The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	1788294	1797741	5599927	protease,tRNA	Dickeya_phage(16.67%)	8	NA	NA
WP_023297315.1|1788294_1789410_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
WP_023297316.1|1789406_1791347_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.5	5.0e-38
WP_002896516.1|1791413_1791635_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_002896520.1|1791960_1792278_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_012542332.1|1792308_1794588_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	3.7e-165
WP_001040187.1|1794706_1794925_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_047666244.1|1795275_1795980_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_022065908.1|1796019_1797741_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	32.8	1.5e-14
>prophage 2
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	1894057	1972394	5599927	integrase,tail,head,portal,terminase,protease,capsid,plate	Enterobacteria_phage(43.24%)	84	1935679:1935701	1970877:1970899
WP_002898458.1|1894057_1894717_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
WP_012968604.1|1894985_1896611_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023297339.1|1897148_1899575_+	glycogen/starch/alpha-glucan phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	41.4	5.5e-10
WP_023297340.1|1899639_1899978_+	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_023297341.1|1900016_1901552_-	cyclic diguanylate phosphodiesterase	NA	NA	NA	NA	NA
WP_004179245.1|1901954_1902971_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_008805909.1|1902992_1904567_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_023297343.1|1904568_1905597_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	30.1	1.9e-12
WP_008805910.1|1905840_1906761_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	5.3e-14
WP_004183598.1|1906757_1907591_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004183607.1|1907852_1908620_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_008805913.1|1908633_1908975_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_008805914.1|1908990_1909866_-	[formate-C-acetyltransferase]-activating enzyme	NA	NA	NA	NA	NA
WP_077139098.1|1909831_1912129_-	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	46.2	1.0e-05
WP_004179264.1|1912178_1912499_-	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_032735166.1|1912519_1913596_-	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_023297345.1|1913905_1916407_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.4	3.9e-11
WP_008805919.1|1916444_1917410_-	oxidoreductase	NA	NA	NA	NA	NA
WP_077139099.1|1917466_1918915_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_008805921.1|1918933_1920058_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_032753974.1|1920094_1921702_-	BCCT family transporter	NA	NA	NA	NA	NA
WP_022065457.1|1922234_1923320_-	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_008805923.1|1923402_1924365_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_008805924.1|1924361_1925642_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_023297349.1|1925644_1927132_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_002898590.1|1927452_1928010_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_162494428.1|1928035_1928788_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_008805927.1|1929013_1930435_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_008805929.1|1930788_1932180_+	APC family permease	NA	NA	NA	NA	NA
WP_002898600.1|1932299_1932422_-	small membrane protein	NA	NA	NA	NA	NA
WP_023297351.1|1932678_1932900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_008805931.1|1932920_1933709_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_012542276.1|1933824_1934274_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023297352.1|1934426_1935674_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
1935679:1935701	attL	AAAAACCCGGAGCAATCCGGGTT	NA	NA	NA	NA
WP_044784190.1|1935770_1936778_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.8	1.7e-98
WP_040150881.1|1936865_1937168_-	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	51.0	1.9e-21
WP_004201487.1|1937262_1937595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087638608.1|1937804_1937984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004201494.1|1937995_1938235_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_077139494.1|1938237_1938510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023279602.1|1938578_1938803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139100.1|1938799_1939378_+	3'-5' exoribonuclease	NA	A0A1Q1PW66	Pseudoalteromonas_phage	38.0	4.5e-27
WP_077139101.1|1939386_1939614_+	hypothetical protein	NA	A0A286S1P6	Klebsiella_phage	40.6	5.5e-05
WP_077139102.1|1939610_1939805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139103.1|1939797_1940751_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	55.0	2.1e-82
