12
WP_010930934.1|2553055_2553991_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_010930935.1|2554072_2555059_-	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_003821347.1|2555058_2556117_-	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_003813827.1|2556173_2556356_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_010930936.1|2556407_2557001_-	DUF177 domain-containing protein	NA	NA	NA	NA	NA
WP_003821345.1|2557109_2557709_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_010930937.1|2557705_2558416_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010930938.1|2558417_2559245_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_003814009.1|2561061_2562303_-	MFS transporter	NA	NA	NA	NA	NA
WP_003814010.1|2562314_2563088_-	peroxide stress protein YaaA	NA	NA	NA	NA	NA
WP_005012067.1|2563114_2564065_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814011.1|2564163_2564946_-	3-hydroxybutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003814012.1|2565034_2566261_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_003814013.1|2566986_2568372_+	alcaligin siderophore biosynthesis protein AlcA	NA	NA	NA	NA	NA
WP_003814014.1|2568390_2568996_+	alcaligin siderophore biosynthesis protein AlcB	NA	NA	NA	NA	NA
WP_010930939.1|2568992_2570849_+	alcaligin siderophore biosynthesis protein AlcC	NA	NA	NA	NA	NA
WP_003814016.1|2570845_2571646_+	alcaligin siderophore biosynthesis protein AlcD	NA	NA	NA	NA	NA
WP_005013753.1|2571660_2572854_+	alcaligin siderophore biosynthesis protein AlcE	NA	NA	NA	NA	NA
WP_003814017.1|2572921_2573896_+	alcaligin siderophore biosynthesis transcriptional regulator AlcR	NA	NA	NA	NA	NA
WP_010930940.1|2574018_2575242_+	alcaligin siderophore export MFS transporter Bcr	NA	S4TR35	Salmonella_phage	29.4	9.8e-24
WP_010930941.1|2575352_2577557_+	TonB-dependent alcaligin siderophore receptor FauA	NA	NA	NA	NA	NA
WP_003814020.1|2577851_2578511_+	NAAT family transporter	NA	NA	NA	NA	NA
WP_019247690.1|2578518_2578725_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814021.1|2579063_2579819_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_003814022.1|2579834_2579996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003814023.1|2580089_2580605_+	hypothetical protein	NA	T1SAR8	Salmonella_phage	44.6	5.1e-06
WP_003814024.1|2580877_2581195_+	virulence factor	NA	NA	NA	NA	NA
WP_170954289.1|2581139_2581784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010930944.1|2581909_2583265_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	47.5	1.6e-83
WP_010930945.1|2583311_2584652_-	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	38.9	1.6e-75
WP_010930946.1|2584753_2585386_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_003814032.1|2585385_2587746_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	48.0	7.6e-81
WP_010930948.1|2587787_2588747_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	40.2	3.1e-57
WP_010929073.1|2588733_2589420_+	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_005015014.1|2589416_2589749_+	multidrug transporter	NA	NA	NA	NA	NA
WP_005012067.1|2589864_2590815_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|2590913_2591864_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814040.1|2591860_2593927_-	cation acetate symporter	NA	NA	NA	NA	NA
WP_003814042.1|2593926_2594199_-	DUF4212 domain-containing protein	NA	NA	NA	NA	NA
WP_017685545.1|2594893_2594983_+	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_010930949.1|2594982_2596767_+	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_010930950.1|2596790_2598956_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	27.1	1.2e-24
WP_003814050.1|2598966_2599566_+	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_003814052.1|2602387_2603083_+	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_005013747.1|2603091_2604042_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 24
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2690159	2730828	4110589	tRNA,transposase	Salmonella_phage(33.33%)	42	NA	NA
WP_005012067.1|2690159_2691110_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_004567479.1|2691220_2691403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931004.1|2691502_2692099_-	lipoprotein	NA	NA	NA	NA	NA
WP_010931005.1|2692282_2693374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003812822.1|2693873_2694284_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931006.1|2694342_2694684_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	42.2	2.8e-13
WP_010931007.1|2694689_2697107_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_010926359.1|2697119_2698142_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.6	1.0e-26
WP_003812832.1|2698216_2698576_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_003812834.1|2698591_2698789_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_010929584.1|2699124_2700075_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003816756.1|2700269_2700719_+	dUTP diphosphatase	NA	S4TNT3	Salmonella_phage	67.2	3.7e-45
