The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	182770	240241	4289950	integrase,transposase	Paenibacillus_phage(21.43%)	49	195647:195661	211073:211087
WP_104932612.1|182770_183815_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_023484160.1|183865_184912_+	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_051428085.1|188355_188547_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051428086.1|188668_188893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484157.1|188902_190018_+	carbohydrate binding domain-containing protein	NA	A0A1V0E026	Clostridioides_phage	41.7	2.3e-43
WP_036658119.1|192672_193356_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.5	4.5e-119
WP_023484916.1|194511_194907_+	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_158225746.1|194920_195319_-	S8 family serine peptidase	NA	A0A127AWU5	Bacillus_phage	41.9	1.4e-11
WP_077584844.1|195358_195649_+	hypothetical protein	NA	NA	NA	NA	NA
195647:195661	attL	TGATTTTACTTGGGT	NA	NA	NA	NA
WP_155116255.1|196136_196277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428087.1|196367_197624_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	35.6	1.4e-62
WP_024093569.1|197863_198823_+	hypothetical protein	NA	A0A2I7SCF1	Paenibacillus_phage	89.9	2.6e-112
WP_023484911.1|198837_199200_+	hypothetical protein	NA	A0A2I7SCG2	Paenibacillus_phage	79.2	6.4e-48
WP_077584845.1|200744_201038_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036658123.1|201034_201547_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_023483535.1|201805_202963_-	MFS transporter	NA	NA	NA	NA	NA
WP_036658125.1|203074_203953_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036658128.1|204748_204976_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_036658506.1|206976_207141_+	FeoB-associated Cys-rich membrane protein	NA	NA	NA	NA	NA
WP_023485392.1|207283_207847_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_036658131.1|207858_209388_+	alkyl hydroperoxide reductase subunit F	NA	A0A2I2L5E1	Orpheovirus	32.4	5.7e-37
WP_158529810.1|209704_210040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658135.1|210026_210260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658138.1|210293_210593_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_051428088.1|210860_211232_+	3'-5' exonuclease	NA	A2I2Z6	Vibrio_virus	44.0	4.3e-15
211073:211087	attR	TGATTTTACTTGGGT	NA	NA	NA	NA
WP_036658141.1|211364_211802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428089.1|212716_213247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483545.1|213460_214069_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.5	8.3e-32
WP_155116257.1|214058_214211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051428090.1|214943_215285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483466.1|215324_216299_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	36.3	3.0e-52
WP_155116258.1|216288_216438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483464.1|217608_217995_+	DUF1878 family protein	NA	NA	NA	NA	NA
WP_023483463.1|218039_219182_+	S8 family peptidase	NA	A0A1B0T6A2	Bacillus_phage	37.4	7.2e-45
WP_036658145.1|220490_220691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658150.1|222489_222687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484139.1|222922_223117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046655214.1|223873_224359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658514.1|224479_224950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658153.1|225867_226344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658155.1|226386_226620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658160.1|227954_229067_+	alanine dehydrogenase	NA	NA	NA	NA	NA
WP_023483532.1|229157_230528_+	amino acid permease	NA	NA	NA	NA	NA
WP_024095239.1|232609_233173_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	41.0	2.6e-24
WP_036656001.1|233387_233705_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023484372.1|235152_236340_-	MFS transporter	NA	NA	NA	NA	NA
WP_036658167.1|236411_237578_-	amidohydrolase	NA	NA	NA	NA	NA
WP_158225752.1|237762_239058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932612.1|239196_240241_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
>prophage 2
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	369073	432820	4289950	head,portal,tail,integrase,transposase,holin,capsid,terminase	Paenibacillus_phage(58.33%)	71	361277:361293	410257:410273
361277:361293	attL	GGGAAAGTCATGAATAC	NA	NA	NA	NA
WP_104932543.1|369073_369943_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_036658287.1|371687_371963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046655359.1|372076_372895_+	sporulation protein YunB	NA	NA	NA	NA	NA
WP_042119748.1|372949_374026_-	M23 family metallopeptidase	NA	A0A7K9	Microcystis_virus	37.0	5.1e-08
WP_024094891.1|374214_375108_+	lipoyl synthase	NA	NA	NA	NA	NA
WP_023482946.1|375145_375565_+	YutD family protein	NA	NA	NA	NA	NA
WP_023483243.1|377241_378048_-	NAD kinase	NA	NA	NA	NA	NA
WP_036658570.1|378191_379436_-	sporulation integral membrane protein YlbJ	NA	NA	NA	NA	NA
WP_036658291.1|379753_380137_+	globin	NA	NA	NA	NA	NA
WP_077584863.1|380164_380866_+	DUF2225 domain-containing protein	NA	NA	NA	NA	NA
WP_036658295.1|380993_381230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077584864.1|381231_381432_-	YycC family protein	NA	NA	NA	NA	NA
WP_036658297.1|381654_383460_+	M3 family oligoendopeptidase	NA	NA	NA	NA	NA
WP_023483248.1|384037_384403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051428101.1|384455_385595_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	39.7	2.2e-62
WP_036658299.1|385674_386139_-	hypothetical protein	NA	A0A2I7SC21	Paenibacillus_phage	58.8	1.1e-49
WP_036658575.1|386146_386455_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	33.5	1.9e-16
WP_036658301.1|386931_387114_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_046655182.1|387083_387332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658305.1|387348_387600_+	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	46.9	2.8e-10
WP_036658306.1|387615_387846_+	hypothetical protein	NA	A0A2I7SC43	Paenibacillus_phage	88.2	1.8e-32
WP_036658308.1|387842_388127_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	95.7	2.1e-46
WP_036658310.1|388159_388531_+	hypothetical protein	NA	A0A0K2CZF3	Paenibacillus_phage	100.0	5.7e-60
WP_036658312.1|388567_389278_+	hypothetical protein	NA	A0A0K2CZT8	Paenibacillus_phage	100.0	3.6e-127
WP_036658314.1|389343_390654_+	AAA family ATPase	NA	A0A0K2CZN2	Paenibacillus_phage	99.8	1.4e-180
WP_023483362.1|390656_391733_+	ATP-binding protein	NA	A0A0K2CZH1	Paenibacillus_phage	100.0	5.1e-210
WP_036658315.1|391757_392264_+	hypothetical protein	NA	A0A0K2CZ91	Paenibacillus_phage	100.0	1.8e-93
WP_036658317.1|392273_393854_+	DEAD/DEAH box helicase	NA	A0A0K2CZF8	Paenibacillus_phage	100.0	4.7e-305
WP_077584865.1|393889_394060_+	DUF3797 domain-containing protein	NA	A0A0K2CZU3	Paenibacillus_phage	100.0	6.9e-29
WP_036658319.1|394067_396320_+	AAA family ATPase	NA	A0A0K2CZ75	Paenibacillus_phage	100.0	0.0e+00
WP_036658320.1|396606_396885_+	hypothetical protein	NA	A0A0K2CZH7	Paenibacillus_phage	100.0	4.9e-48
WP_036658322.1|396874_397270_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CZ96	Paenibacillus_phage	100.0	2.0e-71
WP_036658324.1|397273_397495_+	hypothetical protein	NA	A0A0K2CZG3	Paenibacillus_phage	100.0	9.9e-36
WP_158673680.1|397511_398597_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CZU8	Paenibacillus_phage	99.7	1.2e-209
WP_036658328.1|398630_398825_+	hypothetical protein	NA	A0A0K2CZP1	Paenibacillus_phage	100.0	3.2e-30
WP_036658330.1|398821_399250_+	RinA family phage transcriptional regulator	NA	A0A0K2CZI2	Paenibacillus_phage	100.0	1.9e-75
WP_036658332.1|399382_399589_+	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	93.9	2.2e-29
WP_046655181.1|399644_399887_+	hypothetical protein	NA	A0A1C8E971	Bacillus_phage	85.5	1.3e-28
WP_023484968.1|400462_401242_+|terminase	phage-related terminase-like protein small subunit	terminase	A0A1L2JY44	Aeribacillus_phage	52.3	6.4e-53
WP_023484969.1|401225_402521_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1L2JY46	Aeribacillus_phage	58.6	3.9e-140
WP_023484970.1|402521_403931_+|portal	phage portal protein	portal	A0A097PAT2	Streptococcus_pyogenes_phage	50.7	2.4e-114
WP_158529811.1|403839_404454_+	hypothetical protein	NA	A0A097PBF2	Streptococcus_pyogenes_phage	35.7	2.3e-13
WP_077584867.1|404459_404732_+|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	47.1	9.8e-17
WP_023484972.1|404812_405409_+	DUF4355 domain-containing protein	NA	NA	NA	NA	NA
WP_023484973.1|405421_406318_+	hypothetical protein	NA	A7J297	Streptococcus_phage	52.1	4.3e-69
WP_023484974.1|406320_406644_+|head,tail	phage head-tail connector protein	head,tail	NA	NA	NA	NA
WP_023484975.1|406640_406946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036658585.1|406951_407287_+	hypothetical protein	NA	A0A097PAT9	Streptococcus_pyogenes_phage	37.2	2.4e-09
WP_023484976.1|407291_407702_+	DUF5072 family protein	NA	A0A097PAW5	Streptococcus_pyogenes_phage	44.9	3.9e-33
WP_023484977.1|407715_408240_+|tail	phage major tail protein, TP901-1 family	tail	A0A097PBF4	Streptococcus_pyogenes_phage	72.8	1.6e-52
WP_036658588.1|408242_408545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585227.1|408670_408970_+	phenylalanine racemase	NA	A0A097PAX1	Streptococcus_pyogenes_phage	45.8	5.3e-16
WP_023484978.1|408990_412191_+	tape measure protein	NA	M1IEW1	Bacillus_virus	43.2	6.7e-56
410257:410273	attR	GGGAAAGTCATGAATAC	NA	NA	NA	NA
WP_036658337.1|412193_412892_+	hypothetical protein	NA	A0A1B2APY0	Phage_Wrath	41.8	2.4e-43
WP_158673688.1|412948_414370_+|tail	phage tail protein	tail	A0A1B2APX2	Phage_Wrath	54.4	1.6e-110
WP_023484981.1|414369_415134_+	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	80.9	1.5e-70
WP_036658339.1|415145_415346_+	hypothetical protein	NA	A0A0C5AE97	Paenibacillus_phage	62.5	3.9e-15
WP_155116252.1|415471_415639_+	hypothetical protein	NA	A0A0C5ABK5	Bacteriophage	87.0	2.3e-16
WP_077585228.1|416181_416850_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0C5AEW3	Paenibacillus_phage	94.6	1.3e-126
WP_051428102.1|417113_417554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036658597.1|418198_418441_+	hypothetical protein	NA	A0A0C5AN23	Paenibacillus_phage	92.5	1.6e-31
WP_104932584.1|419691_420039_+	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	99.1	1.5e-57
WP_096761240.1|420522_421673_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	35.1	2.3e-35
WP_036658346.1|424171_425734_+	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_077584997.1|426021_426108_+|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_077584868.1|426326_427610_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023483236.1|427947_429171_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036658350.1|429539_429887_+	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	67.5	8.9e-23
WP_023485372.1|430563_431976_+	NADP-dependent phosphogluconate dehydrogenase	NA	E3SJC4	Synechococcus_phage	29.4	3.9e-32
WP_042119627.1|431977_432241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077584869.1|432718_432820_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	527510	540303	4289950	integrase	Paenibacillus_phage(58.33%)	17	527168:527183	540331:540346
527168:527183	attL	TTTTTGTGCAAAATAA	NA	NA	NA	NA
WP_077584874.1|527510_528128_-|integrase	site-specific integrase	integrase	S5MNZ2	Brevibacillus_phage	53.0	5.1e-37
WP_024094340.1|528111_528447_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MNZ2	Brevibacillus_phage	43.2	6.8e-12
WP_051428114.1|528612_529164_-	helix-turn-helix domain-containing protein	NA	R9VW28	Paenibacillus_phage	33.3	3.6e-18
WP_024094338.1|529310_529535_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158529812.1|529534_529705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042119037.1|530129_530333_+	hypothetical protein	NA	A0A0S2SXP3	Bacillus_phage	40.0	6.8e-07
WP_040930346.1|530415_530931_-	DUF3231 family protein	NA	NA	NA	NA	NA
WP_077584875.1|531042_531369_+	hypothetical protein	NA	A0A0C5AFG5	Paenibacillus_phage	82.2	1.6e-45
WP_036658701.1|531625_531976_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	60.0	1.4e-28
WP_024094328.1|534947_535187_+	hypothetical protein	NA	A0A0C5AEG8	Bacteriophage	100.0	2.8e-36
WP_077585229.1|535186_535855_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	95.9	4.0e-128
WP_024094326.1|535864_536107_+	hypothetical protein	NA	A0A2I7SCT4	Paenibacillus_phage	97.5	7.3e-32