WP_158520298.1|1940925_1941087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139104.1|1941063_1941441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077139105.1|1941439_1944067_+	replication endonuclease	NA	A0A0M4RTM8	Salmonella_phage	52.4	2.3e-195
WP_077139106.1|1944063_1944297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139107.1|1944964_1945696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139108.1|1946151_1947198_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	69.1	1.3e-141
WP_077139109.1|1947197_1948919_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	64.9	7.1e-222
WP_077139110.1|1949078_1949912_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	64.1	3.2e-95
WP_077139111.1|1949936_1950986_+|capsid	phage major capsid protein, P2 family	capsid	A0A0M3ULA3	Salmonella_phage	54.8	7.4e-105
WP_077139112.1|1951033_1951948_+|terminase	terminase	terminase	B9A7B6	Serratia_phage	74.5	1.5e-85
WP_077139113.1|1952050_1952548_+|head	head completion/stabilization protein	head	B9A7B7	Serratia_phage	68.5	6.5e-59
WP_077139114.1|1952547_1952748_+|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	66.2	2.3e-15
WP_044784790.1|1952738_1953020_+	hypothetical protein	NA	B9A7B8	Serratia_phage	57.1	1.4e-18
WP_077139115.1|1953016_1953568_+	lysozyme	NA	Q1I0Z1	Pasteurella_virus	40.8	1.6e-29
WP_145952626.1|1953564_1953954_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_077139117.1|1954098_1954557_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	48.4	5.6e-33
WP_077139118.1|1954553_1955195_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	47.3	4.5e-44
WP_077139119.1|1955194_1955779_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	63.5	5.1e-63
WP_077139120.1|1955775_1956141_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	59.1	1.0e-29
WP_077139121.1|1956127_1957027_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	60.2	4.4e-90
WP_077139122.1|1957019_1957616_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	47.9	2.1e-40
WP_158520299.1|1957620_1959990_+	hypothetical protein	NA	A0A1U9WR19	Escherichia_phage	47.1	2.9e-08
WP_077139124.1|1959992_1960256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145952627.1|1960248_1960437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139125.1|1960442_1961630_+|tail	phage tail protein	tail	S4TP62	Salmonella_phage	52.2	2.3e-46
WP_077139126.1|1961729_1962584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077139127.1|1962858_1963347_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	60.5	4.4e-52
WP_077139128.1|1963356_1966302_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	43.8	3.6e-205
WP_077139129.1|1966282_1966423_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	74.4	2.0e-10
WP_032421199.1|1966455_1966755_-|tail	phage tail assembly protein	tail	B9A7B2	Serratia_phage	71.9	7.7e-31
WP_023328126.1|1966808_1967324_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	68.8	3.1e-64
WP_077139130.1|1967323_1968505_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7NV69	Enterobacteria_phage	69.3	8.0e-156
WP_077139131.1|1968658_1969813_+	phage late control D family protein	NA	B9A7A9	Serratia_phage	80.4	9.5e-178
WP_077139132.1|1969857_1970106_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_077139133.1|1970121_1970343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077139134.1|1970382_1970769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008805934.1|1970939_1971167_-	hypothetical protein	NA	NA	NA	NA	NA
1970877:1970899	attR	AAAAACCCGGAGCAATCCGGGTT	NA	NA	NA	NA
WP_008805935.1|1971187_1971784_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_071822048.1|1972220_1972394_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 3
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	2091103	2149593	5599927	integrase,tail,tRNA,head,portal,holin,terminase,capsid	Klebsiella_phage(46.34%)	57	2085457:2085472	2139925:2139940
2085457:2085472	attL	GTATCTGCCCGCTGGC	NA	NA	NA	NA
WP_012542211.1|2091103_2092210_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_008806030.1|2092266_2092725_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_032729972.1|2092741_2093392_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_008806032.1|2093632_2094883_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_077139140.1|2095001_2096129_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	58.4	2.6e-119
WP_012542206.1|2096109_2096355_-	excisionase	NA	NA	NA	NA	NA
WP_077139141.1|2096407_2098546_-	exonuclease	NA	S4TNL0	Salmonella_phage	42.7	2.5e-99
WP_014228879.1|2098687_2099032_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_077139142.1|2099074_2099269_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_040234937.1|2099659_2099974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014228883.1|2100303_2100687_-	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	63.5	5.1e-19