WP_005012808.1|2700715_2701666_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931008.1|2701776_2703225_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931009.1|2703339_2703621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005013747.1|2703724_2704675_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003820420.1|2704919_2705633_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_019247724.1|2705755_2705983_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003816758.1|2706277_2706916_-	DedA family protein	NA	NA	NA	NA	NA
WP_010931011.1|2707024_2708059_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_010929591.1|2708055_2709006_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931012.1|2709421_2709946_-	DNA-binding protein	NA	J9Q7G7	Salmonella_phage	32.9	6.5e-09
WP_004567322.1|2709949_2710219_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931013.1|2710417_2711479_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_010931014.1|2711562_2713197_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.1	2.9e-15
WP_010931015.1|2713198_2714002_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931016.1|2714030_2714990_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931017.1|2714993_2716508_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_019248147.1|2716544_2717549_-	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931018.1|2717980_2718451_-	DUF1801 domain-containing protein	NA	NA	NA	NA	NA
WP_010931019.1|2718486_2719098_-	LysE family translocator	NA	NA	NA	NA	NA
WP_010931020.1|2719128_2719752_-	FMN-binding negative transcriptional regulator	NA	NA	NA	NA	NA
WP_010931021.1|2719832_2721365_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931022.1|2721399_2722641_-	MFS transporter	NA	NA	NA	NA	NA
WP_010931023.1|2722684_2723716_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A2K9L339	Tupanvirus	27.8	1.8e-26
WP_010931024.1|2723712_2724882_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_010931025.1|2724875_2725556_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931026.1|2725717_2726560_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931027.1|2726722_2727694_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010931028.1|2727865_2728744_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_010931029.1|2728766_2729837_-	FUSC family protein	NA	NA	NA	NA	NA
WP_005013747.1|2729877_2730828_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 25
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2786293	2859163	4110589	tRNA,transposase	Moraxella_phage(16.67%)	58	NA	NA
WP_003810909.1|2786293_2786710_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_010931061.1|2786820_2787453_+	7-carboxy-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_010931062.1|2787481_2787925_+	6-carboxytetrahydropterin synthase QueD	NA	NA	NA	NA	NA
WP_003810897.1|2787946_2789038_-	TRAP transporter substrate-binding protein DctP	NA	NA	NA	NA	NA
WP_010931063.1|2789092_2789893_-	aldolase	NA	NA	NA	NA	NA
WP_010931064.1|2790028_2790649_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_010931065.1|2790788_2791262_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|2792401_2793352_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931066.1|2793348_2801010_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.9	7.3e-24
WP_010931067.1|2801250_2805297_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	67.4	6.3e-160
WP_003816847.1|2805609_2806191_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_010931068.1|2806187_2807486_+	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_010931069.1|2807565_2808594_+	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_010931070.1|2808854_2809805_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010927663.1|2809801_2810752_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931071.1|2811068_2811674_+	fimbrial major subunit FimX	NA	NA	NA	NA	NA
WP_010931072.1|2811727_2813041_-	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_003813284.1|2813115_2813586_-	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_010931073.1|2813585_2814374_-	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_010931074.1|2814384_2816037_-	phenylacetic acid degradation protein PaaN	NA	NA	NA	NA	NA
WP_010929591.1|2816124_2817075_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931075.1|2818236_2818743_-	phenylacetate-CoA oxygenase subunit PaaJ	NA	NA	NA	NA	NA
WP_003813293.1|2818739_2819504_-	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_010931076.1|2819519_2819804_-	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_003813298.1|2819868_2820858_-	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_010931077.1|2821029_2821959_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_003813302.1|2821930_2822617_-	NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_003813303.1|2822650_2823196_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	37.7	2.1e-26
