The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019614	Listeria monocytogenes strain 10-092876-1559 LM1 chromosome, complete genome	2972553	122957	129482	2972553	tail	Listeria_phage(33.33%)	10	NA	NA
WP_003721739.1|122957_123410_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	47.9	4.0e-31
WP_003721740.1|123415_123751_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JAR9	uncultured_Caudovirales_phage	52.5	4.0e-20
WP_003732219.1|123967_124396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003735200.1|124407_124824_+	hypothetical protein	NA	A8ASQ1	Listeria_phage	38.6	1.7e-20
WP_045598082.1|125101_125491_+	DUF5072 family protein	NA	NA	NA	NA	NA
WP_003721744.1|125503_126016_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	62.7	1.2e-47
WP_003721745.1|126063_126366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072217178.1|126407_126812_+	phenylalanine racemase	NA	NA	NA	NA	NA
WP_031665466.1|126798_128667_+	membrane protein	NA	A0A097PAU2	Streptococcus_pyogenes_phage	45.8	3.5e-20
WP_009911828.1|128663_129482_+|tail	phage tail family protein	tail	A0A060AFE1	Staphylococcus_phage	35.0	7.2e-39
>prophage 2
NZ_CP019614	Listeria monocytogenes strain 10-092876-1559 LM1 chromosome, complete genome	2972553	662998	697448	2972553	protease,portal,tail,terminase,integrase,holin,head,capsid	Listeria_phage(48.39%)	45	673122:673139	708145:708162
WP_023552234.1|662998_664150_-|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	46.3	3.4e-87
WP_023552237.1|664171_664885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014930667.1|664939_665440_-	hypothetical protein	NA	A0A1S7FYX8	Listeria_phage	31.9	1.9e-13
WP_012951299.1|665452_665779_-	helix-turn-helix transcriptional regulator	NA	Q0H244	Geobacillus_phage	47.1	1.6e-13
WP_023552239.1|665952_666144_+	helix-turn-helix transcriptional regulator	NA	Q0H243	Geobacillus_phage	57.6	4.7e-10
WP_012951301.1|666241_666568_+	DUF771 domain-containing protein	NA	A0A2H4J474	uncultured_Caudovirales_phage	41.1	4.9e-15
WP_023552243.1|666740_667655_+	conserved phage C-terminal domain-containing protein	NA	A0A1W6JNI1	Staphylococcus_phage	51.5	7.8e-58
WP_023552247.1|668010_668427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552249.1|668423_668600_+	hypothetical protein	NA	A8ATL8	Listeria_phage	70.7	1.7e-14
WP_023552251.1|668614_669334_+	DUF2786 domain-containing protein	NA	A0A1U9WR73	Streptococcus_virus	29.7	3.5e-21
WP_023552253.1|669337_669640_+	hypothetical protein	NA	A0A059T695	Listeria_phage	96.2	3.8e-22
WP_023552255.1|669636_670038_+	hypothetical protein	NA	A8ASP1	Listeria_phage	58.8	3.2e-40
WP_023552257.1|670037_670748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552259.1|670760_670949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552261.1|670945_671407_+	hypothetical protein	NA	D9J0I6	Brochothrix_phage	35.9	6.7e-18
WP_023552263.1|671403_671787_+	hypothetical protein	NA	A8ATZ3	Listeria_phage	77.2	5.4e-45
WP_023552266.1|671807_672056_+	DUF3850 domain-containing protein	NA	A0A059T7N3	Listeria_phage	84.0	5.0e-28
WP_023552268.1|672055_672637_+	DUF3310 domain-containing protein	NA	A0A059T5J6	Listeria_phage	76.3	2.3e-76
WP_023552271.1|672636_673116_+	single-stranded DNA-binding protein	NA	A8ASP5	Listeria_phage	83.8	1.3e-69
673122:673139	attL	AAAGGAGCGATGAAAATG	NA	NA	NA	NA
WP_023552274.1|673136_673376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031694735.1|673366_673552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552279.1|673622_674141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552281.1|674137_674680_+|integrase	tyrosine-type recombinase/integrase	integrase	H0USV4	Bacillus_phage	53.3	2.5e-48