WP_023328112.1|2100788_2101013_+	helix-turn-helix transcriptional regulator	NA	A0A077K9X2	Edwardsiella_phage	55.2	3.0e-11
WP_048270562.1|2101015_2101570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012542197.1|2101621_2102605_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	56.4	3.6e-45
WP_012542196.1|2102597_2103062_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	70.2	1.7e-61
WP_032754004.1|2103075_2103516_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032754005.1|2103828_2105592_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_021462586.1|2106038_2106266_-	DUF1737 domain-containing protein	NA	NA	NA	NA	NA
WP_021462587.1|2106584_2107331_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	29.8	3.0e-07
WP_021462588.1|2107401_2108091_-	YafY family transcriptional regulator	NA	A0A1B0RXM1	Streptococcus_phage	29.8	5.4e-11
WP_032754006.1|2108529_2108763_+	DinI family protein	NA	K7PM44	Enterobacteria_phage	67.1	1.3e-22
WP_077274161.1|2109105_2109498_+	DNA-binding protein	NA	K7PHB4	Enterobacterial_phage	36.6	6.1e-12
WP_077139143.1|2109697_2110729_+	DUF968 domain-containing protein	NA	S5MW46	Escherichia_phage	50.1	6.6e-98
WP_077139144.1|2110741_2111089_+	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	88.5	4.7e-56
WP_069134952.1|2111112_2112291_-	hypothetical protein	NA	A0A291AUQ1	Sinorhizobium_phage	29.9	1.5e-45
WP_040234927.1|2112280_2113312_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_017880269.1|2114209_2114425_+|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	87.3	7.9e-30
WP_077139145.1|2114424_2114922_+	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	87.0	1.5e-79
WP_012542173.1|2114918_2115269_+	hypothetical protein	NA	A0A0K2FIW3	Enterobacter_phage	36.8	3.5e-11
WP_145952629.1|2116217_2116637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032749552.1|2116692_2116917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162838183.1|2117095_2117260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032428746.1|2117243_2117606_+	HNH endonuclease	NA	Q6UAS2	Klebsiella_phage	83.3	1.2e-57
WP_077139147.1|2117557_2117881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014907818.1|2117877_2118309_+	hypothetical protein	NA	Q6UAS0	Klebsiella_phage	61.6	1.8e-41
WP_012542168.1|2118557_2118992_+|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	61.9	9.4e-30
WP_014228904.1|2118991_2120713_+|terminase	terminase large subunit	terminase	Q7Y413	Yersinia_phage	57.2	7.2e-190
WP_020318187.1|2120706_2120886_+	hypothetical protein	NA	Q6UAX9	Klebsiella_phage	57.9	6.8e-11
WP_047666384.1|2120885_2122145_+|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	89.3	5.2e-222
WP_032754009.1|2122181_2123102_+	S49 family peptidase	NA	Q6UAX7	Klebsiella_phage	87.9	2.8e-148
WP_014228907.1|2123179_2124466_+|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	89.3	4.4e-216
WP_032754010.1|2124524_2124785_+	hypothetical protein	NA	Q6UAX5	Klebsiella_phage	63.9	3.3e-22
WP_020317538.1|2124765_2125083_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6UAX4	Klebsiella_phage	89.8	1.5e-45
WP_032754011.1|2125079_2125418_+|head,tail	head-tail adaptor protein	head,tail	Q6UAX3	Klebsiella_phage	88.4	3.1e-52
WP_032754012.1|2125398_2125788_+	hypothetical protein	NA	Q6UAX2	Klebsiella_phage	83.7	1.2e-55
WP_171972701.1|2125793_2126186_+	HK97 gp10 family phage protein	NA	Q6UAX1	Klebsiella_phage	93.1	1.0e-59
WP_014228913.1|2126217_2126679_+|tail	major tail shaft subunit	tail	Q6UAX0	Klebsiella_phage	83.7	7.8e-67
WP_014228914.1|2126736_2127102_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	89.3	1.6e-51
WP_032754014.1|2127334_2130691_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	87.3	0.0e+00
WP_017880254.1|2130690_2131029_+|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	89.3	6.4e-58
WP_023289191.1|2131025_2131781_+|tail	phage minor tail protein L	tail	Q6UAW5	Klebsiella_phage	80.9	2.7e-125
WP_032754016.1|2131782_2132493_+	C40 family peptidase	NA	Q6UAW4	Klebsiella_phage	89.8	1.4e-134
WP_077274162.1|2132539_2133367_+	hypothetical protein	NA	A0A0S2SY43	Pseudomonas_phage	45.9	1.8e-05
WP_032754018.1|2133382_2133973_+|tail	tail assembly protein	tail	K7PHE5	Enterobacteria_phage	75.4	5.7e-78
WP_077139148.1|2134035_2146626_+	carbohydrate binding domain-containing protein	NA	Q6UAW1	Klebsiella_phage	48.1	0.0e+00
2139925:2139940	attR	GCCAGCGGGCAGATAC	NA	NA	NA	NA
WP_032754023.1|2146687_2148112_+|tail	tail fiber domain-containing protein	tail	A0A0P0IDN1	Klebsiella_phage	49.2	2.4e-98
WP_032754025.1|2148534_2149593_+	sensor domain-containing diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	32.2	8.0e-14
>prophage 4
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	2339292	2354466	5599927	integrase	Klebsiella_phage(40.0%)	14	2337824:2337837	2350108:2350121
2337824:2337837	attL	TGCCGGTGACGCTG	NA	NA	NA	NA