WP_023483239.1|536497_537829_+	lytic polysaccharide monooxygenase	NA	A0A2D1GD28	Mycobacterium_phage	29.3	4.1e-07
WP_104932493.1|538199_538646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094322.1|539090_539480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094321.1|539627_540041_-	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	98.6	8.7e-33
WP_024094320.1|540105_540303_+	helix-turn-helix transcriptional regulator	NA	D0R7I7	Paenibacillus_phage	76.9	2.4e-09
540331:540346	attR	TTTTTGTGCAAAATAA	NA	NA	NA	NA
>prophage 4
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	560604	639472	4289950	tRNA,head,portal,tail,protease,holin,transposase,capsid,terminase	Paenibacillus_phage(96.05%)	108	NA	NA
WP_077584880.1|560604_561357_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_023484358.1|561499_561841_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_023484359.1|561952_562555_+	signal peptidase I	NA	NA	NA	NA	NA
WP_036658681.1|562646_563528_+	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_023484361.1|563820_564504_+	ribonuclease HII	NA	G4YAY0	Emiliania_huxleyi_virus	37.7	5.7e-21
WP_077584881.1|564558_565383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077584882.1|565625_566369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484363.1|566365_566698_+	EscU/YscU/HrcU family type III secretion system export apparatus switch protein	NA	NA	NA	NA	NA
WP_023484364.1|566707_567112_+	YraN family protein	NA	NA	NA	NA	NA
WP_023484366.1|567631_569314_-	recombinase family protein	NA	A0A0K2CYN0	Paenibacillus_phage	100.0	0.0e+00
WP_036658676.1|569315_569654_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZ35	Paenibacillus_phage	100.0	9.2e-57
WP_046655112.1|569748_569970_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CYW6	Paenibacillus_phage	100.0	1.7e-35
WP_144029586.1|570092_570284_+	hypothetical protein	NA	A0A0K2CYD7	Paenibacillus_phage	100.0	5.0e-28
WP_036658672.1|570298_570568_+	hypothetical protein	NA	A0A0K2CYH1	Paenibacillus_phage	100.0	8.4e-45
WP_036658670.1|570588_570792_+	hypothetical protein	NA	R9W009	Paenibacillus_phage	100.0	2.2e-34
WP_036658668.1|570798_571176_+	hypothetical protein	NA	R9VW30	Paenibacillus_phage	100.0	1.2e-65
WP_036658666.1|571172_571403_+	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	100.0	1.0e-35
WP_155116304.1|571386_571560_+	hypothetical protein	NA	R9VY98	Paenibacillus_phage	100.0	6.0e-28
WP_023483806.1|571564_572317_+	phage antirepressor KilAC domain-containing protein	NA	A0A0K2CY14	Paenibacillus_phage	100.0	3.9e-140
WP_036658665.1|572313_572889_+	hypothetical protein	NA	A0A0K2CYP2	Paenibacillus_phage	100.0	1.1e-102
WP_036658663.1|572881_573139_+	hypothetical protein	NA	A0A0K2CZ43	Paenibacillus_phage	100.0	1.7e-42
WP_036658661.1|573128_573641_-	hypothetical protein	NA	A0A0K2CYX7	Paenibacillus_phage	100.0	2.9e-94
WP_036658659.1|573727_574072_+	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	100.0	3.8e-58
WP_155116354.1|574049_574190_+	hypothetical protein	NA	A0A0K2CYI0	Paenibacillus_phage	100.0	3.1e-19
WP_036658656.1|574289_574553_+	hypothetical protein	NA	A0A0K2CYP7	Paenibacillus_phage	100.0	2.6e-43
WP_023485214.1|574549_575098_+	host-nuclease inhibitor Gam family protein	NA	A0A0K2CZ48	Paenibacillus_phage	100.0	4.3e-96
WP_023485215.1|575100_575739_+	ERF family protein	NA	A0A0K2CYY2	Paenibacillus_phage	100.0	5.9e-113
WP_036658655.1|575728_576133_+	single-stranded DNA-binding protein	NA	A0A0K2CYR2	Paenibacillus_phage	100.0	7.8e-71
WP_036658652.1|576141_576531_+	hypothetical protein	NA	A0A0K2CYI4	Paenibacillus_phage	100.0	1.5e-66
WP_036658651.1|576527_576860_+	hypothetical protein	NA	A0A0K2CYQ2	Paenibacillus_phage	100.0	2.8e-58
WP_023483153.1|576939_577722_+	DnaD domain protein	NA	A0A0K2CZ53	Paenibacillus_phage	100.0	1.9e-137
WP_104932619.1|577621_578434_+	ATP-binding protein	NA	A0A0K2CYY7	Paenibacillus_phage	99.5	7.5e-121
WP_036658649.1|578552_578771_+	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	100.0	3.7e-35
WP_036658646.1|578763_579138_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	100.0	1.4e-66
WP_036658643.1|579319_579685_+	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	100.0	4.7e-67
WP_023483250.1|579701_580484_+	DNA cytosine methyltransferase	NA	A0A0K2CYZ1	Paenibacillus_phage	100.0	7.4e-158
WP_036658642.1|580467_580650_+	hypothetical protein	NA	A0A0K2CYS1	Paenibacillus_phage	100.0	7.7e-26
WP_036658640.1|580701_580935_+	hypothetical protein	NA	A0A0K2CYJ4	Paenibacillus_phage	100.0	4.3e-37
WP_036658638.1|580927_581173_+	hypothetical protein	NA	A0A0K2CYR3	Paenibacillus_phage	100.0	1.6e-39
WP_155116353.1|581169_581313_+	hypothetical protein	NA	A0A0K2CZ63	Paenibacillus_phage	100.0	3.0e-17
WP_077584885.1|581441_581879_+	transcriptional regulator	NA	A0A0K2CYZ6	Paenibacillus_phage	100.0	3.7e-74
WP_036658635.1|582084_582429_+	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	100.0	4.5e-59
WP_023484796.1|582483_582900_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CYJ8	Paenibacillus_phage	100.0	9.2e-75
WP_036658634.1|582930_583134_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0K2CYR6	Paenibacillus_phage	100.0	1.5e-33
WP_023484126.1|583313_583628_+	hypothetical protein	NA	A0A0K2CZ01	Paenibacillus_phage	100.0	1.9e-48
WP_077584886.1|583614_583959_+	HNH endonuclease	NA	A0A0K2CZA0	Paenibacillus_phage	87.7	2.8e-53
WP_023484127.1|584062_584377_+|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZ94	Paenibacillus_phage	100.0	1.6e-50
WP_077584887.1|584357_586082_+|terminase	terminase large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	100.0	0.0e+00
WP_036656297.1|586096_587332_+|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	99.8	3.5e-239
WP_046655269.1|587321_588038_+|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	100.0	1.1e-131
WP_023484582.1|588034_589177_+|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	99.5	6.6e-208
WP_036656301.1|589302_589566_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0K2CZI4	Paenibacillus_phage	100.0	4.2e-41
WP_023484581.1|589562_589883_+|head	phage head closure protein	head	A0A0K2CZB5	Paenibacillus_phage	100.0	3.0e-57
WP_036656302.1|589879_590272_+	HK97 gp10 family phage protein	NA	A0A0K2CZ33	Paenibacillus_phage	100.0	4.3e-66
WP_036656304.1|590268_590598_+	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	100.0	4.4e-56
WP_046655268.1|590633_591230_+	hypothetical protein	NA	A0A0K2CZP8	Paenibacillus_phage	100.0	3.9e-111
WP_023484578.1|591301_591673_+	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	100.0	2.9e-64
WP_077584888.1|591906_592338_+	hypothetical protein	NA	A0A2I7SBZ5	Paenibacillus_phage	94.6	5.3e-49
WP_077584889.1|592283_595610_+|tail	phage tail tape measure protein	tail	A0A0K2CYK9	Paenibacillus_phage	100.0	4.3e-308
WP_023484576.1|595610_596477_+|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	100.0	4.0e-165
WP_023484575.1|596479_597598_+	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	100.0	2.0e-212
WP_051428011.1|597603_598677_+	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	99.7	7.1e-212
WP_036656307.1|598686_599028_+	hypothetical protein	NA	A0A0K2CZC5	Paenibacillus_phage	100.0	9.9e-59
WP_167552488.1|599024_599186_+	hypothetical protein	NA	A0A0K2CZ44	Paenibacillus_phage	100.0	8.8e-26
WP_024094415.1|599166_599406_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	100.0	2.8e-36
WP_077585230.1|599405_600080_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	R9VY83	Paenibacillus_phage	100.0	1.8e-136
WP_051428122.1|600364_600619_+	hypothetical protein	NA	R9W000	Paenibacillus_phage	100.0	2.7e-37
WP_077584890.1|600805_601774_+	hypothetical protein	NA	A0A0K2CYL7	Paenibacillus_phage	99.7	4.6e-178
WP_036658891.1|601793_602147_+	hypothetical protein	NA	R9W0N7	Paenibacillus_phage	100.0	4.8e-64
WP_036658895.1|602130_602574_+	hypothetical protein	NA	A0A0K2CYV0	Paenibacillus_phage	100.0	5.8e-75
WP_023484754.1|603426_606354_+	RICIN domain-containing protein	NA	A0A0K2CYN4	Paenibacillus_phage	100.0	0.0e+00
WP_036653966.1|606665_606929_-	hypothetical protein	NA	A0A0K2CYM1	Paenibacillus_phage	100.0	3.8e-42
WP_036653970.1|607014_607200_-	hypothetical protein	NA	A0A0K2CZ26	Paenibacillus_phage	100.0	8.3e-28
WP_036653973.1|607668_607896_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	100.0	8.6e-35
WP_077584891.1|607996_608155_+|holin	putative holin-like toxin	holin	A0A0K2CYN9	Paenibacillus_phage	100.0	8.4e-21
WP_036653975.1|608365_608917_-	DUF4352 domain-containing protein	NA	A0A0K2CYG1	Paenibacillus_phage	100.0	3.4e-69
WP_036653977.1|609140_609809_+	hypothetical protein	NA	A0A0K2CYM6	Paenibacillus_phage	100.0	3.5e-108
WP_036653979.1|609801_610317_+	accessory gene regulator B family protein	NA	A0A0K2CZ30	Paenibacillus_phage	100.0	1.8e-88
WP_036653981.1|610448_610805_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	A0A0K2CYP4	Paenibacillus_phage	100.0	1.0e-61
WP_152532805.1|611040_611328_+	hypothetical protein	NA	A0A0K2CYG5	Paenibacillus_phage	98.7	8.4e-35
WP_036653988.1|611367_611703_-	transcriptional regulator	NA	A0A0K2CYN0	Paenibacillus_phage	100.0	1.1e-54
WP_104932581.1|611824_612874_-	YifB family Mg chelatase-like AAA ATPase	NA	NA	NA	NA	NA
WP_024094299.1|613007_613403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094298.1|613434_613695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484652.1|614081_615242_+	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_023484651.1|615298_616234_+	succinate--CoA ligase subunit alpha	NA	NA	NA	NA	NA
WP_023484649.1|617593_619684_+	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	40.9	1.8e-110
WP_023484648.1|619696_621025_+|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_036653992.1|621203_621746_+|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_174567583.1|621801_623310_+|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	27.6	2.4e-40
WP_024094289.1|623344_624130_+	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_036653997.1|624373_624784_+	flagellar basal body rod protein FlgB	NA	NA	NA	NA	NA
WP_024094288.1|624787_625237_+	flagellar basal body rod protein FlgC	NA	NA	NA	NA	NA
WP_024094287.1|625258_625573_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_024094286.1|625674_627258_+	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_036653999.1|627270_628287_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_036654005.1|628279_629107_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_023484638.1|629106_630426_+	flagellar protein export ATPase FliI	NA	NA	NA	NA	NA
WP_023484637.1|630436_630880_+	flagellar export protein FliJ	NA	NA	NA	NA	NA
WP_024094283.1|630905_631817_+	protein kinase PKN/PRK1, effector,flagellar motor switch protein FliG-like protein	NA	NA	NA	NA	NA
WP_023484635.1|631852_633256_+	flagellar hook-length control protein FliK	NA	NA	NA	NA	NA
WP_052752953.1|633291_633885_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484724.1|633881_634271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094279.1|634359_635172_+	flagellar hook-basal body complex protein	NA	NA	NA	NA	NA
WP_023484722.1|635224_635446_+	flagellar FlbD family protein	NA	NA	NA	NA	NA
WP_023484720.1|635940_636939_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_023484719.1|636928_638176_+	flagellar motor switch phosphatase FliY	NA	NA	NA	NA	NA
WP_023483236.1|638248_639472_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 5
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	802731	901519	4289950	transposase,bacteriocin	Tupanvirus(28.57%)	65	NA	NA
WP_104932533.1|802731_803553_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	50.3	5.5e-39
WP_077584913.1|803507_803681_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_042119576.1|803862_804852_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_077584914.1|805224_806016_+	polysaccharide deacetylase	NA	NA	NA	NA	NA
WP_023484992.1|806076_806721_+	YkyA family protein	NA	NA	NA	NA	NA
WP_023484993.1|806769_807333_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036654120.1|807590_808481_-	DUF3471 domain-containing protein	NA	NA	NA	NA	NA
WP_024094172.1|808996_809182_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096761293.1|809756_809936_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036654122.1|812080_812596_+	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	32.5	1.2e-12
WP_096761125.1|812663_813708_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_158673685.1|813705_816489_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	31.2	2.5e-67
WP_077584917.1|816510_819555_+	non-ribosomal peptide synthetase	NA	A0A2K9L3I8	Tupanvirus	24.7	1.9e-76