WP_023552283.1|674695_675028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552285.1|675298_675625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023552287.1|675621_675984_+	HNH endonuclease	NA	A0A075M5R4	Enterococcus_phage	46.2	5.5e-15
WP_012951321.1|676078_676606_+|terminase	phage terminase small subunit P27 family	terminase	J7KC46	Streptococcus_phage	46.7	6.1e-31
WP_012951322.1|676574_678326_+|terminase	terminase large subunit	terminase	A0A2H4JCI4	uncultured_Caudovirales_phage	50.7	4.1e-156
WP_023552290.1|678332_678533_+	DUF1056 family protein	NA	NA	NA	NA	NA
WP_012951323.1|678535_679771_+|portal	phage portal protein	portal	A0A2H4JAR2	uncultured_Caudovirales_phage	42.1	3.6e-82
WP_012951324.1|679767_680334_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1D6Z2A7	Staphylococcus_phage	52.2	1.0e-44
WP_012951325.1|680397_681567_+|capsid	phage major capsid protein	capsid	A0A060AI54	Enterococcus_phage	38.1	2.1e-44
WP_023552291.1|681615_681954_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JB77	uncultured_Caudovirales_phage	36.7	4.0e-12
WP_012951327.1|681923_682244_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_012951328.1|682237_682603_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_012951329.1|682605_683004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012951330.1|683024_683600_+|tail	major tail protein	tail	M1PRQ7	Streptococcus_phage	42.4	1.2e-32
WP_012951331.1|683689_684037_+	hypothetical protein	NA	NA	NA	NA	NA
WP_068995373.1|684233_688433_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	33.0	1.2e-12
WP_014930683.1|688425_690669_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	29.4	1.2e-56
WP_023552296.1|690674_692966_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	37.9	9.8e-134
WP_023552297.1|692958_694020_+	hypothetical protein	NA	A0A059T7R4	Listeria_phage	51.0	1.2e-94
WP_003722523.1|694058_694424_+	hypothetical protein	NA	Q9T1A0	Listeria_phage	100.0	7.4e-12
WP_023552298.1|694436_694721_+|holin	holin	holin	A8ASL4	Listeria_phage	93.5	5.9e-41
WP_009912342.1|696818_697448_+	hypothetical protein	NA	A8ASL7	Listeria_phage	90.4	1.9e-100
708145:708162	attR	CATTTTCATCGCTCCTTT	NA	NA	NA	NA
>prophage 3
NZ_CP019614	Listeria monocytogenes strain 10-092876-1559 LM1 chromosome, complete genome	2972553	1138516	1147474	2972553		Hokovirus(28.57%)	9	NA	NA
WP_003721506.1|1138516_1138900_+	glycerol-3-phosphate cytidylyltransferase	NA	A0A1V0SGE7	Hokovirus	40.7	1.4e-16
WP_003732709.1|1138921_1139905_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	34.6	4.1e-12
WP_045599224.1|1139919_1140933_+	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.2	2.3e-10
WP_003721509.1|1141141_1142632_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	49.7	9.5e-114
WP_014601905.1|1142643_1143468_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.6	1.3e-67
WP_003721511.1|1143480_1143789_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_003721512.1|1143848_1144253_+	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_014601906.1|1144381_1145938_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	28.1	3.9e-17
WP_014601907.1|1146070_1147474_+	SIR2 family protein	NA	Q38324	Lactococcus_phage	25.7	1.2e-17
>prophage 4
NZ_CP019614	Listeria monocytogenes strain 10-092876-1559 LM1 chromosome, complete genome	2972553	1233080	1336963	2972553	protease,portal,tail,tRNA,terminase,integrase,holin,capsid	Listeria_phage(67.61%)	119	1258765:1258783	1299270:1299288