WP_003813306.1|2823240_2824506_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_003813309.1|2824502_2825405_+	ribosome small subunit-dependent GTPase A	NA	NA	NA	NA	NA
WP_019247679.1|2826586_2827531_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931079.1|2827625_2829143_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931080.1|2829184_2830813_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003811986.1|2830920_2831802_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931081.1|2834914_2835289_+	endonuclease	NA	F4YXR7	Roseobacter_phage	54.4	2.1e-25
WP_003812004.1|2835313_2835652_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931082.1|2835695_2837330_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	36.6	8.3e-87
WP_010931083.1|2837368_2838715_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_003812010.1|2838822_2840244_+	argininosuccinate lyase	NA	NA	NA	NA	NA
WP_010931084.1|2840313_2840898_-	nitroreductase	NA	NA	NA	NA	NA
WP_005012067.1|2841000_2841951_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931085.1|2842085_2843192_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010931086.1|2843202_2844300_+	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_010931087.1|2844444_2845650_-	molybdopterin molybdotransferase MoeA	NA	NA	NA	NA	NA
WP_010931088.1|2845656_2846178_-	molybdenum cofactor biosynthesis protein B	NA	NA	NA	NA	NA
WP_010931089.1|2846174_2846666_-	molybdenum cofactor biosynthesis protein MoaE	NA	NA	NA	NA	NA
WP_003819740.1|2846662_2846914_-	MoaD/ThiS family protein	NA	NA	NA	NA	NA
WP_003819741.1|2846894_2847380_-	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_010931090.1|2847515_2850977_+	DUF748 domain-containing protein	NA	NA	NA	NA	NA
WP_010931091.1|2850994_2851879_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_010931092.1|2851888_2852320_-	lipoprotein	NA	NA	NA	NA	NA
WP_003809348.1|2852566_2853070_+	peroxiredoxin	NA	M1I839	Pelagibacter_phage	44.1	1.8e-24
WP_010931094.1|2853147_2854548_+	MFS transporter	NA	NA	NA	NA	NA
WP_010931095.1|2854622_2855498_-	membrane protein	NA	NA	NA	NA	NA
WP_023853546.1|2855494_2856502_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_010931097.1|2856969_2857275_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_003819753.1|2857365_2857956_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010930525.1|2858146_2859163_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 26
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2862306	2929117	4110589	protease,transposase	uncultured_Mediterranean_phage(28.57%)	50	NA	NA
WP_023995489.1|2862306_2863257_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|2863355_2864306_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931099.1|2864302_2865097_-	N-formylglutamate deformylase	NA	NA	NA	NA	NA
WP_010931100.1|2865128_2865833_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_010931101.1|2865907_2866708_-	SURF1 family protein	NA	NA	NA	NA	NA
WP_003809276.1|2866704_2867112_-	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_003819722.1|2867108_2867750_-	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_010931102.1|2867742_2869743_-	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_010931103.1|2871003_2872335_+	MFS transporter	NA	NA	NA	NA	NA
WP_005012067.1|2872331_2873282_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931105.1|2874988_2875255_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_003812839.1|2875962_2876301_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010931107.1|2880854_2881457_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931108.1|2881553_2882843_+	MFS transporter	NA	NA	NA	NA	NA
WP_003812846.1|2882900_2883632_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	1.4e-12
WP_010931109.1|2883628_2884432_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.5	7.9e-14
WP_003812851.1|2884428_2885517_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_003820410.1|2885513_2886443_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003812857.1|2886591_2887737_-	branched-chain amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930800.1|2887758_2888709_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_154698391.1|2888726_2888885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931110.1|2889039_2892861_-	trifunctional transcriptional regulator/proline dehydrogenase/L-glutamate gamma-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_010931111.1|2893017_2893686_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_014905522.1|2893690_2895364_-	MCE family protein	NA	NA	NA	NA	NA
WP_003820402.1|2895382_2896702_-	PqiA/YebS family transporter subunit	NA	NA	NA	NA	NA