WP_023483474.1|819778_821440_+	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	30.3	5.0e-55
WP_077584918.1|821904_827535_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	27.5	7.3e-98
WP_023484588.1|827507_830336_+	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	33.8	2.0e-88
WP_051427813.1|830425_830638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654129.1|831129_831792_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit beta	NA	NA	NA	NA	NA
WP_023484590.1|831818_832700_+	L-serine ammonia-lyase, iron-sulfur-dependent, subunit alpha	NA	NA	NA	NA	NA
WP_023484592.1|834418_834850_+	NfeD family protein	NA	NA	NA	NA	NA
WP_023484593.1|834853_835780_+	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_023484594.1|835948_837226_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_023484595.1|837483_838542_-	DctP family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_024094161.1|841884_842367_+	low molecular weight phosphotyrosine protein phosphatase	NA	NA	NA	NA	NA
WP_023484599.1|843761_844967_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_023484600.1|844988_845984_+	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_036654131.1|846004_846898_+	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_023484602.1|846984_848514_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_024094156.1|848743_849979_+	MFS transporter	NA	NA	NA	NA	NA
WP_024094155.1|850260_850425_+	GapA-binding peptide SR1P	NA	NA	NA	NA	NA
WP_036656604.1|850424_853118_+	pyruvate, phosphate dikinase	NA	A0A2D2W2B1	Stenotrophomonas_phage	40.4	2.3e-94
WP_023484605.1|853210_853840_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023484606.1|853846_854650_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_024094152.1|854820_856575_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.7	1.3e-61
WP_023484608.1|856636_857719_-	tyrosine recombinase XerS	NA	A0A2R2ZGM9	Clostridioides_phage	25.6	3.9e-08
WP_023484609.1|858304_860605_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_077584919.1|862350_862926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484612.1|863868_866517_+	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.9	4.0e-38
WP_036656608.1|866624_867959_+	magnesium transporter	NA	NA	NA	NA	NA
WP_036654146.1|871760_872453_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.7	3.9e-46
WP_036656612.1|872427_873882_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	28.4	2.1e-25
WP_024094142.1|874190_875558_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_036654150.1|876248_877079_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_040931545.1|877471_877678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094139.1|877732_878017_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484621.1|878222_879110_+	anion permease	NA	NA	NA	NA	NA
WP_077584922.1|879202_880612_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_036654154.1|881632_882154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427815.1|882186_882441_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_051427817.1|882937_883243_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_023484627.1|884442_884832_+	DoxX family protein	NA	NA	NA	NA	NA
WP_023484628.1|884998_885427_+	cell wall hydrolase	NA	NA	NA	NA	NA
WP_023484630.1|886915_887464_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_024094129.1|887841_888048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040931540.1|889154_889925_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
WP_096761262.1|889911_891018_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_040931749.1|891037_891865_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_036654158.1|892222_892999_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_023483236.1|893679_894903_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036654163.1|895056_895329_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	94.7	1.6e-30
WP_051427818.1|895976_896219_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	91.2	2.6e-29
WP_051427819.1|896516_897062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654167.1|897335_898694_+	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.7	2.0e-73
WP_036654169.1|899886_900393_+	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	33.3	8.5e-06
WP_104932616.1|900474_901519_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
>prophage 6
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	1373450	1443861	4289950	tail,portal,transposase	Paenibacillus_phage(91.78%)	88	NA	NA
WP_023483236.1|1373450_1374674_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_051427858.1|1375320_1375503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483502.1|1375968_1376352_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483501.1|1376348_1377215_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.0	7.9e-20
WP_023483500.1|1377204_1377855_+	ABC-2 transporter permease	NA	NA	NA	NA	NA
WP_023483497.1|1379180_1379564_-	kinase-associated lipoprotein B	NA	NA	NA	NA	NA
WP_023483496.1|1379642_1379981_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_023483495.1|1380003_1380537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656763.1|1380619_1382239_-	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	27.9	2.4e-54
WP_036654499.1|1382269_1384183_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.9	6.4e-54
WP_036654503.1|1384217_1385261_-	M42 family metallopeptidase	NA	NA	NA	NA	NA
WP_036656764.1|1385577_1385868_-	Dabb family protein	NA	NA	NA	NA	NA
WP_023483491.1|1385893_1387450_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	28.3	4.4e-53
WP_046655198.1|1387589_1389332_-	FHA domain-containing protein	NA	NA	NA	NA	NA
WP_077584987.1|1390103_1390730_+	hypothetical protein	NA	A0A0N9SJT2	Paenibacillus_phage	59.0	7.5e-36
WP_023484106.1|1390903_1391329_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654623.1|1391375_1391726_+	hypothetical protein	NA	A0A2I7SCF2	Paenibacillus_phage	84.5	2.5e-49
WP_046655200.1|1392141_1392387_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023484108.1|1392526_1393540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036654626.1|1393558_1393834_+	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	60.9	1.2e-19
WP_158225708.1|1394056_1394695_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	96.4	9.1e-106
WP_051427866.1|1394606_1394861_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	100.0	5.3e-41
WP_158225709.1|1395256_1395694_-	hypothetical protein	NA	A0A0N9S7V6	Paenibacillus_phage	98.6	8.8e-76
WP_167552494.1|1395690_1397238_-|tail	phage tail protein	tail	A0A0N9SIL8	Paenibacillus_phage	98.1	1.7e-294
WP_167552495.1|1397262_1398012_-|tail	phage tail protein	tail	A0A0N9SIL8	Paenibacillus_phage	96.0	1.9e-139
WP_023484113.1|1398014_1399472_-|tail	phage tail family protein	tail	A0A0N9RRA9	Paenibacillus_phage	96.3	5.8e-281
WP_077584990.1|1399473_1399998_-	hypothetical protein	NA	A0A0N9SJR9	Paenibacillus_phage	53.7	1.2e-34
WP_158529819.1|1400141_1401083_-	hypothetical protein	NA	A0A0N9SJR9	Paenibacillus_phage	27.0	9.9e-08
WP_036654632.1|1402393_1402771_-	hypothetical protein	NA	A0A0N9RZB8	Paenibacillus_phage	72.0	5.3e-21
WP_036654634.1|1402743_1403121_-	hypothetical protein	NA	A0A0N9SST2	Paenibacillus_phage	92.8	6.6e-56
WP_036654636.1|1403123_1403381_-	hypothetical protein	NA	A0A0K2CZ43	Paenibacillus_phage	51.9	8.1e-13
WP_036654638.1|1403447_1404017_-	hypothetical protein	NA	A0A0N9SHI3	Paenibacillus_phage	70.5	3.7e-66
WP_036654641.1|1404029_1404404_-	hypothetical protein	NA	A0A0N7GFE5	Paenibacillus_phage	95.2	1.6e-62
WP_036654643.1|1404400_1404826_-	hypothetical protein	NA	A0A0N9SJT1	Paenibacillus_phage	90.8	2.9e-68
WP_023484117.1|1404822_1405155_-	hypothetical protein	NA	A0A0N9RTI3	Paenibacillus_phage	99.1	4.1e-57
WP_036654646.1|1405155_1405539_-	hypothetical protein	NA	A0A0N9SGG4	Paenibacillus_phage	94.5	2.2e-62
WP_023484118.1|1405553_1406489_-	hypothetical protein	NA	A0A0N9S7T7	Paenibacillus_phage	79.4	2.7e-143
WP_023484119.1|1406544_1407198_-	hypothetical protein	NA	A0A0N9SIL0	Paenibacillus_phage	81.0	4.1e-61
WP_023484120.1|1407285_1408149_-	hypothetical protein	NA	A0A0N9SJR1	Paenibacillus_phage	83.6	3.8e-131
WP_036656796.1|1408145_1409642_-|portal	phage portal protein	portal	A0A0N7GFE4	Paenibacillus_phage	93.9	4.9e-251
WP_036654649.1|1411719_1411971_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484124.1|1412862_1413252_-	helix-turn-helix domain-containing protein	NA	A0A0N7GFF5	Paenibacillus_phage	100.0	1.5e-66
WP_023484125.1|1413241_1413661_-	hypothetical protein	NA	A0A0N9SJZ8	Paenibacillus_phage	95.7	3.9e-73
WP_158225710.1|1413662_1413830_-	hypothetical protein	NA	A0A0N9RTP7	Paenibacillus_phage	76.4	6.6e-16
WP_036654652.1|1413819_1414038_-	hypothetical protein	NA	A0A0N9SGN2	Paenibacillus_phage	94.4	6.8e-29
WP_023483236.1|1414218_1415442_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036654658.1|1415738_1416131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051427869.1|1417327_1417780_-	hypothetical protein	NA	A0A0N7GFF4	Paenibacillus_phage	75.3	1.4e-60
WP_051427870.1|1417769_1418177_-	DUF134 domain-containing protein	NA	A0A0N9RZI0	Paenibacillus_phage	84.4	8.5e-57
WP_023485385.1|1418164_1419442_-	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX25	Bacillus_phage	39.7	1.5e-75
WP_023485386.1|1419455_1420622_-	SAM-dependent DNA methyltransferase	NA	A0A0N9ST12	Paenibacillus_phage	100.0	1.5e-234
WP_077584993.1|1420748_1421132_+	hypothetical protein	NA	A0A0N9SHP7	Paenibacillus_phage	100.0	1.4e-72
WP_036654664.1|1421088_1421649_-	AAA family ATPase	NA	A0A0N9SJZ0	Paenibacillus_phage	100.0	1.8e-105
WP_023485387.1|1421632_1422508_-	hypothetical protein	NA	A0A0N9RTN7	Paenibacillus_phage	100.0	2.0e-167
WP_036654666.1|1422511_1422976_-	DUF4065 domain-containing protein	NA	A0A0N9SGM1	Paenibacillus_phage	100.0	1.3e-88
WP_036654668.1|1422969_1423287_-	hypothetical protein	NA	A0A0N9S804	Paenibacillus_phage	100.0	1.3e-57
WP_051427871.1|1423288_1423678_-	hypothetical protein	NA	A0A0N7GFF3	Paenibacillus_phage	100.0	3.1e-72
WP_036654670.1|1423692_1423914_-	hypothetical protein	NA	A0A0N9SIR4	Paenibacillus_phage	100.0	8.4e-35
WP_155116291.1|1423964_1424126_-	hypothetical protein	NA	A0A0N9RRE2	Paenibacillus_phage	100.0	1.0e-26
WP_077585238.1|1424155_1424596_-	hypothetical protein	NA	A0A0N9SJY5	Paenibacillus_phage	99.1	7.8e-56
WP_040931725.1|1424731_1424962_-	crossover junction endodeoxyribonuclease RuvC	NA	A0A0N9ST03	Paenibacillus_phage	100.0	1.6e-36
WP_051427873.1|1425239_1426259_-	hypothetical protein	NA	A0A0N9SHN6	Paenibacillus_phage	94.1	1.1e-156
WP_023483062.1|1426243_1426858_-	3'-5' exonuclease	NA	A0A0N9SJX9	Paenibacillus_phage	95.1	4.1e-103
WP_036654676.1|1426854_1427052_-	hypothetical protein	NA	A0A0N7GFF2	Paenibacillus_phage	100.0	6.6e-31
WP_051427874.1|1427052_1428225_-	DNA polymerase	NA	A0A0N9RTM8	Paenibacillus_phage	91.0	6.8e-208
WP_036654678.1|1428208_1428541_-	hypothetical protein	NA	A0A0N9SGL0	Paenibacillus_phage	86.4	6.7e-52
WP_023483058.1|1430339_1431149_-	hypothetical protein	NA	A0A0N9SIQ5	Paenibacillus_phage	76.9	6.5e-109
WP_036654684.1|1431354_1431768_-	hypothetical protein	NA	A0A0N9RZF9	Paenibacillus_phage	96.4	6.6e-73
WP_036654686.1|1431912_1432128_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	80.6	1.0e-24
WP_023483057.1|1432300_1433038_-	hypothetical protein	NA	A0A0N9SJW5	Paenibacillus_phage	95.5	8.2e-135
WP_036654689.1|1433131_1433656_-	hypothetical protein	NA	A0A0N9RTM1	Paenibacillus_phage	69.5	7.1e-56
WP_051427875.1|1433718_1434282_-	hypothetical protein	NA	A0A0N9SGJ9	Paenibacillus_phage	96.8	2.2e-87
WP_051427876.1|1434334_1435285_-	toprim domain-containing protein	NA	A0A0N9S7Y2	Paenibacillus_phage	88.9	4.9e-164
WP_023483055.1|1435297_1436674_-	AAA family ATPase	NA	A0A0N9SIP5	Paenibacillus_phage	96.9	1.1e-254
WP_023483054.1|1436670_1437441_-	hypothetical protein	NA	A0A0N7GFF0	Paenibacillus_phage	95.3	6.6e-143
WP_036654693.1|1437448_1437715_-	hypothetical protein	NA	A0A0N9RRC8	Paenibacillus_phage	95.5	2.7e-43
WP_036654695.1|1437725_1438253_-	hypothetical protein	NA	A0A0N9SJU7	Paenibacillus_phage	83.4	3.3e-77
WP_023483053.1|1438390_1439233_-	DUF3102 domain-containing protein	NA	A0A0N9RZE9	Paenibacillus_phage	62.0	8.4e-83
WP_051427877.1|1439249_1439642_-	hypothetical protein	NA	A0A0N9SSX1	Paenibacillus_phage	90.8	6.7e-59
WP_167552496.1|1439601_1439904_-	hypothetical protein	NA	A0A0N9SHL8	Paenibacillus_phage	63.0	4.9e-25
WP_036654698.1|1440036_1440408_-	hypothetical protein	NA	A0A0N9SJV6	Paenibacillus_phage	39.8	1.2e-17
WP_036656824.1|1440646_1441033_-	helix-turn-helix domain-containing protein	NA	A0A0N7GFE9	Paenibacillus_phage	63.5	9.0e-32