WP_022065867.1|2339292_2340792_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	33.6	2.3e-59
WP_004140269.1|2340820_2341630_-	peptide ABC transporter ATP-binding protein SapF	NA	A0A2H4PQG7	Staphylococcus_phage	28.9	2.1e-14
WP_008807804.1|2341631_2342624_-	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_008807805.1|2342623_2343514_-	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_162494433.1|2343660_2344878_+|integrase	site-specific integrase	integrase	K7PGY1	Enterobacteria_phage	51.6	2.5e-120
WP_040975856.1|2345448_2345748_-	hypothetical protein	NA	A0A1V0E5P0	Salmonella_phage	55.9	1.5e-13
WP_077139161.1|2345855_2346323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040975858.1|2346356_2346770_-	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	79.0	9.5e-48
WP_077139162.1|2347174_2347510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043875398.1|2347824_2348289_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.2	1.4e-52
WP_043875397.1|2348285_2348768_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	1.9e-79
WP_077139163.1|2348778_2349159_+	nitrite transporter	NA	A0A286S2A6	Klebsiella_phage	92.1	3.8e-67
WP_077139164.1|2349155_2352227_+	kinase	NA	A0A286S259	Klebsiella_phage	92.2	0.0e+00
2350108:2350121	attR	TGCCGGTGACGCTG	NA	NA	NA	NA
WP_077139165.1|2352282_2354466_+	hypothetical protein	NA	J7HXC9	Pseudomonas_phage	29.6	1.8e-15
>prophage 5
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	2421457	2448466	5599927	plate,transposase	Cronobacter_phage(25.0%)	19	NA	NA
WP_162494436.1|2421457_2422801_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_046621187.1|2422797_2423487_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_046621190.1|2423483_2425187_+	OmpA family protein	NA	NA	NA	NA	NA
WP_023340018.1|2425191_2425683_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_077139171.1|2425948_2428603_+	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	33.4	1.2e-98
WP_162494480.1|2428604_2431295_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	31.8	2.1e-18
WP_049152609.1|2431291_2431708_+	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_023157869.1|2433645_2434167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015874726.1|2434335_2434440_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_015874727.1|2434411_2434603_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077274163.1|2434653_2435448_+|transposase	IS3 family transposase	transposase	A0A0N9SIX5	Staphylococcus_phage	30.4	2.4e-07
WP_023157866.1|2435434_2436505_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	35.0	3.3e-07
WP_049152832.1|2437774_2438983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077258941.1|2438979_2442435_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_015874732.1|2442434_2444033_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_049152830.1|2444063_2445119_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_032739739.1|2445115_2445586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032739741.1|2445662_2447417_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_032739743.1|2447380_2448466_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 6
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	2678302	2689181	5599927		Escherichia_phage(87.5%)	9	NA	NA
WP_012541792.1|2678302_2678923_-	aldolase	NA	A0A077SK32	Escherichia_phage	98.1	5.7e-113
WP_077139200.1|2678915_2680181_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	97.4	3.4e-229
WP_008804983.1|2680192_2681095_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	98.7	1.1e-157
WP_008804982.1|2681355_2682117_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	99.2	2.1e-133
WP_012968280.1|2682134_2682995_-	class A beta-lactamase LEN-13	NA	A0A077SL40	Escherichia_phage	90.2	3.9e-144
WP_008804980.1|2683289_2683550_+	hypothetical protein	NA	A0A077SK33	Escherichia_phage	95.3	3.0e-39
WP_077139201.1|2683636_2684725_+	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	97.8	7.7e-206
WP_008804978.1|2684753_2686019_-	MFS transporter	NA	NA	NA	NA	NA
WP_077139202.1|2686073_2689181_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.4	0.0e+00
>prophage 7
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	3793472	3808654	5599927		Bacillus_phage(18.18%)	12	NA	NA
WP_077139363.1|3793472_3794789_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.1	2.6e-30
WP_012967599.1|3794812_3796228_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_008804104.1|3797305_3798310_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	29.2	1.2e-30
WP_004144151.1|3798709_3798832_+	small membrane protein	NA	NA	NA	NA	NA
WP_000704907.1|3799254_3800421_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	7.0e-112
WP_023297948.1|3800601_3801156_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	5.0e-52
WP_044650166.1|3801170_3802061_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	32.9	5.3e-27