WP_003736387.1|1233080_1234133_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	34.9	1.3e-29
WP_003732769.1|1234132_1236541_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_026749898.1|1236701_1237403_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.8	3.9e-33
WP_031644433.1|1237416_1240827_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_003721623.1|1240924_1241377_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_069029478.1|1241392_1244593_+	MMPL family transporter	NA	NA	NA	NA	NA
WP_077323708.1|1244699_1245374_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	47.7	9.8e-50
WP_072215733.1|1245410_1246337_-	ribonuclease HIII	NA	NA	NA	NA	NA
WP_003740576.1|1246490_1246754_+	cell division protein ZapA	NA	NA	NA	NA	NA
WP_003723849.1|1246753_1247296_+	CvpA family protein	NA	NA	NA	NA	NA
WP_010989712.1|1247388_1249101_+	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.8	5.1e-18
WP_010989713.1|1249123_1251481_+	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.0e-21
WP_003723853.1|1251561_1251873_+	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	39.6	5.4e-19
WP_003732777.1|1251948_1253760_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_003732778.1|1253948_1255163_+	aspartate kinase	NA	NA	NA	NA	NA
WP_003733801.1|1255218_1255713_-	YslB family protein	NA	NA	NA	NA	NA
WP_003723856.1|1255860_1256661_+	glutamate racemase	NA	NA	NA	NA	NA
WP_003732780.1|1256673_1257420_+	ribonuclease PH	NA	NA	NA	NA	NA
WP_012581486.1|1257423_1258035_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_012951515.1|1258071_1258596_+	metallophosphoesterase	NA	NA	NA	NA	NA
1258765:1258783	attL	AATCCCTCTCAGGACGTAA	NA	NA	NA	NA
WP_057141537.1|1258881_1260036_-|integrase	site-specific integrase	integrase	A0A059T688	Listeria_phage	98.2	9.7e-215
WP_015987307.1|1260171_1260786_-	hypothetical protein	NA	A0A059T7Z1	Listeria_phage	96.1	2.0e-97
WP_069029477.1|1260836_1261289_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A059T7S0	Listeria_phage	99.3	5.3e-84
WP_069029476.1|1261305_1261629_-	helix-turn-helix transcriptional regulator	NA	A0A059T6G1	Listeria_phage	65.4	1.0e-33
WP_023548970.1|1261902_1262079_+	helix-turn-helix transcriptional regulator	NA	D2IZW2	Enterococcus_phage	46.6	1.1e-05
WP_023548969.1|1262092_1262863_+	phage antirepressor KilAC domain-containing protein	NA	A0A1Q1PVU2	Staphylococcus_phage	49.4	5.0e-66
WP_015987310.1|1263151_1263394_+	hypothetical protein	NA	A8ATD2	Listeria_phage	100.0	1.4e-43
WP_023548967.1|1263396_1263582_+	hypothetical protein	NA	A0A059T7Z3	Listeria_phage	98.4	4.4e-29
WP_003730998.1|1263816_1263969_+	hypothetical protein	NA	A0A059T7S2	Listeria_phage	96.0	2.9e-18
WP_069029475.1|1264189_1264387_+	hypothetical protein	NA	A0A0B5CU49	Listeria_phage	95.4	8.9e-28
WP_022741832.1|1264383_1264527_+	hypothetical protein	NA	A8ATZ0	Listeria_phage	97.9	6.4e-20
WP_069029474.1|1264542_1264899_+	hypothetical protein	NA	S5MAA0	Brevibacillus_phage	33.3	4.4e-09
WP_069029473.1|1264895_1265105_+	hypothetical protein	NA	A8ATE0	Listeria_phage	91.3	3.8e-29
WP_031645762.1|1265208_1265424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026747228.1|1265420_1265630_+	hypothetical protein	NA	A0A059T6C7	Listeria_phage	60.6	2.9e-13
WP_172425824.1|1265656_1265815_+	hypothetical protein	NA	A0A059T654	Listeria_phage	94.2	1.5e-22
WP_031648699.1|1265814_1266009_+	hypothetical protein	NA	A0A059T7V7	Listeria_phage	89.1	4.1e-25
WP_053804902.1|1266024_1266240_+	hypothetical protein	NA	A0A059T7T1	Listeria_phage	88.9	5.3e-26
WP_053804903.1|1266290_1266851_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009933642.1|1266954_1267128_+	hypothetical protein	NA	A0A059T5G3	Listeria_phage	100.0	5.2e-24