WP_155116298.1|1441052_1441220_-	hypothetical protein	NA	A0A0N9SIN5	Paenibacillus_phage	90.6	8.3e-19
WP_155116299.1|1441216_1441393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483052.1|1441414_1442041_-	hypothetical protein	NA	A0A0K2CZL5	Paenibacillus_phage	72.6	1.9e-87
WP_036654702.1|1442489_1442780_-	helix-turn-helix domain-containing protein	NA	A0A2I7SC15	Paenibacillus_phage	81.1	5.3e-37
WP_036654705.1|1442826_1443039_-	helix-turn-helix transcriptional regulator	NA	A0A1X9I583	Streptococcus_phage	61.7	1.1e-12
WP_023483051.1|1443207_1443861_+	helix-turn-helix domain-containing protein	NA	A0A2I7SCV6	Paenibacillus_phage	66.0	1.7e-70
>prophage 7
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	1452647	1460104	4289950	transposase,holin	Paenibacillus_phage(80.0%)	11	NA	NA
WP_023483042.1|1452647_1453034_-	LytTR family transcriptional regulator	NA	A0A0K2CYP4	Paenibacillus_phage	50.0	3.6e-25
WP_096761125.1|1453243_1454288_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_036654716.1|1454330_1454852_-	accessory gene regulator B family protein	NA	A0A0K2CZ30	Paenibacillus_phage	40.5	6.2e-20
WP_144029498.1|1454802_1455138_-	hypothetical protein	NA	A0A0K2CYM6	Paenibacillus_phage	44.6	1.2e-13
WP_036654721.1|1455743_1456199_+	hypothetical protein	NA	A0A0C5AER4	Bacteriophage	40.2	1.9e-20
WP_077584997.1|1456419_1456506_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_036654725.1|1456660_1456876_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC05	Paenibacillus_phage	98.6	4.5e-33
WP_024094464.1|1457330_1457522_+	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
WP_036654728.1|1457518_1457788_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	97.7	7.6e-38
WP_036654730.1|1458355_1458835_-	ETX/MTX2 family pore-forming toxin	NA	NA	NA	NA	NA
WP_023483236.1|1458880_1460104_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
>prophage 8
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	1500248	1509328	4289950	transposase	Paenibacillus_phage(50.0%)	11	NA	NA
WP_023484756.1|1500248_1500638_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	49.3	6.5e-06
WP_077585001.1|1501655_1502180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094463.1|1503184_1503406_-	helix-turn-helix transcriptional regulator	NA	A0A0E3U244	Fusobacterium_phage	44.4	3.8e-11
WP_024094464.1|1503902_1504094_+	hypothetical protein	NA	A0A2I7SC20	Paenibacillus_phage	98.4	1.6e-29
WP_036654728.1|1504090_1504360_+	hypothetical protein	NA	A0A2I7SC25	Paenibacillus_phage	97.7	7.6e-38
WP_036654753.1|1504363_1504576_+	hypothetical protein	NA	A0A2I7SC04	Paenibacillus_phage	78.8	8.4e-24
WP_036654757.1|1504912_1505461_-	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	81.4	1.3e-73
WP_036654758.1|1505797_1506298_-	hypothetical protein	NA	R9VWV6	Paenibacillus_phage	31.7	7.1e-05
WP_096761125.1|1506891_1507936_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_024094469.1|1508469_1508880_+	helix-turn-helix transcriptional regulator	NA	F8J1E0	Lactobacillus_phage	38.8	6.6e-09
WP_024094470.1|1508911_1509328_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	37.0	4.6e-18
>prophage 9
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	1649523	1731320	4289950	tRNA,portal,plate,tail,integrase,protease,bacteriocin,capsid,terminase	Paenibacillus_phage(35.0%)	100	1660941:1660956	1734034:1734049
WP_036654813.1|1649523_1650873_-|tRNA	tRNA (N(6)-L-threonylcarbamoyladenosine(37)-C(2))- methylthiotransferase MtaB	tRNA	NA	NA	NA	NA
WP_024094559.1|1650875_1651643_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_023483648.1|1651810_1652488_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_036654815.1|1652496_1653465_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_024094561.1|1654067_1654208_-	YfhD family protein	NA	NA	NA	NA	NA
WP_023483645.1|1654358_1655480_-	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	34.3	3.2e-29
WP_036654816.1|1655635_1657489_-	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	49.2	4.2e-143
WP_023483643.1|1657545_1658145_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_024094564.1|1658267_1659299_-	heat-inducible transcriptional repressor HrcA	NA	NA	NA	NA	NA
WP_096761271.1|1659342_1659789_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042119652.1|1659878_1660295_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_023483639.1|1660437_1661589_-	oxygen-independent coproporphyrinogen III oxidase	NA	NA	NA	NA	NA
1660941:1660956	attL	GCAGAGGAAGCTGATC	NA	NA	NA	NA
WP_023483638.1|1661669_1663484_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	23.7	4.4e-20
WP_023483637.1|1663560_1664004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656515.1|1664040_1665237_-	stage II sporulation protein P	NA	NA	NA	NA	NA
WP_024094568.1|1665438_1666434_-	GPR endopeptidase	NA	NA	NA	NA	NA
WP_036656512.1|1666619_1666892_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_036656508.1|1666990_1668016_-	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_036656506.1|1668347_1668584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656505.1|1668613_1669372_-	zf-HC2 domain-containing protein	NA	NA	NA	NA	NA
WP_024094571.1|1670439_1671114_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.5	1.6e-31
WP_023483629.1|1671125_1673633_-	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_144029639.1|1673746_1674028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_144029638.1|1674040_1674319_-	hypothetical protein	NA	M1PSD2	Streptococcus_phage	54.2	2.7e-14
WP_077585009.1|1675752_1677315_-	peptidase M4 family protein	NA	NA	NA	NA	NA
WP_046655328.1|1678130_1678826_+	hypothetical protein	NA	A0A0C5AN10	Bacteriophage	68.7	2.0e-82
WP_023483534.1|1678828_1679578_+	DUF4065 domain-containing protein	NA	A0A0C5ABL3	Bacteriophage	67.5	5.1e-92
WP_024094406.1|1680387_1680939_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094407.1|1681140_1681623_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.4e-26
WP_051428031.1|1681871_1682939_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.9	2.2e-48
WP_023484263.1|1683193_1685473_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_023484264.1|1685492_1686605_-	AAA family ATPase	NA	A0A1S5V1G7	Saudi_moumouvirus	28.8	1.5e-15
WP_036656497.1|1686917_1687160_-	hypothetical protein	NA	A0A0K2CZD0	Paenibacillus_phage	97.4	4.3e-32
WP_024094412.1|1687172_1687451_-	hypothetical protein	NA	R9VWV2	Paenibacillus_phage	80.6	4.2e-39
WP_024094413.1|1687468_1687933_-	hypothetical protein	NA	A0A0K2CZJ8	Paenibacillus_phage	71.4	6.9e-63
WP_036656495.1|1688616_1688856_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	R9W0N4	Paenibacillus_phage	98.7	1.1e-35
WP_155116215.1|1688890_1689049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094417.1|1689041_1689437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024094418.1|1689449_1690853_-	kelch-like protein	NA	S5MNY5	Brevibacillus_phage	37.5	5.4e-10
WP_024094419.1|1690856_1691135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484987.1|1691131_1691695_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	46.9	1.8e-36
WP_036656489.1|1691705_1692782_-|plate	baseplate J/gp47 family protein	plate	A0A0K2CP27	Brevibacillus_phage	51.8	6.0e-102
WP_023485211.1|1692774_1693185_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	45.5	2.7e-26
WP_023485210.1|1693187_1693430_-	DUF2577 domain-containing protein	NA	A0A0A8WJ65	Clostridium_phage	42.7	1.4e-11
WP_023485209.1|1693429_1694413_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	56.2	9.7e-107
WP_023485208.1|1694417_1695056_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	49.1	6.4e-51
WP_036656487.1|1695052_1697161_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	42.5	2.1e-143
WP_024094427.1|1697214_1697385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485206.1|1697384_1697810_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	44.8	1.6e-26
WP_023485204.1|1698301_1699633_-|tail	phage tail sheath family protein	tail	A0A0A7RTT5	Clostridium_phage	48.4	4.2e-113
WP_036656485.1|1699633_1699816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485203.1|1699808_1700219_-	hypothetical protein	NA	S5MUN8	Brevibacillus_phage	46.8	7.8e-26
WP_023485202.1|1700215_1700626_-	HK97 gp10 family phage protein	NA	A0A0A7RTT0	Clostridium_phage	56.6	1.8e-38
WP_023485201.1|1700625_1700985_-	hypothetical protein	NA	S5M673	Brevibacillus_phage	54.7	6.4e-32
WP_036656482.1|1700986_1701355_-	hypothetical protein	NA	S5MP25	Brevibacillus_phage	55.8	2.1e-30
WP_024094434.1|1701341_1701575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485200.1|1701586_1702633_-|capsid	major capsid protein	capsid	A0A0K2CP76	Brevibacillus_phage	87.2	5.4e-172
WP_036656480.1|1702648_1703005_-	hypothetical protein	NA	A0A0K2CNR0	Brevibacillus_phage	73.3	1.8e-42
WP_036656478.1|1703019_1703643_-	phage scaffolding protein	NA	A0A0K2CP96	Brevibacillus_phage	59.8	1.0e-61
WP_023485197.1|1703680_1704700_-|capsid	minor capsid protein	capsid	S5MTV5	Brevibacillus_phage	57.6	1.3e-109
WP_023485196.1|1704696_1706160_-|portal	phage portal protein	portal	A0A0K2CNK4	Brevibacillus_phage	59.3	8.1e-166
WP_023485195.1|1706175_1707447_-|terminase	PBSX family phage terminase large subunit	terminase	A0A2P1JTW5	Anoxybacillus_phage	65.7	9.5e-163
WP_023485194.1|1707439_1708180_-|terminase	phage-related terminase-like protein small subunit	terminase	A0A2H4J4R0	uncultured_Caudovirales_phage	47.5	1.4e-44
WP_024093566.1|1708677_1708881_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	89.6	2.9e-26
WP_077585010.1|1709002_1709536_-	RNA polymerase subunit sigma-24	NA	A0A0K2CNQ1	Brevibacillus_phage	59.6	2.3e-46
WP_155116272.1|1709522_1709693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485192.1|1710155_1710464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585242.1|1710557_1711223_-	site-specific DNA-methyltransferase	NA	A0A1D8KTH4	Synechococcus_phage	52.0	3.2e-61
WP_023485190.1|1711297_1711819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093562.1|1711833_1712199_-	hypothetical protein	NA	A0A0K2CZ58	Paenibacillus_phage	86.0	1.5e-57
WP_036656474.1|1712389_1712764_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0K2CYQ8	Paenibacillus_phage	66.9	2.6e-44
WP_036656473.1|1712765_1712975_-	hypothetical protein	NA	A0A0K2CYJ0	Paenibacillus_phage	86.8	5.0e-29
WP_024093557.1|1713804_1714692_-	DnaD domain protein	NA	A0A0K2CY85	Paenibacillus_phage	100.0	8.1e-153
WP_024093556.1|1714740_1715073_-	hypothetical protein	NA	A0A0K2CY25	Paenibacillus_phage	98.2	5.3e-57
WP_023485307.1|1715088_1715901_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	R9TMF6	Paenibacillus_phage	68.5	2.0e-110
WP_023485306.1|1715881_1716706_-	hypothetical protein	NA	A0A0A7S0A9	Clostridium_phage	62.8	1.9e-87
WP_023485305.1|1716709_1718338_-	hypothetical protein	NA	R9TQJ2	Paenibacillus_phage	76.6	3.8e-225
WP_024093553.1|1718407_1718986_-|protease	spore protease YyaC	protease	G3M9W0	Bacillus_virus	41.2	1.2e-24
WP_023485303.1|1718982_1719414_-	hypothetical protein	NA	A0A0K2CYQ7	Paenibacillus_phage	53.7	1.9e-06
WP_024093551.1|1719421_1719685_-	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	56.3	2.2e-13
WP_036656470.1|1719721_1719913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656467.1|1720078_1720762_-	ORF6N domain-containing protein	NA	A0A2I7SCV5	Paenibacillus_phage	73.8	1.6e-55
WP_024093548.1|1720758_1720947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485301.1|1720982_1721291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093547.1|1721287_1722043_-	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	76.5	1.5e-107
WP_155116273.1|1722071_1722236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485299.1|1722265_1722499_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	S5MA41	Brevibacillus_phage	49.3	5.8e-18
WP_036656465.1|1722636_1722858_-	hypothetical protein	NA	R9W0P6	Paenibacillus_phage	90.4	1.6e-30
WP_042118685.1|1722854_1723232_-	hypothetical protein	NA	R9VW30	Paenibacillus_phage	89.6	3.8e-59
WP_036656462.1|1723331_1723589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093542.1|1723565_1723826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585011.1|1723841_1724102_-	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	85.9	1.5e-35
WP_077585012.1|1724034_1724859_-	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AFE7	Paenibacillus_phage	94.7	1.1e-130
WP_077585243.1|1724998_1725103_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_158225787.1|1725103_1725208_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023483881.1|1725482_1726208_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	42.2	1.5e-11
