The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019628	Pseudoalteromonas aliena strain EH1 chromosome, complete genome	4594697	632348	771622	4594697	integrase,transposase,protease,plate	Pseudomonas_phage(17.65%)	107	694869:694884	757378:757529
WP_077535544.1|632348_633677_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_077535545.1|633697_634978_+	type VI secretion system protein TssL	NA	NA	NA	NA	NA
WP_077535546.1|634988_638498_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_077535547.1|638479_639208_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_077535548.1|639200_639998_+	serine/threonine-protein phosphatase	NA	I6PCV8	Cronobacter_phage	27.8	7.1e-07
WP_077535549.1|640454_641570_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_077535550.1|641586_642090_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_077535551.1|642086_643577_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_077535552.1|643613_645140_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_077535553.1|645142_645922_+	virulence protein, SciE type	NA	NA	NA	NA	NA
WP_077535554.1|645937_646423_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_077535555.1|646419_648246_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_077535556.1|648242_649232_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_077535557.1|649254_651858_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	7.3e-93
WP_077535558.1|652107_652587_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_077535559.1|652660_654514_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.3	2.4e-37
WP_077535560.1|654521_654878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535561.1|654909_655200_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_077535562.1|655202_656231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535563.1|656227_657079_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167368333.1|661302_661806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535565.1|661823_662315_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_077535567.1|667690_668542_+	immunity 49 family protein	NA	NA	NA	NA	NA
WP_077535568.1|668574_669066_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535569.1|669083_670253_+	lipase family protein	NA	A0A2R8FER2	Brazilian_cedratvirus	33.0	2.0e-10
WP_077535570.1|670814_671588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535571.1|671581_672169_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077535572.1|672165_672780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535573.1|673228_673927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535574.1|674015_674390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077538800.1|674895_675411_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_077535575.1|675511_677047_-	catalase	NA	A0A2K9L572	Tupanvirus	39.6	2.9e-97
WP_077535576.1|677464_678139_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_157604220.1|678415_680140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535577.1|680174_681698_+	mannitol dehydrogenase family protein	NA	G9E6E2	Micromonas_pusilla_virus	32.2	2.0e-58
WP_077535578.1|681700_682618_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_077535579.1|682876_684343_+	carbon starvation protein A	NA	NA	NA	NA	NA
WP_077535580.1|684429_684948_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077535581.1|685175_685796_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_077535582.1|685838_686531_+	cupin	NA	NA	NA	NA	NA
WP_077535583.1|686652_687033_+	STAS/SEC14 domain-containing protein	NA	NA	NA	NA	NA
WP_077535584.1|687127_688021_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_077535585.1|688193_689714_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_077535586.1|690151_690832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535587.1|690973_691642_+	hypothetical protein	NA	NA	NA	NA	NA
691729:691788	attL	CGTTGGTGCGTCAAGCTAAGCTTGATCCATCTTGCAGGGTGCAAGTCCCTGTCGGGCAAG	NA	NA	NA	NA
WP_077535588.1|692286_693576_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.9	1.4e-28
691729:691788	attL	CGTTGGTGCGTCAAGCTAAGCTTGATCCATCTTGCAGGGTGCAAGTCCCTGTCGGGCAAG	NA	NA	NA	NA
WP_077535589.1|693805_695344_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077535590.1|695631_695967_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_077535591.1|695994_696471_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	30.1	9.1e-10
WP_157604222.1|696472_697597_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_077535592.1|697957_698284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535593.1|698319_699588_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_077535588.1|700477_701767_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.9	1.4e-28
WP_077535594.1|702052_703549_+|transposase	transposase	transposase	NA	NA	NA	NA
702666:702681	attR	GCAGTAAAGGCAAGCC	NA	NA	NA	NA
WP_077535595.1|703767_704757_+	NgoFVII family restriction endonuclease	NA	NA	NA	NA	NA
702666:702681	attR	GCAGTAAAGGCAAGCC	NA	NA	NA	NA
WP_077535596.1|705507_706002_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535597.1|706204_707155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077535598.1|707502_709023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077535599.1|709022_709928_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	35.2	5.4e-19
WP_077535600.1|710142_711363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077535601.1|711337_712750_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	36.2	2.9e-59
WP_077535602.1|712976_714521_-	peptidase M56, BlaR1	NA	NA	NA	NA	NA
WP_077535603.1|714547_714928_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_077535604.1|715930_716365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535605.1|716379_716685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157604224.1|717027_718142_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.8	6.0e-44
WP_077535606.1|718568_720587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077535607.1|721236_721761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167368294.1|722109_722271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535608.1|722899_723868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007377199.1|723893_724601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077535609.1|724879_725668_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_007581760.1|725660_726326_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_077535610.1|726358_726997_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	34.6	1.8e-16
WP_077535611.1|727052_728807_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_077535612.1|728803_730138_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_077535613.1|730124_730958_-	DUF547 domain-containing protein	NA	NA	NA	NA	NA
WP_077535614.1|730960_733114_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077535615.1|733124_735485_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_077535616.1|736049_736463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535617.1|736556_736982_-	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_077535618.1|737362_737581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535619.1|737604_739260_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_077535620.1|739518_740745_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_077535621.1|740861_742091_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_077535622.1|742087_743092_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	22.7	2.8e-08