WP_069029472.1|1267124_1267508_+	hypothetical protein	NA	A0A059T6A2	Listeria_phage	96.9	8.0e-65
WP_014929535.1|1267509_1267989_+	siphovirus Gp157 family protein	NA	A0A059T803	Listeria_phage	100.0	5.4e-79
WP_009911358.1|1268001_1268691_+	AAA family ATPase	NA	A0A059T7T3	Listeria_phage	99.6	7.5e-130
WP_069029471.1|1268754_1270011_+	DEAD/DEAH box helicase	NA	Q8W5V9	Listeria_phage	95.9	1.1e-232
WP_009928019.1|1270035_1270521_+	DUF669 domain-containing protein	NA	A0A059T5G4	Listeria_phage	100.0	2.9e-88
WP_069029470.1|1270543_1272817_+	DNA primase	NA	A0A059T6A4	Listeria_phage	99.6	0.0e+00
WP_014929539.1|1273103_1273424_+	VRR-NUC domain-containing protein	NA	Q8W5V6	Listeria_phage	98.1	1.2e-53
WP_069029488.1|1273607_1274138_+	DUF3310 domain-containing protein	NA	A0A059T7T5	Listeria_phage	79.5	1.8e-78
WP_031664885.1|1274138_1274564_+	DUF722 domain-containing protein	NA	A0A059T6H4	Listeria_phage	99.3	1.8e-73
WP_031664882.1|1274790_1275732_+	DUF4868 domain-containing protein	NA	A0A1Q1PW39	Staphylococcus_phage	33.0	5.9e-45
WP_031664880.1|1275757_1276369_+	hypothetical protein	NA	A0A1Q1PW40	Staphylococcus_phage	42.8	6.0e-22
WP_026747157.1|1276398_1276725_+	hypothetical protein	NA	A0A059T5G5	Listeria_phage	94.4	2.5e-51
WP_069029469.1|1276724_1277039_+	HNH endonuclease	NA	A8ATF8	Listeria_phage	97.1	1.6e-55
WP_031668694.1|1277087_1277444_+|terminase	P27 family phage terminase small subunit	terminase	A0A059T7Y1	Listeria_phage	96.0	1.0e-45
WP_026747160.1|1277440_1279084_+|terminase	terminase large subunit	terminase	A0A059T7Q8	Listeria_phage	98.9	0.0e+00
WP_026747161.1|1279093_1279483_-	DUF2513 domain-containing protein	NA	A0A2I7SCV0	Paenibacillus_phage	37.2	2.8e-17
WP_026747162.1|1279533_1280664_+|portal	phage portal protein	portal	A0A059T6F0	Listeria_phage	98.7	9.8e-212
WP_009928004.1|1280660_1281377_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	57.4	5.5e-67
WP_014930913.1|1281403_1282555_+|capsid	phage major capsid protein	capsid	A0A059T678	Listeria_phage	100.0	6.3e-214
WP_176716059.1|1282561_1282732_+	hypothetical protein	NA	A0A059T7Y2	Listeria_phage	98.2	3.1e-21
WP_009934007.1|1282741_1283041_+	hypothetical protein	NA	A8ATA0	Listeria_phage	98.0	9.9e-47
WP_031659499.1|1283024_1283390_+	hypothetical protein	NA	A0A059T6F2	Listeria_phage	97.5	4.2e-63
WP_012951550.1|1283386_1283788_+	hypothetical protein	NA	A0A059T5F3	Listeria_phage	100.0	2.1e-68
WP_053804915.1|1283784_1284168_+	hypothetical protein	NA	A0A059T681	Listeria_phage	100.0	1.3e-67
WP_025370590.1|1284188_1284776_+|tail	phage tail protein	tail	A0A059T7Y4	Listeria_phage	99.0	1.3e-106
WP_025370591.1|1284846_1285179_+	hypothetical protein	NA	A0A059T7R2	Listeria_phage	97.3	8.7e-52
WP_009931626.1|1285229_1285391_+	hypothetical protein	NA	A0A059T6F4	Listeria_phage	98.0	4.3e-20
WP_069029468.1|1285394_1290317_+|tail	phage tail tape measure protein	tail	A0A059T5F4	Listeria_phage	99.7	0.0e+00
WP_069029467.1|1290309_1291959_+|tail	phage tail family protein	tail	A0A059T682	Listeria_phage	99.1	0.0e+00
WP_069029466.1|1291971_1294266_+|tail	phage tail protein	tail	A0A059T7Y6	Listeria_phage	98.7	0.0e+00
WP_069027764.1|1294255_1295347_+	carbohydrate-binding protein CenC	NA	A0A059T7R4	Listeria_phage	91.5	2.5e-188
WP_009928178.1|1295394_1295838_+	hypothetical protein	NA	A0A059T6F6	Listeria_phage	100.0	6.8e-76
WP_009928179.1|1295816_1296233_+	hypothetical protein	NA	A0A059T5F5	Listeria_phage	99.3	9.3e-43
WP_061668555.1|1296253_1296520_+|holin	phage holin	holin	A0A059T684	Listeria_phage	98.9	7.3e-41