WP_023483880.1|1726275_1727508_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	75.1	4.8e-180
WP_051428029.1|1727519_1729433_-	DNA internalization-related competence protein ComEC/Rec2	NA	NA	NA	NA	NA
WP_077585013.1|1729507_1730002_-	dCMP deaminase family protein	NA	A0A222YXY3	Mycobacterium_phage	44.9	3.3e-23
WP_036656460.1|1730027_1731320_-	homocysteine synthase	NA	A0A0B5JD48	Pandoravirus	27.8	8.5e-18
1734034:1734049	attR	GCAGAGGAAGCTGATC	NA	NA	NA	NA
>prophage 10
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	1927586	2058461	4289950	head,portal,tail,integrase,protease,holin,transposase,bacteriocin,capsid,terminase	Paenibacillus_phage(65.98%)	155	1950774:1950833	2057324:2058492
WP_046655163.1|1927586_1929305_-|protease	ATP-dependent protease LonB	protease	A0A0R6PGP8	Moraxella_phage	25.1	3.6e-16
WP_052304436.1|1929520_1930228_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_023484289.1|1930278_1931400_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_023484290.1|1931504_1932764_-|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	65.0	4.5e-149
WP_036656352.1|1932779_1933370_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.1	1.2e-56
WP_023484292.1|1933534_1934836_-	trigger factor	NA	NA	NA	NA	NA
WP_046655164.1|1935014_1935917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484294.1|1936047_1937268_-	CapA family protein	NA	A0A2H4J5Z6	uncultured_Caudovirales_phage	33.9	4.8e-55
WP_024094793.1|1937494_1937608_-	DUF4023 family protein	NA	NA	NA	NA	NA
WP_024094794.1|1937662_1939177_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_036656348.1|1939169_1939646_-	PH domain-containing protein	NA	NA	NA	NA	NA
WP_024094796.1|1939811_1940165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484298.1|1940453_1942298_+	asparagine synthase (glutamine-hydrolyzing)	NA	L7RC73	Acanthamoeba_polyphaga_moumouvirus	24.7	9.9e-28
WP_023484299.1|1942365_1942998_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_023484300.1|1942984_1943740_-	ribonuclease PH	NA	NA	NA	NA	NA
WP_023484301.1|1944075_1945107_-	GerMN domain-containing protein	NA	NA	NA	NA	NA
WP_036656345.1|1945343_1945859_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	53.6	8.5e-38
WP_023484303.1|1945970_1946780_+	MFS transporter	NA	NA	NA	NA	NA
WP_036656341.1|1947010_1947193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656340.1|1947941_1948415_+	hypothetical protein	NA	A0A0C5AER4	Bacteriophage	69.1	9.6e-36
WP_077585032.1|1948516_1948654_-	helix-turn-helix transcriptional regulator	NA	A0A2I7SC34	Paenibacillus_phage	90.9	7.0e-16
WP_023484983.1|1948786_1949059_-	barstar family protein	NA	NA	NA	NA	NA
WP_077585246.1|1949072_1949819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585033.1|1950138_1950750_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
1950774:1950833	attL	TATATAAGTTGAATCAATATTCTTAGCAAACCTTGGCAAGGAAAAAGGAACCATTTGTCG	NA	NA	NA	NA
WP_104932612.1|1950866_1951911_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_158225777.1|1951934_1952111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167552501.1|1953701_1953860_-	hypothetical protein	NA	A0A2H4J054	uncultured_Caudovirales_phage	58.7	7.4e-09
WP_152659182.1|1953859_1954843_-	hypothetical protein	NA	A0A0C5AEQ0	Bacteriophage	75.9	7.1e-49
WP_155116279.1|1955178_1955346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485248.1|1955568_1955883_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_023485249.1|1955882_1956224_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_023485250.1|1956291_1956873_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483154.1|1957252_1957732_+	hypothetical protein	NA	A0A0K2CZD8	Paenibacillus_phage	99.4	7.6e-81
WP_077584997.1|1958055_1958142_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_077585034.1|1958300_1958453_-	Arc family DNA-binding protein	NA	A0A0K2CZC4	Paenibacillus_phage	100.0	5.8e-19
WP_036656321.1|1958866_1959085_+	hypothetical protein	NA	A0A0K2CZK3	Paenibacillus_phage	100.0	6.8e-37
WP_158225779.1|1959062_1959236_+	hypothetical protein	NA	A0A0K2CZV9	Paenibacillus_phage	100.0	5.6e-26
WP_036656319.1|1959314_1959587_+	hypothetical protein	NA	A0A0K2CZR1	Paenibacillus_phage	100.0	3.3e-41
WP_036656316.1|1959600_1959873_+	hypothetical protein	NA	A0A0K2CZB9	Paenibacillus_phage	100.0	4.3e-49
WP_036656314.1|1959955_1960135_-	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	98.3	7.1e-24
WP_036656312.1|1960278_1960518_-	hypothetical protein	NA	A0A0K2CZD0	Paenibacillus_phage	100.0	1.0e-33
WP_077585248.1|1960738_1961407_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0K2CZQ6	Paenibacillus_phage	100.0	2.4e-133
WP_036656310.1|1961406_1961637_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A0K2CZB4	Paenibacillus_phage	100.0	2.0e-34
WP_167552488.1|1961617_1961779_-	hypothetical protein	NA	A0A0K2CZ44	Paenibacillus_phage	100.0	8.8e-26
WP_036656307.1|1961775_1962117_-	hypothetical protein	NA	A0A0K2CZC5	Paenibacillus_phage	100.0	9.9e-59
WP_051428011.1|1962126_1963200_-	hypothetical protein	NA	A0A0K2CZJ3	Paenibacillus_phage	99.7	7.1e-212
WP_023484575.1|1963205_1964324_-	siphovirus ReqiPepy6 Gp37-like family protein	NA	A0A0K2CZQ1	Paenibacillus_phage	100.0	2.0e-212
WP_023484576.1|1964326_1965193_-|tail	phage tail family protein	tail	A0A0K2CZA8	Paenibacillus_phage	100.0	4.0e-165
WP_077584889.1|1965193_1968520_-|tail	phage tail tape measure protein	tail	A0A0K2CYK9	Paenibacillus_phage	100.0	4.3e-308
WP_077584888.1|1968465_1968897_-	hypothetical protein	NA	A0A2I7SBZ5	Paenibacillus_phage	94.6	5.3e-49
WP_023484578.1|1969130_1969502_-	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	100.0	2.9e-64
WP_046655268.1|1969573_1970170_-	hypothetical protein	NA	A0A0K2CZP8	Paenibacillus_phage	100.0	3.9e-111
WP_036656304.1|1970205_1970535_-	hypothetical protein	NA	A0A0K2CZA4	Paenibacillus_phage	100.0	4.4e-56
WP_036656302.1|1970531_1970924_-	HK97 gp10 family phage protein	NA	A0A0K2CZ33	Paenibacillus_phage	100.0	4.3e-66
WP_023484581.1|1970920_1971241_-|head	phage head closure protein	head	A0A0K2CZB5	Paenibacillus_phage	100.0	3.0e-57
WP_036656301.1|1971237_1971501_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0K2CZI4	Paenibacillus_phage	100.0	4.2e-41
WP_023484582.1|1971626_1972769_-|capsid	phage major capsid protein	capsid	A0A0K2CZ99	Paenibacillus_phage	99.5	6.6e-208
WP_046655269.1|1972765_1973482_-|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	100.0	1.1e-131
WP_036656297.1|1973471_1974707_-|portal	phage portal protein	portal	A0A0K2CZB0	Paenibacillus_phage	99.8	3.5e-239
WP_077584887.1|1974721_1976446_-|terminase	terminase large subunit	terminase	A0A0K2CZH9	Paenibacillus_phage	100.0	0.0e+00
WP_023484127.1|1976426_1976741_-|terminase	P27 family phage terminase small subunit	terminase	A0A0K2CZ94	Paenibacillus_phage	100.0	1.6e-50
WP_036656294.1|1976844_1977189_-	HNH endonuclease	NA	A0A0K2CZA0	Paenibacillus_phage	100.0	4.3e-62
WP_023484460.1|1977200_1977551_-	hypothetical protein	NA	A0A0K2CZA6	Paenibacillus_phage	100.0	9.5e-65
WP_036656290.1|1977784_1978057_-	hypothetical protein	NA	A0A0K2CZP5	Paenibacillus_phage	100.0	5.9e-46
WP_036657636.1|1978105_1978459_-	toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	100.0	4.4e-62
WP_036656288.1|1978505_1978730_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0K2CZG8	Paenibacillus_phage	100.0	1.0e-35
WP_036656285.1|1978793_1979000_-	hypothetical protein	NA	A0A0K2CZA1	Paenibacillus_phage	100.0	2.0e-30
WP_036656282.1|1979174_1979798_-	RNA polymerase subunit sigma-24	NA	NA	NA	NA	NA
WP_046655221.1|1979763_1979973_-	DUF3310 domain-containing protein	NA	A0A291LBF7	Klebsiella_phage	56.9	4.2e-12
WP_023484462.1|1980007_1981399_-	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	63.5	3.3e-169
WP_036656280.1|1981395_1981674_-	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	51.1	6.2e-19
WP_023484463.1|1981959_1984287_-	hypothetical protein	NA	S5M5Y2	Brevibacillus_phage	61.8	1.1e-294
WP_036656278.1|1984306_1984897_-	hypothetical protein	NA	B6V303	Bacillus_phage	26.8	2.8e-08
WP_036656275.1|1984918_1985434_-	hypothetical protein	NA	A0A2H4J8I5	uncultured_Caudovirales_phage	41.4	1.2e-20
WP_036656273.1|1985448_1985649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158225724.1|1985699_1985858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656271.1|1985854_1986067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428009.1|1986056_1986443_-	hypothetical protein	NA	A0A0C5AET7	Bacteriophage	80.3	2.1e-57
WP_036656266.1|1986664_1986997_-	hypothetical protein	NA	A0A0C5JZC6	Enterococcus_phage	42.7	2.0e-11
WP_036656265.1|1987043_1987226_-	hypothetical protein	NA	A0A0K2CYS1	Paenibacillus_phage	81.7	5.7e-21
WP_036656262.1|1987243_1989208_-	XRE family transcriptional regulator	NA	S5M5X4	Brevibacillus_phage	59.1	3.9e-224
WP_023484466.1|1989275_1989875_-	DUF2815 family protein	NA	A0A2I7QIM8	Bacillus_phage	58.3	3.3e-57
WP_023484467.1|1989880_1991068_-	DUF2800 domain-containing protein	NA	S5MUB5	Brevibacillus_phage	49.5	5.1e-102
WP_023484468.1|1991064_1991451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656261.1|1991456_1991648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484469.1|1991790_1992045_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A0K2CZ86	Paenibacillus_phage	93.8	2.5e-38
WP_036656259.1|1992041_1992392_-	hypothetical protein	NA	A0A0K2CZG5	Paenibacillus_phage	100.0	1.6e-48
WP_036657628.1|1992410_1992632_-	hypothetical protein	NA	A0A0K2CZM7	Paenibacillus_phage	100.0	3.8e-35
WP_023484470.1|1992640_1993339_-	DNA cytosine methyltransferase	NA	A0A0K2CZT5	Paenibacillus_phage	100.0	8.1e-124
WP_036656257.1|1993345_1993561_-	hypothetical protein	NA	A0A0K2CZE9	Paenibacillus_phage	98.6	2.7e-30
WP_155116251.1|1993843_1994002_-	hypothetical protein	NA	A0A0K2CZG0	Paenibacillus_phage	100.0	5.1e-18
WP_036656256.1|1994016_1994256_-	hypothetical protein	NA	A0A0K2CZM3	Paenibacillus_phage	100.0	8.2e-36
WP_036656254.1|1994261_1994651_-	hypothetical protein	NA	A0A0K2CZT2	Paenibacillus_phage	100.0	3.0e-67
WP_036656252.1|1994666_1994855_-	hypothetical protein	NA	A0A0K2CZE4	Paenibacillus_phage	100.0	5.3e-30
WP_040931267.1|1994847_1995081_-	hypothetical protein	NA	A0A0K2CZ76	Paenibacillus_phage	100.0	2.8e-36
WP_036656248.1|1995115_1995334_-	hypothetical protein	NA	A0A0K2CZF4	Paenibacillus_phage	100.0	7.0e-34
WP_051428008.1|1995356_1995629_-	hypothetical protein	NA	A0A0K2CZL9	Paenibacillus_phage	100.0	2.2e-45
WP_155116250.1|1995612_1995756_-	hypothetical protein	NA	A0A0K2CZS8	Paenibacillus_phage	97.9	1.5e-21
WP_036656245.1|1995763_1996021_-	hypothetical protein	NA	A0A0K2CZE0	Paenibacillus_phage	100.0	8.3e-42
WP_036656244.1|1996145_1996361_-	hypothetical protein	NA	A0A0K2CZE8	Paenibacillus_phage	100.0	1.6e-30
WP_051428007.1|1996383_1997022_-	hypothetical protein	NA	A0A0K2CZL5	Paenibacillus_phage	100.0	1.3e-128
WP_036656242.1|1997037_1997331_-	helix-turn-helix domain-containing protein	NA	A0A0K2CZS5	Paenibacillus_phage	100.0	4.4e-47
WP_023483804.1|1997327_1998092_-	Rha family transcriptional regulator	NA	A0A0K2CZD5	Paenibacillus_phage	100.0	7.5e-131
WP_023484952.1|1998088_1998478_-	hypothetical protein	NA	A0A0K2CZ66	Paenibacillus_phage	100.0	1.2e-68
WP_023484953.1|1998497_1999322_-	hypothetical protein	NA	A0A0K2CZE3	Paenibacillus_phage	100.0	4.6e-150
WP_036656239.1|1999547_1999784_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CZL1	Paenibacillus_phage	100.0	7.4e-37
WP_051428006.1|1999894_2000578_+	helix-turn-helix transcriptional regulator	NA	A0A0K2CZS1	Paenibacillus_phage	99.6	7.9e-124
WP_046655220.1|2000583_2001063_+	hypothetical protein	NA	A0A0K2CZC9	Paenibacillus_phage	100.0	4.4e-89
WP_023484955.1|2001117_2002359_+|integrase	site-specific integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	99.8	6.5e-241
WP_023484956.1|2002610_2003594_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_023484957.1|2003603_2004338_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_036657613.1|2004842_2005787_+	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_023483236.1|2006036_2007260_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_051428005.1|2007997_2008456_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077585035.1|2008957_2009176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052304415.1|2009521_2009716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585036.1|2009786_2011382_+	hypothetical protein	NA	A0A126FC74	Lonomia_obliqua_multiple_nucleopolyhedrovirus	26.4	2.5e-35
WP_077585037.1|2011451_2013221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656234.1|2013575_2014481_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	55.5	3.5e-87