WP_000676431.1|3802092_3802962_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.3	9.8e-111
WP_044650165.1|3802988_3804053_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	2.0e-105
WP_077139364.1|3804211_3805582_-	O9 family phosphomannomutase RfbK1	NA	A0A127AWJ1	Bacillus_phage	26.0	8.4e-32
WP_012967599.1|3805605_3807021_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	30.8	3.1e-53
WP_064160974.1|3807247_3808654_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.5	1.8e-37
>prophage 8
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	3850796	3857724	5599927	tRNA	Bacillus_phage(33.33%)	6	NA	NA
WP_008804077.1|3850796_3852299_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.6e-30
WP_004201558.1|3852295_3853018_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_008804076.1|3853336_3854698_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.0e-207
WP_162494462.1|3854940_3855837_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	2.1e-15
WP_016161506.1|3856076_3856850_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.0e-26
WP_032736203.1|3856860_3857724_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	22.5	2.0e-07
>prophage 9
NZ_CP017289	Klebsiella variicola strain GJ3 chromosome, complete genome	5599927	4872186	4890163	5599927	capsid,tail,tRNA,portal,terminase,protease,head	uncultured_Caudovirales_phage(66.67%)	18	NA	NA
WP_008806537.1|4872186_4873200_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	3.7e-109
WP_001144069.1|4873437_4873653_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_008806538.1|4873764_4875510_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	1.2e-75
WP_008806539.1|4875728_4877570_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_008806540.1|4877669_4878176_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_071959634.1|4878514_4879270_+	abortive infection family protein	NA	NA	NA	NA	NA
WP_057201115.1|4879314_4880202_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_077139444.1|4880417_4882079_-|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	95.7	0.0e+00
WP_004174262.1|4882062_4882419_-|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	98.3	1.6e-59
WP_032455328.1|4882683_4883127_-	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	62.6	7.1e-49
WP_023323295.1|4883126_4883420_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	82.5	4.2e-42
WP_004174258.1|4883412_4883751_-|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	47.7	7.3e-22
WP_004174256.1|4883747_4884983_-|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	95.9	1.0e-233
WP_077139445.1|4884984_4885545_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	97.8	5.0e-100
WP_004174253.1|4885596_4886757_-|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	95.6	6.3e-206
WP_070544411.1|4887012_4887786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004174250.1|4887838_4888084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004174245.1|4888363_4890163_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.0	5.1e-130
>prophage 1
NZ_CP017285	Klebsiella variicola strain GJ3 plasmid pKPGJ-3a, complete sequence	108857	15	38234	108857	transposase,integrase	Burkholderia_phage(14.29%)	37	NA	NA
WP_000845039.1|15_1029_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001067855.1|1303_2008_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|2158_2974_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_040217779.1|3374_4643_-|transposase	ISL3 family transposase	transposase	Q6V7R1	Burkholderia_virus	34.4	1.5e-59
WP_046499093.1|4647_7905_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_046499086.1|7908_9198_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_077138923.1|9194_11222_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_077138924.1|11364_11688_-	theronine dehydrogenase	NA	I3UM57	Rhodobacter_phage	37.2	1.0e-12
WP_077138925.1|11684_12413_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_077138926.1|12409_12841_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_077138927.1|12890_14900_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	30.2	3.5e-26
WP_077138928.1|14970_15189_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_016247540.1|15814_16132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008324193.1|16166_16421_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	50.0	2.1e-13
WP_015493073.1|16613_16805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044789508.1|16847_17354_-	antirestriction protein ArdA	NA	A0A1I9S7Y0	Rhodococcus_phage	31.8	4.8e-09
WP_077138929.1|17752_18532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008455408.1|18585_19005_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_008455410.1|19015_19237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008455412.1|19236_19914_-	DNA methylase	NA	A0A2K9VH43	Faecalibacterium_phage	37.0	9.5e-29