WP_069029464.1|1296519_1297227_+	M15 family metallopeptidase	NA	A8ATW4	Listeria_phage	97.4	5.0e-129
WP_053804924.1|1297342_1298080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014931684.1|1298148_1298334_-	hypothetical protein	NA	R4IBK5	Listeria_phage	86.7	9.2e-19
WP_077323712.1|1298770_1299004_+	hypothetical protein	NA	A8ATC5	Listeria_phage	92.2	3.7e-33
WP_045599352.1|1299651_1301010_+	DUF1254 domain-containing protein	NA	NA	NA	NA	NA
1299270:1299288	attR	AATCCCTCTCAGGACGTAA	NA	NA	NA	NA
WP_003729706.1|1301051_1301645_-	YdeI/OmpD-associated family protein	NA	NA	NA	NA	NA
WP_012581425.1|1301781_1302189_-	VOC family protein	NA	NA	NA	NA	NA
WP_031664862.1|1302353_1302953_+	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.5	3.8e-29
WP_003723543.1|1302985_1303246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581424.1|1303369_1304782_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.1	2.2e-51
WP_003730329.1|1304806_1305070_+	DUF3116 family protein	NA	NA	NA	NA	NA
WP_031664861.1|1305235_1305712_+	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_003730327.1|1305748_1305994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012581422.1|1305990_1307196_-	MFS transporter	NA	NA	NA	NA	NA
WP_031664859.1|1307400_1308060_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_003726053.1|1308099_1308294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003730323.1|1308360_1309209_-	YitT family protein	NA	NA	NA	NA	NA
WP_003723553.1|1309539_1309677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003732787.1|1309827_1310541_+	trehalose operon repressor	NA	NA	NA	NA	NA
WP_031664857.1|1310571_1312218_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_023552381.1|1312236_1313721_-	PTS system trehalose-specific EIIBC component	NA	NA	NA	NA	NA
WP_014601949.1|1313837_1314299_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_003726717.1|1314337_1314802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014601950.1|1314990_1315905_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_014601951.1|1315929_1317177_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	52.0	4.2e-107
WP_014601952.1|1317160_1317991_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	42.0	1.1e-45
WP_031664854.1|1318138_1319278_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_003723563.1|1319358_1319754_-	helix-turn-helix transcriptional regulator	NA	A9D9J6	Lactobacillus_prophage	57.4	1.3e-14
WP_003727524.1|1319904_1320120_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_010989719.1|1320238_1320772_+|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_003732795.1|1320789_1321455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003732796.1|1321716_1322655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003723884.1|1322769_1324053_+	trigger factor	NA	NA	NA	NA	NA
WP_003723886.1|1324237_1325497_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	63.2	1.4e-145
WP_003723887.1|1325615_1326182_+	type I signal peptidase SipX	NA	NA	NA	NA	NA
WP_003723888.1|1326216_1326786_+	type I signal peptidase SipY	NA	NA	NA	NA	NA
WP_003723889.1|1326887_1327430_+	type I signal peptidase SipZ	NA	NA	NA	NA	NA
WP_003723890.1|1327439_1328303_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_023548886.1|1328299_1329085_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	39.2	3.0e-26
WP_003723892.1|1329218_1330079_+	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_009924617.1|1330349_1332428_+	type I DNA topoisomerase	NA	A0A1V0SB35	Catovirus	37.7	1.4e-107