WP_077535623.1|743254_745717_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_077535624.1|745779_745998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535625.1|746060_746279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157604226.1|746356_746554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535627.1|746625_747243_+	LysE family translocator	NA	NA	NA	NA	NA
WP_077535628.1|747395_748235_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_077535629.1|748515_749646_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.2	1.2e-36
WP_077535630.1|750525_751392_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077538804.1|751438_751951_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077535631.1|752121_753009_+	haloalkane dehalogenase	NA	B9U1C3	Vaccinia_virus	39.2	1.6e-55
WP_077535632.1|753079_755632_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	36.2	8.3e-166
WP_167368334.1|755878_756253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535634.1|756734_757280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535636.1|759273_759732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157604228.1|759989_760637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535638.1|760633_761743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535639.1|761903_762311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535640.1|762307_763018_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_077535641.1|763731_768957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077535642.1|768976_769627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077535643.1|770584_771622_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP019628	Pseudoalteromonas aliena strain EH1 chromosome, complete genome	4594697	2170801	2217114	4594697	integrase,tRNA,transposase,protease	Vibrio_phage(25.0%)	40	2189840:2189858	2201095:2201113
WP_157604224.1|2170801_2171915_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.8	6.0e-44
WP_077536751.1|2172408_2173089_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_077536752.1|2173465_2174224_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.0	4.4e-14
WP_077536753.1|2175347_2175767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077536754.1|2175811_2176228_-	glyoxalase	NA	NA	NA	NA	NA
WP_077536755.1|2176460_2178452_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	25.7	1.6e-15
WP_077536756.1|2179607_2181017_-	PDZ domain-containing protein	NA	NA	NA	NA	NA
WP_077536757.1|2181264_2182380_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077536758.1|2183226_2184210_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_077536759.1|2184220_2184598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077536760.1|2184598_2185672_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X6WGT4	Pacmanvirus	25.4	3.2e-10
WP_077536761.1|2185664_2186999_+	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_077536762.1|2187029_2188262_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_077536763.1|2188883_2189330_-	VOC family protein	NA	NA	NA	NA	NA
WP_167368338.1|2189423_2189618_-	hypothetical protein	NA	NA	NA	NA	NA
2189840:2189858	attL	ATTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_077536764.1|2189996_2191247_-	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_077536765.1|2191248_2193255_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_077536766.1|2193317_2196008_-	class I SAM-dependent DNA methyltransferase	NA	Q6NE04	Leptospira_phage	39.4	6.0e-167
WP_077536767.1|2196131_2196698_-	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	38.5	3.4e-19
WP_077536768.1|2196861_2197962_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_077536769.1|2197948_2198440_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077536770.1|2198426_2198633_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	57.4	5.1e-10
WP_077536771.1|2198727_2199645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077536772.1|2199668_2200880_-|integrase	tyrosine-type recombinase/integrase	integrase	B7SYF8	Stenotrophomonas_phage	37.1	9.6e-64
WP_007580030.1|2201095_2202742_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	67.8	1.0e-185
2201095:2201113	attR	ATTACATCATTCCGCCCAT	NA	NA	NA	NA
WP_077536773.1|2202790_2203078_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	40.4	3.7e-14
WP_077536774.1|2203187_2203664_-	FxsA family protein	NA	NA	NA	NA	NA
WP_077536775.1|2203830_2204151_+	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_077536776.1|2204150_2205986_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_077536777.1|2206214_2206667_+	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_077536778.1|2206708_2207167_+	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_077536779.1|2207193_2208534_+	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_077536780.1|2208660_2209131_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_077536781.1|2209155_2210499_+	AMIN domain-containing protein	NA	A0A067ZJB6	Vibrio_phage	29.2	7.5e-17
WP_077536782.1|2210535_2212383_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	43.7	5.6e-63
WP_077538927.1|2212393_2213311_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_077536783.1|2213390_2213654_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_077536784.1|2213670_2214960_+	GTPase HflX	NA	NA	NA	NA	NA
WP_077536785.1|2215060_2216230_+|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_077536786.1|2216235_2217114_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
>prophage 3
NZ_CP019628	Pseudoalteromonas aliena strain EH1 chromosome, complete genome	4594697	2652830	2660987	4594697		uncultured_Mediterranean_phage(28.57%)	8	NA	NA
WP_077537128.1|2652830_2653595_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.5	1.8e-71
WP_077537129.1|2653584_2654223_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	50.6	2.4e-37
WP_077537130.1|2654232_2654811_+	DedA family protein	NA	NA	NA	NA	NA
WP_077537131.1|2654852_2655677_+	peptidoglycan DD-metalloendopeptidase family protein	NA	G3MBP9	Bacillus_virus	36.0	1.8e-05
WP_077537132.1|2655712_2656687_+	RNA polymerase sigma factor RpoS	NA	A0A2I7SAT0	Vibrio_phage	30.5	1.3e-31
WP_077537133.1|2656779_2659365_-	DNA mismatch repair protein MutS	NA	A0A1V0SJ67	Klosneuvirus	26.2	1.3e-36
WP_077537134.1|2659386_2659875_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	41.2	6.7e-24
WP_008170234.1|2659943_2660987_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	64.5	3.8e-117
>prophage 4
NZ_CP019628	Pseudoalteromonas aliena strain EH1 chromosome, complete genome	4594697	3507107	3515792	4594697	tRNA,transposase	Leptospira_phage(33.33%)	8	NA	NA
WP_077537735.1|3507107_3509603_+	DUF87 domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	6.1e-89
WP_077537736.1|3509599_3510226_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_077537737.1|3510218_3511562_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	37.5	4.6e-75
WP_077537738.1|3511554_3511935_+	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	38.5	1.2e-09
WP_077537739.1|3511944_3513249_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	51.0	6.2e-93
WP_077535063.1|3513520_3513817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077535064.1|3513816_3514164_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	45.3	9.9e-22
WP_157604331.1|3514310_3515792_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	32.3	1.1e-66