WP_010931114.1|2896706_2899022_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	41.9	4.1e-164
WP_010931115.1|2899077_2901246_-	penicillin-binding protein 1C	NA	NA	NA	NA	NA
WP_010931116.1|2901242_2906432_-	alpha-2-macroglobulin family protein	NA	NA	NA	NA	NA
WP_003820400.1|2906521_2906836_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	43.8	1.2e-10
WP_003812875.1|2907063_2907309_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	76.6	1.3e-20
WP_003820399.1|2907403_2907922_+	DUF192 domain-containing protein	NA	A0A1B1IUW8	uncultured_Mediterranean_phage	42.2	5.1e-14
WP_010931117.1|2908021_2909227_-	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_019247560.1|2909342_2910740_-	chloride channel protein	NA	NA	NA	NA	NA
WP_010931119.1|2910856_2911435_-	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_010931120.1|2911507_2912899_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	32.0	1.4e-29
WP_005012067.1|2913066_2914017_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003812889.1|2914297_2914918_+	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_010931122.1|2914914_2915328_+	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_010931123.1|2915324_2916368_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_003812895.1|2916423_2916612_+	Trm112 family protein	NA	NA	NA	NA	NA
WP_010931124.1|2916621_2917386_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_010931125.1|2917476_2918133_+	adenylate kinase	NA	NA	NA	NA	NA
WP_010931126.1|2918224_2918983_+	3-hydroxyacyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_010931127.1|2919008_2920610_+	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_010931128.1|2920810_2921815_+	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_003812908.1|2921915_2922179_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_010931129.1|2922296_2923073_-	2-dehydro-3-deoxyglucarate aldolase	NA	NA	NA	NA	NA
WP_005012067.1|2923663_2924614_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931130.1|2926997_2928110_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_005012808.1|2928166_2929117_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 27
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	2959503	2998692	4110589	transposase	Planktothrix_phage(50.0%)	37	NA	NA
WP_005012067.1|2959503_2960454_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_162268686.1|2960471_2960621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023852715.1|2960574_2961471_-	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003814547.1|2963748_2965974_+	glycoside hydrolase family 31 protein	NA	NA	NA	NA	NA
WP_003814544.1|2966138_2967227_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	36.4	8.7e-32
WP_019247918.1|2967183_2967837_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931144.1|2967884_2968682_+	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010930176.1|2969213_2970164_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247277.1|2970238_2971393_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_005012067.1|2971449_2972400_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814535.1|2972498_2972804_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003820797.1|2972832_2973267_-	DUF126 domain-containing protein	NA	NA	NA	NA	NA
WP_010931147.1|2973268_2974513_-	DUF521 domain-containing protein	NA	NA	NA	NA	NA
WP_003820799.1|2974509_2975220_-	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_033446288.1|2975234_2976146_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010931149.1|2976508_2976913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019247890.1|2976909_2977368_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_019247891.1|2977374_2978283_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_010931150.1|2978279_2979146_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_003814524.1|2979132_2979960_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_003820806.1|2979970_2981098_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.3	1.2e-23
WP_023852748.1|2982175_2983414_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931152.1|2983455_2984718_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_010931153.1|2984724_2985477_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_019248355.1|2985528_2985714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003820813.1|2985989_2986454_+	redox-sensitive transcriptional activator SoxR	NA	NA	NA	NA	NA
WP_003820814.1|2986485_2987145_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_010931154.1|2987289_2989398_+	AsmA family protein	NA	NA	NA	NA	NA