WP_031664850.1|1332490_1333795_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_009911635.1|1334077_1334980_+	tyrosine recombinase XerC	NA	A0A097EYL9	Mycobacterium_phage	28.6	1.2e-13
WP_003724001.1|1335000_1335540_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_010989722.1|1335553_1336963_+|protease	ATP-dependent protease ATPase subunit HslU	protease	W6AS21	Erwinia_phage	27.7	4.9e-43
>prophage 5
NZ_CP019614	Listeria monocytogenes strain 10-092876-1559 LM1 chromosome, complete genome	2972553	1862346	1870632	2972553		Synechococcus_phage(33.33%)	8	NA	NA
WP_033921148.1|1862346_1862913_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.9	7.0e-25
WP_031665593.1|1862909_1863959_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	44.4	9.2e-63
WP_003722245.1|1863977_1865405_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.6	1.1e-53
WP_039384720.1|1865389_1867609_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.1	6.5e-159
WP_003733240.1|1867601_1868285_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_003722248.1|1868288_1868534_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_014931516.1|1868545_1869259_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3F9V5	Synechococcus_phage	37.8	8.8e-41
WP_045598711.1|1869339_1870632_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.0	2.5e-17
>prophage 6
NZ_CP019614	Listeria monocytogenes strain 10-092876-1559 LM1 chromosome, complete genome	2972553	2528612	2536456	2972553		Streptococcus_phage(50.0%)	7	NA	NA
WP_003722604.1|2528612_2529584_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	39.4	5.2e-52
WP_003722605.1|2529591_2530560_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.3	6.7e-68
WP_003722606.1|2530561_2531437_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.7	1.9e-08
WP_031645160.1|2531544_2533275_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	53.3	3.3e-174
WP_003734087.1|2533316_2534378_-	galactose mutarotase	NA	NA	NA	NA	NA
WP_014601137.1|2534394_2535378_-	UDP-glucose 4-epimerase GalE	NA	A0A1V0SG19	Hokovirus	37.2	1.6e-48
WP_003722610.1|2535496_2536456_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.7	2.0e-88
>prophage 7
NZ_CP019614	Listeria monocytogenes strain 10-092876-1559 LM1 chromosome, complete genome	2972553	2622915	2694012	2972553	protease,tail,tRNA,terminase,integrase,holin	Listeria_phage(87.72%)	88	2654751:2654800	2694100:2694149
WP_003723609.1|2622915_2624586_-|tRNA	arginine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003723610.1|2624582_2625032_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_003723611.1|2625109_2625763_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_045598658.1|2625836_2626022_+	4-oxalocrotonate tautomerase	NA	NA	NA	NA	NA
WP_009924630.1|2626056_2627379_-	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	33.2	2.6e-30
WP_003723614.1|2627393_2628230_-	lipoyl-[GcvH]:protein N-lipoyltransferase	NA	NA	NA	NA	NA
WP_003729274.1|2628547_2628748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723616.1|2628770_2629094_-	YxeA family protein	NA	NA	NA	NA	NA
WP_003734106.1|2629248_2630910_-	peptide ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003726112.1|2631045_2631660_-	SdpI family protein	NA	NA	NA	NA	NA
WP_003733267.1|2631683_2632316_-	nicotinamidase	NA	NA	NA	NA	NA
WP_003723621.1|2632316_2632841_-	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_003733266.1|2632843_2633842_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_010990017.1|2633938_2634211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723624.1|2634259_2635171_-	cation transporter	NA	NA	NA	NA	NA