WP_077138930.1|20273_20945_+	SOS response-associated peptidase family protein	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	60.4	9.0e-80
WP_015493080.1|21124_21547_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.5	3.1e-30
WP_077138931.1|21546_22821_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.8	4.3e-155
WP_077138932.1|22869_24243_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_000143877.1|24292_24616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843283.1|24612_25050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077138933.1|25049_26081_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	26.1	2.2e-08
WP_040118447.1|26080_26947_-	ParA family protein	NA	NA	NA	NA	NA
WP_042005150.1|27440_28073_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	31.2	9.6e-07
WP_045358108.1|28126_28327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040113343.1|28472_29402_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	53.1	1.4e-75
WP_072094655.1|30627_32031_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	9.0e-106
WP_004098817.1|32064_33279_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001749988.1|33518_34088_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	43.2	5.2e-36
WP_001067855.1|34390_35095_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_077138935.1|35100_35340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553819.1|35336_38234_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
>prophage 1
NZ_CP017286	Klebsiella variicola strain GJ3 plasmid pKPGJ-3b, complete sequence	92231	36663	47447	92231	integrase	Macacine_betaherpesvirus(25.0%)	12	34407:34420	44051:44064
34407:34420	attL	GCGGTTTTCCCAGC	NA	NA	NA	NA
WP_029497485.1|36663_37443_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	7.1e-52
WP_032433931.1|37500_37758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032072094.1|37885_37999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012539983.1|38630_39386_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	95.2	1.7e-135
WP_015632469.1|40176_41382_+	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	4.0e-163
WP_032741647.1|41381_42356_+	ParB/RepB/Spo0J family partition protein	NA	A0A1B0V750	Salmonella_phage	55.3	4.2e-86
WP_077138871.1|42437_43709_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.2	2.3e-148
WP_020805749.1|43708_44140_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	3.6e-29
44051:44064	attR	GCTGGGAAAACCGC	NA	NA	NA	NA
WP_077138872.1|44372_45344_+	StbA family protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_001568039.1|45346_46018_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_048322267.1|46079_46310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001568041.1|46745_47447_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.2	1.6e-26
>prophage 1
NZ_CP017287	Klebsiella variicola strain GJ3 plasmid pKPGJ-3c, complete sequence	73385	8824	33526	73385	protease,transposase	Escherichia_phage(53.85%)	25	NA	NA
WP_001067855.1|8824_9529_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|9718_10534_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067834.1|10684_11389_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	3.1e-139
WP_000219391.1|11510_12416_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|12412_13651_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|13650_14235_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|14727_15492_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000130000.1|15718_16024_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|16034_17240_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000083830.1|17572_17827_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|18064_18139_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130646.1|18131_18989_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|19927_20581_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|20673_20931_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|20863_21265_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001067855.1|22575_23280_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_013188475.1|23790_24666_+	class A extended-spectrum beta-lactamase CTX-M-65	NA	A0A1B0VBP7	Salmonella_phage	98.9	6.8e-152
WP_013362812.1|24700_25669_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	100.0	1.6e-186
WP_001067855.1|27419_28124_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_014839980.1|28509_28926_+	fosfomycin resistance glutathione transferase FosA3	NA	Q2LI91	Bacillus_phage	35.6	2.0e-08
WP_014839979.1|28930_29449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|29514_30219_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001235713.1|30454_31012_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_050190632.1|31194_32055_+	class A beta-lactamase TEM-215	NA	Q1MVP3	Enterobacteria_phage	99.7	5.1e-160
WP_001067858.1|32821_33526_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