WP_023483458.1|2014890_2015097_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.6	4.6e-19
WP_036656232.1|2015197_2015476_+	HU family DNA-binding protein	NA	M4SRV7	Rhodobacter_phage	38.3	7.2e-07
WP_023482516.1|2016139_2016778_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_024094813.1|2018621_2018846_-	response regulator transcription factor	NA	A0A290GJH9	Caldibacillus_phage	70.5	3.7e-14
WP_023482898.1|2018986_2020297_-	purine/pyrimidine permease	NA	NA	NA	NA	NA
WP_024094816.1|2021348_2022050_-	dihydroorotate dehydrogenase electron transfer subunit	NA	NA	NA	NA	NA
WP_024094817.1|2022465_2023332_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_023482894.1|2023415_2024252_-	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_167552502.1|2024238_2024964_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_036656899.1|2025258_2026035_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_077585039.1|2026106_2027123_+	GDP-mannose 4,6-dehydratase	NA	M4QPK0	Synechococcus_phage	35.2	1.0e-34
WP_023482890.1|2027204_2027924_-	glycosyltransferase	NA	K7Z8A5	Megavirus	23.6	1.2e-10
WP_023482889.1|2027931_2028837_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A291LAD7	Escherichia_phage	25.7	1.2e-15
WP_024094822.1|2028833_2029664_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_023482887.1|2029660_2030647_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.7	4.2e-41
WP_023482886.1|2030636_2031731_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A2P1ELS7	Moumouvirus	44.4	1.9e-87
WP_051427894.1|2031727_2033188_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_023482884.1|2033461_2033833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654842.1|2033832_2034969_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023482882.1|2034943_2036134_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_023482881.1|2036130_2036853_-	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	40.9	3.2e-46
WP_152532822.1|2037107_2041637_-|tail	WIAG-tail domain	tail	NA	NA	NA	NA
WP_036654844.1|2041528_2044936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654846.1|2045063_2045402_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_023482877.1|2045544_2046711_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_023482876.1|2047050_2047833_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_042119178.1|2048386_2048989_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104932543.1|2049306_2050176_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	2.2e-134
WP_077585040.1|2050196_2050880_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	96.9	4.5e-119
WP_023483333.1|2050985_2051465_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_023483332.1|2051530_2052325_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023483331.1|2052328_2053768_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_023483330.1|2054086_2055379_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_023483329.1|2055480_2056401_-	glycosyl hydrolase lipoprotein-like protein	NA	NA	NA	NA	NA
WP_036654854.1|2056673_2057273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932612.1|2057416_2058461_+|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
2057324:2058492	attR	TATATAAGTTGAATCAATATTCTTAGCAAACCTTGGCAAGGAAAAAGGAACCATTTGTCGAATAAGAAACAGATCAAGAATAGACAAGTGGGGATGACAATGGATAAACATACCGAACTGGCAAAAGTAACGGCAGCCATGCAACAAACCAAAGAGCGCCGAATGTATGAACGCTACCAAGCGATCTATTTGCATTTGAAAGGCACATCCATGAAGGCGATCGCTGACATTTTGAATCGAAACCGAATGACGGTGAGCAGTTACATTCATACGTACGAGAACGGTGGACTGGGAGCCTTGCAAATCAAGCATTCCTCAGGTGCTCCTACTCGGTTGACGAAGCAGCAGCAGGATCGCTTGAAACAAACCGTCGCCTATTCGGTTCCCCATGAGGTCGGCTTTACGGCAAAGCACAACTGGACGCTTGAACTGATTGCCACGTACGTGGAACGCGAATGGGGCCATTGCTATTCGCTCCGAGGCATTTCCAAGGTCATGGAGCGGCTAGGGCTCAGCTATACGAAACCGACCTACACGCTCGCAGCAGCAGATCCCAAGAAACAACGCCATTTCACCGAAACGACCTTTCCTGAACTGAAAAAAAGCTACTGAACGAGGAGATTGATCACTTGCTGTTCGAGGATGAGTCGATGATCCGGGACTACCAGGCGATTCAGAAGACCTGGTTCCTTCGCGGGAAGCAACGCATCATTCCAACCACGGGCAAGCATCGTGGGGTCAAACTGCTGGCCACGGTTGACTATGAAACGGGACACATCGTTTGGCAAGAAGATGAACAGTACACCGCTGAAACGTTTCTTTCCTTTCTTCAAAAGGTCATGGCGACTTATCCAACAGGGAAACTGGCTCTGGTTTTGGACAATGCCCGGATTCATCATGCAAAGCTGCTTCGGCCGTTTCTGGAAGCGCAAAAAAATCGGCTTGAGCTTGTGTACTTGCCTCCATACAGCCCTCAGTTAAATATCGTAGAAGGACTCTGGAAATGGCTCAAGTCCAGTGTGATCAATAACGTATTCTATTCGGCCGTTTCCGAAATCCGTCTGCGTGTCGGGCAATTTATGGATGAAATCATGAAGCATCCTCATGCCATTATTGACCGGCTGTGCGTGCGACTTTGATTGCTATTTTCTTTCGTTCAACTTATATAG	NA	NA	NA	NA
>prophage 11
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	2125661	2252582	4289950	tRNA,integrase,transposase,holin,coat	Paenibacillus_phage(39.13%)	105	2147279:2147296	2235489:2235505
WP_023483267.1|2125661_2126033_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_036654876.1|2126155_2127049_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_051427899.1|2127424_2127982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654878.1|2128092_2129241_-	transglutaminase domain-containing protein	NA	NA	NA	NA	NA
WP_036654880.1|2129268_2129508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155116295.1|2129530_2129683_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483263.1|2129801_2130944_+	MFS transporter	NA	NA	NA	NA	NA
WP_023483262.1|2131147_2131498_+	ribonuclease-like protein	NA	NA	NA	NA	NA
WP_023483261.1|2131499_2132141_-	SCO family protein	NA	NA	NA	NA	NA
WP_096761322.1|2132231_2133158_-	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_023483259.1|2133402_2134596_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	24.3	2.4e-11
WP_023483258.1|2134605_2135415_-	cache domain-containing protein	NA	NA	NA	NA	NA
WP_158529834.1|2136175_2136502_+|coat	spore coat protein GerQ	coat	NA	NA	NA	NA
WP_155116366.1|2136609_2136765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036654885.1|2136906_2137890_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_023483255.1|2138026_2138251_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	47.8	5.6e-10
WP_036654887.1|2138628_2139615_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_051427900.1|2139993_2141412_-	cobyrinate a,c-diamide synthase	NA	NA	NA	NA	NA
WP_036654889.1|2141624_2142263_-	ribonuclease H family protein	NA	NA	NA	NA	NA
WP_036654891.1|2142857_2143172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|2143622_2144846_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036654894.1|2145250_2146813_-	peptidase M4 family protein	NA	NA	NA	NA	NA
2147279:2147296	attL	TTGGGGAGCTATTTCTTT	NA	NA	NA	NA
WP_046655328.1|2147628_2148324_+	hypothetical protein	NA	A0A0C5AN10	Bacteriophage	68.7	2.0e-82
2147279:2147296	attL	TTGGGGAGCTATTTCTTT	NA	NA	NA	NA
WP_023483534.1|2148326_2149076_+	DUF4065 domain-containing protein	NA	A0A0C5ABL3	Bacteriophage	67.5	5.1e-92
WP_024094406.1|2149885_2150437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024094407.1|2150638_2151121_-	SocA family protein	NA	A0A0N9SGM1	Paenibacillus_phage	41.3	1.4e-26
WP_051428031.1|2151369_2152437_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	33.9	2.2e-48
WP_096761208.1|2152691_2154110_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_144029596.1|2155710_2156019_-	hypothetical protein	NA	A0A0C5AFE4	Paenibacillus_phage	69.4	2.9e-25
WP_023484631.1|2157574_2157925_+	hypothetical protein	NA	A0A2I7SC07	Paenibacillus_phage	61.2	2.9e-13
WP_023483236.1|2157917_2159141_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_158673679.1|2159222_2159936_+	ETX/MTX2 family pore-forming toxin	NA	A0A2I7SC07	Paenibacillus_phage	61.5	6.9e-62
WP_104932540.1|2160592_2161311_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	96.4	3.2e-59
WP_023484146.1|2161434_2162391_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_023484145.1|2162565_2166006_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	46.7	5.1e-09
WP_023484144.1|2166282_2166825_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_023484143.1|2166930_2167725_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_036654904.1|2167751_2167937_-	DUF896 domain-containing protein	NA	NA	NA	NA	NA
WP_036656935.1|2168118_2168364_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_023484142.1|2168641_2169259_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	6.5e-16
WP_024094581.1|2169404_2169671_-	hypothetical protein	NA	A0A2I7SCW2	Paenibacillus_phage	72.7	1.9e-28
WP_042119086.1|2170167_2170398_-	helix-turn-helix transcriptional regulator	NA	A0A0K2CYV5	Paenibacillus_phage	47.9	7.5e-10
WP_051427904.1|2170498_2171590_-	LCP family protein	NA	NA	NA	NA	NA
WP_046655237.1|2174264_2174615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585046.1|2174694_2175114_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2SXP1	Bacillus_phage	59.8	5.3e-38
WP_024093300.1|2175182_2175509_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_077585047.1|2175553_2175874_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_158673678.1|2175926_2176370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_036654912.1|2176590_2179947_-	RICIN domain-containing protein	NA	A0A1V0E026	Clostridioides_phage	37.6	1.4e-88
2176468:2176485	attR	TTGGGGAGCTATTTCTTT	NA	NA	NA	NA
WP_023483571.1|2180768_2181143_-	hypothetical protein	NA	NA	NA	NA	NA
2176468:2176485	attR	TTGGGGAGCTATTTCTTT	NA	NA	NA	NA
WP_096761169.1|2183970_2185305_-	type I glutamate--ammonia ligase	NA	NA	NA	NA	NA
WP_023482825.1|2185338_2185746_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174567586.1|2187208_2188498_-	GTPase HflX	NA	NA	NA	NA	NA
WP_023482829.1|2189638_2190640_-	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_023482830.1|2190681_2191383_-	YdcF family protein	NA	NA	NA	NA	NA
WP_024094596.1|2191572_2191959_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_023482831.1|2192009_2192657_-	peptidylprolyl isomerase	NA	A0A1V0SCU1	Indivirus	48.8	1.2e-20
WP_023482832.1|2192867_2195300_-	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_023482833.1|2195446_2195686_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_023482834.1|2195763_2196726_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_036656949.1|2196713_2197493_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_023482836.1|2197613_2199662_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.2	6.0e-66
WP_023482837.1|2199692_2202374_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	22.2	5.8e-29
WP_023482838.1|2202497_2203853_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482839.1|2203954_2204524_-|coat	outer spore coat protein CotE	coat	NA	NA	NA	NA
WP_023482840.1|2204621_2205584_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_023482843.1|2207265_2207766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046655122.1|2208207_2209167_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023482845.1|2209756_2211277_-	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_036655044.1|2211383_2211719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023482847.1|2211741_2212332_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_036655047.1|2212328_2212883_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_023482849.1|2213010_2213442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655049.1|2213441_2213720_+	DUF2653 family protein	NA	NA	NA	NA	NA
WP_051427922.1|2213885_2215667_-	immune inhibitor A	NA	NA	NA	NA	NA
WP_023482851.1|2215784_2216108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482853.1|2216875_2220001_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_036656992.1|2220136_2221723_-	malate synthase A	NA	NA	NA	NA	NA
WP_023482855.1|2221764_2223057_-	isocitrate lyase	NA	NA	NA	NA	NA
WP_155121091.1|2223116_2223278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655050.1|2223563_2224886_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_152532829.1|2225094_2226297_-	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_023482858.1|2226624_2226984_+	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_023482859.1|2226980_2227673_+	LrgB family protein	NA	NA	NA	NA	NA
WP_036656994.1|2227735_2228488_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_023482861.1|2229059_2230100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655052.1|2230254_2232336_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_155116265.1|2232940_2233090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052304433.1|2233455_2233698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144029584.1|2234549_2234663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158673677.1|2234764_2235118_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_152532830.1|2235092_2235428_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036655055.1|2235466_2235754_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077585052.1|2235833_2236568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655058.1|2237640_2237853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158529825.1|2238129_2240706_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_024093853.1|2240939_2241089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585054.1|2241437_2242748_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_042119509.1|2243886_2244156_+	DUF2642 domain-containing protein	NA	NA	NA	NA	NA