WP_069029494.1|2635296_2639889_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_003733264.1|2640109_2640937_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_003733263.1|2641051_2641927_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_026750099.1|2641937_2642231_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_031645146.1|2642240_2642426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003723280.1|2642494_2643163_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.0	5.0e-38
WP_003733261.1|2643162_2644251_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_014931679.1|2644329_2645709_-	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	43.7	1.4e-55
WP_003723283.1|2645705_2646383_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	48.4	2.6e-58
WP_014931680.1|2646429_2647215_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_003723285.1|2647276_2647753_-	DUF1641 domain-containing protein	NA	NA	NA	NA	NA
WP_045598667.1|2647752_2650740_-	formate dehydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_045598669.1|2651238_2652081_+	S-adenosyl-l-methionine hydroxide adenosyltransferase family protein	NA	NA	NA	NA	NA
WP_045598672.1|2652131_2653613_-	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_014601166.1|2653713_2654601_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
2654751:2654800	attL	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
WP_010989939.1|2655170_2655404_-	hypothetical protein	NA	A0A059T6E1	Listeria_phage	93.5	8.9e-35
WP_003731277.1|2655705_2655939_+	hypothetical protein	NA	A8ATW9	Listeria_phage	100.0	4.3e-13
WP_061727265.1|2655970_2656222_+	hypothetical protein	NA	A8ATW8	Listeria_phage	97.6	2.9e-39
WP_038409766.1|2656222_2656672_+	anti-CRISPR protein AcrIIA1	NA	A8ATW7	Listeria_phage	96.6	1.6e-72
WP_038409764.1|2656696_2657194_+	AP2 domain-containing protein	NA	A8ATW6	Listeria_phage	99.4	1.9e-90
WP_038409916.1|2657468_2658242_+	DUF3825 domain-containing protein	NA	A8ATW5	Listeria_phage	99.6	2.1e-149
WP_068996243.1|2658282_2659086_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A059T7X1	Listeria_phage	81.1	7.5e-81
WP_077323767.1|2659085_2659346_-|holin	phage holin	holin	A0A059T684	Listeria_phage	84.1	1.3e-34
WP_077323769.1|2659345_2659651_-	hypothetical protein	NA	A0A059T5E6	Listeria_phage	98.0	1.2e-42
WP_077323771.1|2659702_2661865_-|tail	phage tail protein	tail	A8ATW1	Listeria_phage	98.8	0.0e+00
WP_077323773.1|2661877_2663446_-|tail	phage tail family protein	tail	A8ATW0	Listeria_phage	99.4	2.6e-303
WP_077323775.1|2663442_2668233_-|tail	phage tail tape measure protein	tail	A8ATV9	Listeria_phage	89.4	0.0e+00
WP_072225507.1|2668237_2668549_-	hypothetical protein	NA	A8ATV8	Listeria_phage	98.9	1.2e-42
WP_015987409.1|2668545_2668977_-	hypothetical protein	NA	A8ATV7	Listeria_phage	100.0	9.6e-75
WP_015987408.1|2669032_2669719_-	Ig domain-containing protein	NA	A8ATV6	Listeria_phage	100.0	9.4e-117
WP_003725064.1|2669723_2670095_-	hypothetical protein	NA	A8ATV5	Listeria_phage	100.0	8.5e-64
WP_015987407.1|2670091_2670409_-	HK97 gp10 family phage protein	NA	A8ATV4	Listeria_phage	100.0	9.9e-53
WP_015987430.1|2670398_2670764_-	hypothetical protein	NA	A8ATV3	Listeria_phage	100.0	4.4e-65
WP_012951937.1|2670763_2671117_-	hypothetical protein	NA	A8ATV2	Listeria_phage	100.0	7.6e-62
WP_172425835.1|2671117_2671285_-	hypothetical protein	NA	A8ATV1	Listeria_phage	100.0	1.7e-11
WP_015987427.1|2671298_2672171_-	F420-dependent oxidoreductase	NA	A8ATV0	Listeria_phage	100.0	1.2e-161
WP_015987425.1|2672193_2672748_-	hypothetical protein	NA	A8ATU9	Listeria_phage	100.0	2.3e-89