WP_023852714.1|2989394_2990345_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931155.1|2990448_2991069_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931156.1|2991160_2991913_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_019248356.1|2993047_2994172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019247402.1|2994217_2994586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2994827_2995778_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247492.1|2996813_2997356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023998107.1|2997553_2997724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005012067.1|2997741_2998692_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 29
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	3317007	3386188	4110589	protease,tRNA,integrase,transposase	Tupanvirus(22.22%)	50	3307836:3307895	3379414:3380457
3307836:3307895	attL	TGTGAACTGTCAATAGGTTGTATTCGTCCAGGTTGAGTCTGGAGATGGGTACAGCGCGCC	NA	NA	NA	NA
WP_005012067.1|3317007_3317958_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274087.1|3320823_3321318_-	DUF4276 family protein	NA	NA	NA	NA	NA
WP_010931070.1|3321334_3322285_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931301.1|3322468_3323680_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010931302.1|3323695_3326647_-	restriction endonuclease subunit M	NA	G8I4P9	Mycobacterium_phage	25.1	2.9e-21
WP_010931303.1|3326648_3329768_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_010931304.1|3329915_3330962_-	Fic family protein	NA	NA	NA	NA	NA
WP_010931305.1|3331303_3332431_-|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	33.6	1.4e-48
WP_010931306.1|3332710_3333802_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010931307.1|3333874_3334657_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_010931308.1|3334653_3335250_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_029443719.1|3335378_3335993_-	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_010931310.1|3336115_3337066_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	35.5	7.3e-43
WP_010931311.1|3337274_3338174_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003818921.1|3338222_3338822_-	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_010931312.1|3338818_3340705_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_010925978.1|3340703_3341531_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	NA	NA	NA	NA
WP_010931313.1|3341621_3342575_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_003808489.1|3342676_3344356_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003808487.1|3344367_3344577_+	DUF2783 domain-containing protein	NA	NA	NA	NA	NA
WP_010931314.1|3344586_3345495_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003818930.1|3345677_3346976_+	homogentisate 1,2-dioxygenase	NA	NA	NA	NA	NA
WP_003818932.1|3347084_3348398_+	fumarylacetoacetase	NA	NA	NA	NA	NA
WP_010931315.1|3348523_3350485_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_010931316.1|3350564_3351887_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_003818936.1|3351883_3352594_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010931317.1|3352611_3354027_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_003808465.1|3354118_3354730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010931319.1|3355008_3356391_+	phosphomannomutase/phosphoglucomutase	NA	A0A127AWJ1	Bacillus_phage	31.6	6.2e-51
WP_003808462.1|3356397_3357963_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_010931320.1|3357970_3359101_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931321.1|3359097_3360252_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_010931322.1|3360248_3361370_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931323.1|3361366_3363292_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A2K9R7N5	Dishui_lake_phycodnavirus	29.0	1.0e-27
WP_010931324.1|3363338_3364475_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931325.1|3364475_3365846_-	polysaccharide biosynthesis C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010930472.1|3365847_3366873_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosaminuronic acid C-4 epimerase TviC	NA	A0A2K9L4U8	Tupanvirus	44.2	4.7e-72
WP_171024626.1|3366884_3368162_-	Vi polysaccharide biosynthesis UDP-N-acetylglucosamine C-6 dehydrogenase TviB	NA	NA	NA	NA	NA
WP_003808448.1|3368264_3369368_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_010931327.1|3370096_3370765_-	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003808444.1|3370888_3371326_+	OsmC family protein	NA	NA	NA	NA	NA
WP_010931328.1|3371378_3372350_+	thymidylate synthase	NA	J7KKN7	Erwinia_phage	33.3	4.8e-50
WP_003816386.1|3372380_3372878_+	dihydrofolate reductase	NA	A0A140HLG8	Bacillus_phage	38.9	3.0e-24
WP_010931330.1|3372841_3374299_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.1	7.6e-15
WP_010931331.1|3374481_3375807_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_010931332.1|3377584_3379150_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005012808.1|3379408_3380359_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931334.1|3381188_3382076_+	ABC transporter permease	NA	NA	NA	NA	NA