WP_023484151.1|2244241_2246122_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_023484150.1|2246605_2247823_+	cytochrome P450	NA	NA	NA	NA	NA
WP_152532853.1|2247985_2248846_+	prolyl oligopeptidase family serine peptidase	NA	NA	NA	NA	NA
WP_023484148.1|2249284_2249743_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077585055.1|2249910_2251389_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	38.2	7.4e-26
WP_096761125.1|2251536_2252582_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
>prophage 12
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	2258488	2291079	4289950	integrase,transposase,protease	Paenibacillus_phage(42.86%)	34	2286564:2286578	2301506:2301520
WP_096761175.1|2258488_2258824_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023482947.1|2258921_2259584_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.1	1.4e-13
WP_036655066.1|2259898_2261368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655069.1|2262887_2263211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482950.1|2263316_2263751_-	DUF2383 domain-containing protein	NA	NA	NA	NA	NA
WP_077585056.1|2263983_2265015_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_023482952.1|2265356_2266220_+	copper amine oxidase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_023482953.1|2266348_2266774_+|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_023482955.1|2267508_2268006_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_036655076.1|2268061_2268748_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_036655078.1|2268786_2269740_-	carbamate kinase	NA	NA	NA	NA	NA
WP_023482958.1|2269756_2271172_-	arginine-ornithine antiporter	NA	NA	NA	NA	NA
WP_023482959.1|2271268_2272267_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_023483236.1|2273218_2274442_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_167552503.1|2274448_2275846_-	radical SAM protein	NA	NA	NA	NA	NA
WP_024095010.1|2275965_2276163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932509.1|2276187_2276328_-	cyclic lactone autoinducer peptide	NA	NA	NA	NA	NA
WP_023485252.1|2276398_2276959_-	accessory gene regulator B family protein	NA	NA	NA	NA	NA
WP_036655081.1|2277171_2277909_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_023485254.1|2277915_2279211_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_024095013.1|2280244_2280466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_040931968.1|2280534_2280735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485255.1|2281716_2283195_+	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	25.4	5.0e-30
WP_036654192.1|2283350_2284406_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1P8DJG9	Virus_Rctr71	29.6	2.5e-15
WP_024095017.1|2284410_2284806_-|transposase	IS200/IS605 family transposase	transposase	Q332K6	Clostridium_botulinum_C_phage	62.8	7.0e-40
WP_024095018.1|2285825_2286011_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K2CZ62	Paenibacillus_phage	54.3	2.4e-06
WP_023485292.1|2286313_2286982_-	adenosylcobinamide amidohydrolase	NA	NA	NA	NA	NA
2286564:2286578	attL	CCGGGAAAAAGGACC	NA	NA	NA	NA
WP_024095020.1|2287053_2287287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095021.1|2287708_2287987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655089.1|2288113_2288440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093681.1|2288785_2289430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_051427925.1|2289521_2290103_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158673676.1|2290363_2290609_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077585061.1|2290632_2291079_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0C5AEA5	Paenibacillus_phage	53.1	9.0e-36
2301506:2301520	attR	GGTCCTTTTTCCCGG	NA	NA	NA	NA
>prophage 13
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	2415089	2438991	4289950	plate,tail,transposase,holin,coat	Brevibacillus_phage(40.0%)	31	NA	NA
WP_023484507.1|2415089_2415293_-|coat	spore coat-like protein	coat	NA	NA	NA	NA
WP_023484506.1|2415477_2415822_+	DUF2512 family protein	NA	NA	NA	NA	NA
WP_036655172.1|2415872_2416220_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_167552505.1|2416881_2418174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484503.1|2418391_2419165_-	N-acetylmuramoyl-L-alanine amidase	NA	D6QWN1	uncultured_phage	62.3	4.0e-55
WP_023484502.1|2419161_2419572_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	50.4	2.3e-30
WP_167552506.1|2419610_2419772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484501.1|2419764_2420157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051427929.1|2420169_2422269_-	kelch repeat-containing protein	NA	NA	NA	NA	NA
WP_036655179.1|2422272_2422551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482439.1|2422547_2423117_-	DUF2313 domain-containing protein	NA	S5MA71	Brevibacillus_phage	42.3	7.7e-32
WP_036655181.1|2423121_2424198_-|plate	baseplate J/gp47 family protein	plate	S5MUH6	Brevibacillus_phage	50.3	9.0e-98
WP_023482437.1|2424175_2424598_-	DUF2634 domain-containing protein	NA	A0A0A7RTU4	Clostridium_phage	47.8	3.3e-27
WP_023482436.1|2424600_2424888_-	DUF2577 domain-containing protein	NA	S5M5M4	Brevibacillus_phage	36.8	7.4e-15
WP_023482435.1|2424887_2425856_-	hypothetical protein	NA	S5MNC9	Brevibacillus_phage	59.5	3.4e-112
WP_023482434.1|2425860_2426502_-	LysM peptidoglycan-binding domain-containing protein	NA	S5MUH0	Brevibacillus_phage	46.3	2.7e-49
WP_036655183.1|2426501_2428547_-	hypothetical protein	NA	A0A0K2CP22	Brevibacillus_phage	40.5	2.5e-128
WP_023482432.1|2428918_2429341_-	hypothetical protein	NA	X5JAB6	Clostridium_phage	41.8	5.8e-24
WP_036655185.1|2429360_2429822_-|tail	phage tail tube protein	tail	A0A0A7RVP1	Clostridium_phage	60.3	2.8e-48
WP_023482430.1|2429823_2431158_-|tail	phage tail sheath family protein	tail	A0A0A7S087	Clostridium_phage	46.4	7.5e-110
WP_036655187.1|2431158_2431341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482429.1|2431315_2431744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655191.1|2432214_2432886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482427.1|2432988_2433438_-	hypothetical protein	NA	A0A0C5AC66	Paenibacillus_phage	77.3	1.9e-57
WP_023482426.1|2433681_2434137_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077585254.1|2434237_2434600_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2P1JU12	Anoxybacillus_phage	40.7	7.9e-14
WP_036655196.1|2434917_2435394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482425.1|2435446_2436928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023482424.1|2436942_2437998_-	nucleoid-associated protein	NA	A0A0A8WF33	Clostridium_phage	25.0	6.3e-11
WP_036655198.1|2438107_2438365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024095080.1|2438829_2438991_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	2556045	2608809	4289950	transposase,holin	Staphylococcus_phage(26.67%)	39	NA	NA
WP_023484075.1|2556045_2556444_-|holin	phage holin family protein	holin	A0A0N7GFE6	Paenibacillus_phage	43.5	1.1e-21
WP_051427935.1|2556760_2557636_-	C40 family peptidase	NA	D2KRB9	Lactobacillus_phage	33.0	2.6e-10
WP_077585255.1|2558201_2559083_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_077585256.1|2559386_2559992_-	3D domain-containing protein	NA	A0A024B055	Bacillus_phage	43.6	2.5e-12
WP_158225756.1|2560864_2561047_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036657096.1|2561257_2561980_+	NTP transferase domain-containing protein	NA	H9NC64	Sphingomonas_phage	41.0	7.8e-45
WP_077585083.1|2562936_2563395_+	sugar nucleotide-binding protein	NA	NA	NA	NA	NA
WP_023484069.1|2563770_2564211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104932612.1|2564423_2565469_-|transposase	IS630 family transposase	transposase	A0A1V0SDF8	Indivirus	20.9	7.9e-06
WP_023484177.1|2565536_2568335_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655262.1|2568331_2568820_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_024093465.1|2568826_2569114_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_077585085.1|2569236_2569983_-	3-oxoacyl-ACP reductase FabG	NA	W8CYX9	Bacillus_phage	46.1	4.9e-10
WP_023484174.1|2569975_2570926_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_036655264.1|2570922_2571342_-	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_023484171.1|2572678_2573626_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	32.4	1.5e-24
WP_024093460.1|2575505_2577389_-	molecular chaperone HtpG	NA	A0A1V0SAD6	Catovirus	34.4	3.6e-94
WP_036655268.1|2578116_2578914_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_077585087.1|2578918_2579797_-	ABC-2 family transporter protein	NA	NA	NA	NA	NA
WP_036655270.1|2579702_2580728_-	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	24.0	4.4e-17
WP_036655272.1|2582450_2585669_-	chromosome segregation protein SMC	NA	NA	NA	NA	NA
WP_172423925.1|2585675_2586302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428051.1|2586429_2587890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585088.1|2587874_2589179_-	DUF2399 domain-containing protein	NA	NA	NA	NA	NA
WP_036655276.1|2589832_2593183_-	DEAD/DEAH box helicase family protein	NA	Q5YA94	Bacillus_phage	23.2	2.0e-18
WP_023484490.1|2593193_2594339_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_023484491.1|2594343_2595801_-	SAM-dependent DNA methyltransferase	NA	A0A1W6JNK1	Staphylococcus_phage	26.9	3.2e-21
WP_077584997.1|2596351_2596438_-|holin	putative holin-like toxin	holin	A0A0K2CZR6	Paenibacillus_phage	100.0	2.0e-05
WP_023484492.1|2596611_2597121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585090.1|2597828_2600990_-	type 2 lantipeptide synthetase LanM	NA	NA	NA	NA	NA
WP_036655279.1|2601091_2601313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484495.1|2601413_2602568_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023484496.1|2602573_2603272_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	3.1e-14
WP_023484497.1|2603287_2604298_-	S8 family serine peptidase	NA	A0A2H4PQH1	Staphylococcus_phage	28.6	9.9e-22
WP_051428052.1|2604294_2604543_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_144029518.1|2604863_2605148_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585257.1|2605808_2607746_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	54.8	6.8e-11
WP_158673674.1|2608154_2608598_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_077585092.1|2608650_2608809_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	2757385	2900072	4289950	tRNA,integrase,transposase,protease,bacteriocin	Paenibacillus_phage(15.38%)	116	2819905:2819920	2824460:2824475
WP_023483236.1|2757385_2758609_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_023483551.1|2758768_2759194_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023483552.1|2759463_2760033_-	maltose O-acetyltransferase-like protein	NA	NA	NA	NA	NA
WP_023483553.1|2760515_2761754_-	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_023483554.1|2761881_2762715_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_023483555.1|2763162_2763969_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_023483556.1|2764151_2765330_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_023483557.1|2765378_2767739_-	UvrD-helicase domain-containing protein	NA	A0A1E1ETV1	Acanthamoeba_castellanii_mimivirus	25.9	1.7e-08
WP_023483558.1|2767981_2768467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483559.1|2768467_2769265_+	MFS transporter	NA	NA	NA	NA	NA
WP_023483560.1|2769489_2771127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483561.1|2771461_2772730_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_023483562.1|2772722_2773628_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.0	4.7e-23
WP_155116267.1|2773773_2773914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093220.1|2775184_2776051_-	cytochrome c oxidase assembly protein	NA	NA	NA	NA	NA
WP_024093219.1|2776177_2776492_-	cytochrome C oxidase subunit IV family protein	NA	NA	NA	NA	NA