WP_015987421.1|2672843_2673884_-	hypothetical protein	NA	A8ATU8	Listeria_phage	100.0	1.6e-200
WP_015987416.1|2673888_2675445_-	hypothetical protein	NA	A8ATU7	Listeria_phage	100.0	4.8e-302
WP_047933366.1|2675459_2676806_-|terminase	PBSX family phage terminase large subunit	terminase	A8ATU6	Listeria_phage	99.5	5.9e-264
WP_015987406.1|2676771_2677512_-	hypothetical protein	NA	A8ATU5	Listeria_phage	100.0	3.7e-135
WP_012951944.1|2677551_2677779_-	hypothetical protein	NA	A8AU06	Listeria_phage	100.0	1.5e-34
WP_015987428.1|2677859_2678492_-	hypothetical protein	NA	A8AU05	Listeria_phage	100.0	1.1e-114
WP_015967178.1|2678673_2679108_-	hypothetical protein	NA	A8AU03	Listeria_phage	100.0	5.1e-76
WP_015967177.1|2679126_2679291_-	hypothetical protein	NA	A8AU02	Listeria_phage	100.0	3.9e-21
WP_003769966.1|2679419_2679824_-	endodeoxyribonuclease	NA	A8AU00	Listeria_phage	100.0	5.4e-72
WP_014601286.1|2679789_2679930_-	BH0509 family protein	NA	A8ATZ9	Listeria_phage	100.0	2.6e-18
WP_015967175.1|2679926_2680232_-	hypothetical protein	NA	A8ATZ8	Listeria_phage	100.0	1.7e-46
WP_070754236.1|2680263_2680746_-	single-stranded DNA-binding protein	NA	A8ATZ7	Listeria_phage	95.6	4.6e-78
WP_070754238.1|2680745_2681024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070754240.1|2681020_2681422_-	hypothetical protein	NA	A0A059T6C9	Listeria_phage	78.9	1.0e-54
WP_020830815.1|2681418_2681697_-	DUF1642 domain-containing protein	NA	R4IBV9	Listeria_phage	53.3	9.6e-20
WP_020830814.1|2681693_2681981_-	hypothetical protein	NA	R4IBL5	Listeria_phage	60.5	7.4e-23
WP_077323777.1|2682087_2682381_-	hypothetical protein	NA	A8ATM4	Listeria_phage	83.5	2.0e-36
WP_077323779.1|2682373_2682913_-	DUF1642 domain-containing protein	NA	A0A059T7S4	Listeria_phage	69.3	1.4e-62
WP_077323781.1|2682909_2683419_-	hypothetical protein	NA	A0A1I9S6E8	Bacillus_phage	44.9	4.2e-29
WP_077323812.1|2683523_2684054_-	sugar-phosphate nucleotidyltransferase	NA	A0A059T5F9	Listeria_phage	94.9	7.1e-96
WP_077323783.1|2684101_2685025_-	DnaD domain-containing protein	NA	A0A0B5D175	Listeria_phage	90.2	9.7e-141
WP_077323785.1|2685062_2685974_-	recombinase RecT	NA	NA	NA	NA	NA
WP_069015687.1|2685966_2687478_-	ATPase	NA	A0A2I7SC81	Paenibacillus_phage	36.2	2.7e-76
WP_003722564.1|2687784_2687973_-	hypothetical protein	NA	Q9T175	Listeria_phage	82.3	1.8e-22
WP_031644321.1|2688075_2688282_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_068996130.1|2688271_2688802_-	hypothetical protein	NA	A8ATY1	Listeria_phage	86.7	2.5e-77
WP_077323787.1|2688922_2689696_-	phage antirepressor KilAC domain-containing protein	NA	A8ATY0	Listeria_phage	98.4	6.8e-140
WP_003731223.1|2689759_2690302_+	hypothetical protein	NA	A8ATX9	Listeria_phage	100.0	2.8e-95
WP_003731222.1|2690279_2690633_-	hypothetical protein	NA	A8ATX8	Listeria_phage	100.0	9.9e-54
WP_015987418.1|2690629_2690866_-	hypothetical protein	NA	A8ATX7	Listeria_phage	100.0	1.1e-37
WP_026747215.1|2690886_2691090_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_039381694.1|2691265_2691571_+	helix-turn-helix transcriptional regulator	NA	A0A059T669	Listeria_phage	64.3	4.0e-27
WP_012951966.1|2691601_2692093_+	hypothetical protein	NA	A8ATX4	Listeria_phage	99.4	2.9e-91
WP_077323789.1|2692115_2692334_+	zinc-ribbon domain-containing protein	NA	A0A059T6E3	Listeria_phage	95.8	4.6e-33
WP_026747212.1|2692348_2692783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077323791.1|2692848_2694012_+|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	31.0	3.4e-50
2694100:2694149	attR	TTAAGCCACTTGTCGGATTTGAACCGACGACCCCTTCCTTACCATGGAAG	NA	NA	NA	NA