3379414:3380457	attR	TGTGAACTGTCAATAGGTTGTATTCGTCCAGGTTGAGTCTGGAGATGGGTACAGCGCGCCCGATGCCTTGGTGGGGTCGATGCCAGTTGTAGTGGTGTAGCCAGGATTTCATGGCATCGGCTCGGTGTTGGGAGTTCTGGTAGGTGTGAGCGTAAGCCCACTCACGCAAGGCCGACTGGATGAAGCGTTCGGCCTTGCCATTGGTCTGTGGGCGGTAAGGTCGGGTAAAGCGGTGCTTGATGCCCAGCTCATGGCACAGCGCGGCGAAGGCGCGGCTGCGAAAGGCCGAGCCATTGTCGGTGAGCAAGCGCTGGATGGTCACGCCCAGGCGCTGGTAGTAGGCCACTGCGTCCTTGAGGAACTGGACGGCGCTGGGGAAGCGCTCGTCGGGGTGGATGTCGGTGAAGGCCACGCGGGCGTGGTCATCGATGGCCACGAAGACGAAGTCCCAGCCGGCCCCCTCAACGGTATCGCGTCGGTTGCCCGTGACCCGGTGGCCAGGGCGCTGGATACGTCCCAGCTTCTTGATGTCGATGTGCAGCAGATCGCCGGGGGCCTGATGCTCGTAGCGCACCACCGGCTCGGCCGGCTCCAGGTCGGCCAGGTGCGACAGACCGGCGCGGGCCAGGACGCGGCTGACGGTGCTGGCTGACACGCCCAGCGCCTGGGCGATGCGCGCTTGGGTCAGCCGCTTGCGGCGCAGCTCCACGATAGCCAGCGCCTTGGCCGGCGCAATCGCTCGGGGCGAGACCGTCGGGCGCGAGGACGCATCGGCCAAGCCCGCCTGGCCCTGAGCCAGGAAGCGGCCCAGCCATTTGCGCACAGTCGGCGCGGTGACCCCATAGGCGCGGGCCGCTTCAGGCACACAAACTTGATGGGCGATCAATTGCTGGACCATTTCGAGTCGACGTAGGAAGGTCAATCGGGCATGCTTATGGGTGTTCATCCGGCCGGGCTCCTTGAGTGAACTGGGGGGGTGGCGATTTCCAGTTTCTCAAATCCGGTTCGGATGAACCATGCATACAACCTATTGAATCTTCACAG	NA	NA	NA	NA
WP_010931335.1|3383663_3385139_+	M81 family metallopeptidase	NA	NA	NA	NA	NA
WP_023995489.1|3385237_3386188_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 30
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	3405099	3468932	4110589	tRNA,transposase	Staphylococcus_phage(12.5%)	47	NA	NA
WP_005012067.1|3405099_3406050_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931344.1|3406816_3407911_-	CoA transferase	NA	NA	NA	NA	NA
WP_019247312.1|3407903_3409238_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_003808193.1|3409191_3409875_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003808195.1|3409900_3411064_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_004566224.1|3411060_3412062_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931346.1|3412061_3412934_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_010931347.1|3412930_3413680_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	1.9e-09
WP_010931348.1|3413676_3414468_-	ATP-binding cassette domain-containing protein	NA	A0A1M7XV31	Cedratvirus	29.4	1.7e-08
WP_010931349.1|3414464_3415604_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_047122778.1|3415879_3416665_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_014486103.1|3416698_3417481_+	crotonase/enoyl-CoA hydratase family protein	NA	NA	NA	NA	NA
WP_010931351.1|3417484_3417874_+	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_010931352.1|3419013_3419877_+	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_010931353.1|3419912_3421001_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_010931070.1|3420997_3421948_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247959.1|3422301_3425280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003818344.1|3426206_3427085_+	fatty acid desaturase	NA	NA	NA	NA	NA
WP_005013747.1|3429033_3429984_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931354.1|3429980_3430448_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	50.7	5.6e-36
WP_010931355.1|3430490_3431261_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010927090.1|3431281_3432082_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_010931356.1|3432092_3433502_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_003814739.1|3433596_3434382_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_010931561.1|3434621_3435638_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814742.1|3435745_3436138_-	OsmC family protein	NA	NA	NA	NA	NA
WP_010931357.1|3436275_3436956_+	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_023994844.1|3436960_3437932_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_010930179.1|3438027_3438978_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003814239.1|3440482_3441184_+	response regulator	NA	W8CYM9	Bacillus_phage	36.6	5.6e-32
WP_010927010.1|3441183_3442608_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_010931361.1|3443677_3445018_-	cytochrome ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_003820957.1|3445133_3446897_+|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	50.0	5.0e-162
WP_010931362.1|3447008_3447887_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_003814250.1|3447999_3448815_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003814252.1|3448818_3449070_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_010929632.1|3449154_3450171_-|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
WP_003814254.1|3450501_3450723_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_019247693.1|3453083_3454001_-	DMT family transporter	NA	NA	NA	NA	NA
WP_019247692.1|3454498_3455707_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931365.1|3455786_3457358_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003814275.1|3457475_3458411_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_003814277.1|3458599_3459544_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	23.2	8.4e-07
WP_003814283.1|3460111_3465829_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	39.5	1.0e-195
WP_010931367.1|3465834_3466962_+	aminodeoxychorismate synthase component I	NA	S4VT78	Pandoravirus	37.8	3.8e-38
WP_003814287.1|3467017_3467644_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_010931363.1|3467915_3468932_+|transposase	IS110-like element IS1663 family transposase	transposase	NA	NA	NA	NA
>prophage 31
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	3473346	3540731	4110589	tRNA,transposase	Acinetobacter_phage(33.33%)	59	NA	NA
WP_019247745.1|3473346_3474219_-|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_003814298.1|3474487_3475708_+	MFS transporter	NA	NA	NA	NA	NA
WP_003814300.1|3475704_3476364_+	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_003814302.1|3476435_3477068_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_010931372.1|3477097_3477616_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_010931373.1|3477626_3478736_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003814312.1|3478782_3479637_+	formyltetrahydrofolate deformylase	NA	NA	NA	NA	NA
WP_010931374.1|3479638_3480541_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005012067.1|3481763_3482714_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023997720.1|3484470_3485460_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_019247413.1|3485456_3485615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931375.1|3485635_3486424_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	53.0	5.1e-66
WP_003817833.1|3486420_3487452_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	42.7	7.4e-73
WP_003815390.1|3487470_3488034_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	62.1	1.1e-65
WP_010931376.1|3488089_3489610_-	anthranilate synthase component I	NA	S4VT78	Pandoravirus	32.1	9.0e-43
WP_010931377.1|3489873_3490578_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003815384.1|3490585_3491323_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003815381.1|3491428_3491803_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003815379.1|3491845_3493135_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_010931378.1|3493131_3494301_+	UbiH/UbiF family hydroxylase	NA	NA	NA	NA	NA
WP_010931379.1|3494297_3495137_+	thiol:disulfide interchange protein DsbC	NA	NA	NA	NA	NA
WP_010931380.1|3495196_3496132_+	D-2-hydroxyacid dehydrogenase family protein	NA	A0A1J0F959	Only_Syngen_Nebraska_virus	27.7	6.4e-15
WP_005012067.1|3496144_3497095_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931381.1|3497193_3498156_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	64.5	4.6e-93
WP_003817821.1|3498187_3498547_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_010931382.1|3498671_3499574_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	24.0	1.9e-08
WP_010931383.1|3499575_3501348_-	M61 family metallopeptidase	NA	NA	NA	NA	NA
WP_003815367.1|3501382_3502159_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_023852617.1|3503482_3504433_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_003815365.1|3505284_3505605_+	ATP synthase subunit I	NA	NA	NA	NA	NA
WP_003815364.1|3505677_3506559_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_003815363.1|3506675_3506918_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_010931385.1|3507055_3507526_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_003815348.1|3507538_3508078_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_010931386.1|3508112_3509654_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_003817813.1|3509752_3510658_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_010931387.1|3510700_3512101_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_003815341.1|3512110_3512533_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_010931388.1|3512715_3513600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010931389.1|3513675_3514752_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_019247688.1|3515058_3517161_+	primosomal protein N'	NA	NA	NA	NA	NA
WP_010931391.1|3517203_3519273_+	UvrD-helicase domain-containing protein	NA	A7KV33	Bacillus_phage	37.3	2.6e-101
WP_005012808.1|3519371_3520322_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931392.1|3520450_3521584_-	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_010931393.1|3521627_3522533_-	hydrolase	NA	NA	NA	NA	NA
WP_023852622.1|3522535_3524236_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.7	1.0e-15
WP_010931394.1|3524232_3525153_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003817805.1|3525160_3526138_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010931395.1|3526196_3527231_-	succinylglutamate desuccinylase/aspartoacylase family protein	NA	NA	NA	NA	NA
WP_003815317.1|3529205_3529442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023995266.1|3529568_3530432_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_003815315.1|3530520_3531342_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003815313.1|3531421_3532159_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931397.1|3532155_3533148_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003817794.1|3533261_3533924_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931399.1|3533968_3535117_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010931400.1|3537440_3538391_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_014486105.1|3538731_3539682_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005013747.1|3539780_3540731_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 33
NZ_CP011714	Bordetella pertussis strain H910 chromosome, complete genome	4110589	4032760	4086192	4110589	transposase	Planktothrix_phage(40.0%)	46	NA	NA
WP_010931661.1|4032760_4033711_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010931662.1|4033880_4035107_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_010931663.1|4035306_4036173_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_003815027.1|4036165_4037128_+	Nudix family hydrolase	NA	A0A221LFJ1	Barns_Ness_breadcrumb_sponge_sobemo-like_virus	53.4	1.9e-06
WP_010927663.1|4037228_4038179_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_005012067.1|4038277_4039228_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_010929577.1|4039326_4040277_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_023994937.1|4040273_4041767_-	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_003815032.1|4041763_4044871_-	multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931665.1|4044867_4047936_-	MdtB/MuxB family multidrug efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_010931666.1|4047932_4049183_-	MdtA/MuxA family multidrug efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_003815038.1|4049363_4050125_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_019247320.1|4050157_4050808_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_003820519.1|4050810_4051650_-	prepilin peptidase	NA	NA	NA	NA	NA
WP_003815047.1|4051890_4052634_+	copper resistance protein NlpE N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003815049.1|4052716_4053064_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003815051.1|4053161_4054004_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_003815053.1|4054048_4054936_-	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_003815055.1|4054962_4055151_-	DUF3460 family protein	NA	NA	NA	NA	NA
WP_010931669.1|4055248_4056706_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_010931670.1|4056692_4058219_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_003815061.1|4058237_4058705_-	CopD family protein	NA	NA	NA	NA	NA
WP_010931671.1|4058704_4059727_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_169507388.1|4059847_4060567_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.9	4.7e-34
WP_003815066.1|4060642_4061743_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815068.1|4061744_4062935_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_003815070.1|4063054_4064071_-	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	42.1	1.0e-71
WP_003815073.1|4064389_4065061_+	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	38.2	9.5e-29
WP_010927126.1|4065057_4065966_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_010931672.1|4066177_4066825_+	chemoreceptor glutamine deamidase CheD	NA	NA	NA	NA	NA
WP_010931673.1|4070676_4071753_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_003815084.1|4071763_4072573_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003815086.1|4072662_4073436_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023853189.1|4073436_4073601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010930363.1|4073618_4074569_+|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
WP_077274100.1|4074457_4075480_+	CoA transferase	NA	NA	NA	NA	NA
WP_010931674.1|4075469_4076624_+	CoA transferase	NA	NA	NA	NA	NA
WP_010931675.1|4076663_4078076_+	MmgE/PrpD family protein	NA	NA	NA	NA	NA
WP_019247370.1|4078200_4079067_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010931677.1|4079068_4079893_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_023853488.1|4079889_4080651_+	nitroreductase	NA	M1I6Q5	Acanthocystis_turfacea_Chlorella_virus	31.0	2.0e-19
WP_003808010.1|4080731_4081418_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010931679.1|4081591_4082599_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_003819309.1|4082595_4083375_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_010931680.1|4083432_4084695_+	CoA transferase	NA	NA	NA	NA	NA
WP_010929591.1|4085241_4086192_-|transposase	IS481-like element IS481 family transposase	transposase	NA	NA	NA	NA