WP_046655223.1|2776496_2777114_-	cytochrome (ubi)quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_077585260.1|2777110_2778919_-	cytochrome c oxidase subunit I	NA	NA	NA	NA	NA
WP_036655362.1|2779108_2780116_-	cytochrome c oxidase subunit II	NA	NA	NA	NA	NA
WP_023483567.1|2780654_2781239_+	guanylate kinase	NA	A0A0K2FM14	Brevibacillus_phage	28.3	2.9e-10
WP_036655364.1|2781516_2782653_+	conserved virulence factor C family protein	NA	NA	NA	NA	NA
WP_023483570.1|2784141_2784447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225750.1|2784557_2784860_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_077585104.1|2784856_2785246_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158529827.1|2785161_2785983_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	50.3	7.2e-39
WP_077585106.1|2785937_2786111_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_024093209.1|2788681_2789038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655368.1|2789034_2789730_-	ATP-binding cassette domain-containing protein	NA	G9BWD6	Planktothrix_phage	33.3	7.8e-18
WP_036655370.1|2790588_2790966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024093204.1|2791330_2791498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655372.1|2792967_2793150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655374.1|2793304_2793604_+|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_036655376.1|2793611_2794733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655377.1|2794747_2795203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655379.1|2795223_2795838_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	30.3	4.8e-11
WP_051427942.1|2795968_2796319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225745.1|2796468_2796714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052752965.1|2796769_2797450_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_144029627.1|2797537_2799295_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_036655381.1|2799377_2800076_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_023483621.1|2800047_2800974_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_024093200.1|2800970_2801771_-	thiazole synthase	NA	NA	NA	NA	NA
WP_036655382.1|2801772_2801976_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_023483618.1|2802032_2802737_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_051428054.1|2802720_2803344_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_036655384.1|2803764_2804277_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_036655386.1|2805281_2805899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483614.1|2805885_2806449_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_046655172.1|2806678_2808091_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_023483612.1|2808196_2808598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023483611.1|2808853_2810296_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_023483609.1|2811632_2812151_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	63.1	1.7e-49
WP_024093191.1|2812177_2812915_-	7-carboxy-7-deazaguanine synthase QueE	NA	E7DN68	Pneumococcus_phage	41.8	4.2e-54
WP_023483607.1|2812907_2813393_-	6-carboxytetrahydropterin synthase QueD	NA	J9PV91	Bacillus_phage	68.2	7.7e-57
WP_023483606.1|2813389_2814061_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.8	1.5e-66
WP_158529828.1|2814704_2816312_+|tRNA	arginine--tRNA ligase	tRNA	A0A2I2L3K1	Orpheovirus	32.3	2.9e-76
WP_024093187.1|2817008_2817146_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_036655391.1|2818181_2819084_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	42.3	1.5e-45
WP_046655388.1|2819050_2819314_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
2819905:2819920	attL	CAAAGAAATAGCTCCC	NA	NA	NA	NA
WP_023483999.1|2820048_2820705_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_036655393.1|2821376_2821664_+|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	37.8	3.1e-05
WP_023484170.1|2821711_2822080_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077585110.1|2822051_2822324_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	U5P429	Shigella_phage	47.0	7.7e-14
WP_023484457.1|2822562_2823936_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_036654156.1|2824702_2825473_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.2	8.0e-32
2824460:2824475	attR	CAAAGAAATAGCTCCC	NA	NA	NA	NA
WP_040931538.1|2825459_2827406_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_036655398.1|2829197_2831180_+	acyltransferase family protein	NA	B5WZU0	Pseudomonas_phage	32.2	3.8e-41
WP_036655400.1|2831196_2831700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104932532.1|2832493_2833363_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	98.7	7.5e-135
WP_036655402.1|2833443_2833734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655403.1|2835142_2836039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484003.1|2836184_2838062_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023484002.1|2838187_2838637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484001.1|2838649_2839630_+	polyprenyl synthetase family protein	NA	NA	NA	NA	NA
WP_144029530.1|2843085_2844015_-	lethal factor domain protein	NA	NA	NA	NA	NA
WP_023483236.1|2844144_2845368_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036655407.1|2848434_2849457_-	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_036655409.1|2849443_2849725_-	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_158225757.1|2849828_2850686_-	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_052304444.1|2850710_2851220_-	TULIP family P47-like protein	NA	NA	NA	NA	NA
WP_036655412.1|2852966_2853191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585262.1|2855476_2855782_+	response regulator	NA	NA	NA	NA	NA
WP_036655414.1|2855778_2856084_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_023485455.1|2856093_2856423_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_023485454.1|2856770_2857637_-	UbiA family prenyltransferase	NA	NA	NA	NA	NA
WP_023485453.1|2857626_2859066_-	menaquinone biosynthesis decarboxylase	NA	NA	NA	NA	NA
WP_023485452.1|2859079_2860354_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.2	3.4e-27
WP_036655417.1|2862444_2863248_-	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_036655420.1|2863264_2864131_-	energy-coupling factor transporter ATPase	NA	W8CYL7	Bacillus_phage	28.9	4.2e-13
WP_023485447.1|2864106_2864940_-	energy-coupling factor transporter ATPase	NA	G9BWD6	Planktothrix_phage	34.2	1.4e-21
WP_036657173.1|2864975_2865545_-	Gx transporter family protein	NA	NA	NA	NA	NA
WP_023485444.1|2866202_2867270_+	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_036655424.1|2867714_2868944_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_046655058.1|2869473_2871054_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_144083284.1|2871294_2871522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485441.1|2871535_2871859_+	YcxB family protein	NA	NA	NA	NA	NA
WP_024093155.1|2872304_2874062_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.7	3.1e-15
WP_036655426.1|2874146_2877842_+	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	30.8	2.3e-76
WP_023485438.1|2877906_2878329_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_036655428.1|2878346_2879219_-	PTS N-acetylgalactosamine transporter subunit IID	NA	NA	NA	NA	NA
WP_036655430.1|2879993_2880467_-	PTS N-acetylgalactosamine transporter subunit IIB	NA	NA	NA	NA	NA
WP_024093152.1|2880675_2881401_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_036655432.1|2881632_2882061_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_023485432.1|2882434_2883655_-	MFS transporter	NA	NA	NA	NA	NA
WP_023485429.1|2886029_2886617_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	36.8	1.2e-11
WP_023485428.1|2886815_2889983_-	MMPL family transporter	NA	NA	NA	NA	NA
WP_023485427.1|2889979_2890435_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_077585115.1|2891262_2891973_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_046655059.1|2892092_2894132_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	43.3	1.4e-11
WP_077585116.1|2894602_2894710_+	TipAS antibiotic-recognition domain-containing protein	NA	NA	NA	NA	NA
WP_036657184.1|2894771_2895062_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485422.1|2895200_2895527_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_046655063.1|2896312_2896681_-	lectin	NA	NA	NA	NA	NA
WP_024093143.1|2897091_2897277_+	sporulation killing factor	NA	NA	NA	NA	NA
WP_023485421.1|2897350_2898565_+	sporulation killing factor system radical SAM maturase	NA	NA	NA	NA	NA
WP_051427950.1|2898578_2900072_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 16
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	3612665	3648196	4289950	integrase,tRNA,transposase,bacteriocin	Paenibacillus_phage(27.27%)	35	3607371:3607387	3632482:3632498
3607371:3607387	attL	TGAAGGGAAGTGTGCTT	NA	NA	NA	NA
WP_023482488.1|3612665_3613145_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase subunit type 1 TsaE	tRNA	NA	NA	NA	NA
WP_023482489.1|3613141_3614020_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_023482490.1|3614026_3614545_+	ribosomal protein S18-alanine N-acetyltransferase	NA	NA	NA	NA	NA
WP_036655844.1|3614557_3615586_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	39.7	4.3e-65
WP_023482492.1|3615718_3616858_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	42.2	1.5e-50
WP_036655849.1|3618382_3619363_+	LD-carboxypeptidase	NA	NA	NA	NA	NA
WP_036655851.1|3619458_3621390_-	ABC-F type ribosomal protection protein	NA	A0A2K9L3Z8	Tupanvirus	30.7	8.7e-59
WP_036655852.1|3621670_3622300_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_023482498.1|3622313_3622811_+	cyclic pyranopterin monophosphate synthase MoaC	NA	NA	NA	NA	NA
WP_023482499.1|3622829_3623321_+	MogA/MoaB family molybdenum cofactor biosynthesis protein	NA	NA	NA	NA	NA
WP_023482500.1|3623317_3624328_+	molybdopterin-binding protein	NA	NA	NA	NA	NA
WP_036655855.1|3624359_3624623_+	twin-arginine translocase TatA/TatE family subunit	NA	NA	NA	NA	NA
WP_024093068.1|3624667_3625429_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	27.7	1.8e-12
WP_023482502.1|3625750_3626032_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	52.2	2.4e-18
WP_023482503.1|3626121_3627750_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	59.1	8.1e-159
WP_077585167.1|3627838_3628336_-|integrase	site-specific integrase	integrase	A0A0C5AN64	Paenibacillus_phage	59.8	5.3e-45
WP_080675781.1|3628868_3629072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|3629364_3630588_+|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_077585169.1|3630706_3630919_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036655862.1|3630889_3631102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077585170.1|3630997_3631231_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_077585279.1|3631237_3631390_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036655864.1|3631638_3631923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655866.1|3632501_3632894_+	hypothetical protein	NA	NA	NA	NA	NA
3632482:3632498	attR	TGAAGGGAAGTGTGCTT	NA	NA	NA	NA
WP_144029687.1|3633386_3633755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144029688.1|3633783_3634041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483965.1|3635025_3636801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585280.1|3637042_3637711_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	96.4	2.8e-129
WP_024093077.1|3637980_3638475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655869.1|3638471_3639575_-	endospore germination permease	NA	NA	NA	NA	NA
WP_036657409.1|3639571_3641095_-	spore germination protein	NA	NA	NA	NA	NA
WP_024093080.1|3641894_3643145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655871.1|3643216_3646243_+	RICIN domain-containing protein	NA	A0A1V0E026	Clostridioides_phage	37.6	1.7e-88
WP_036655873.1|3646380_3647604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036655875.1|3647971_3648196_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A0C5AEG8	Bacteriophage	85.7	2.1e-25
>prophage 17
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	3801016	3858419	4289950	integrase,transposase,bacteriocin	Prochlorococcus_phage(18.18%)	59	3839147:3839206	3858493:3858625
WP_023484873.1|3801016_3801352_-|bacteriocin	circular bacteriocin, circularin A/uberolysin family	bacteriocin	NA	NA	NA	NA
WP_036655979.1|3801398_3801959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655980.1|3802310_3803399_+	3-isopropylmalate dehydrogenase	NA	NA	NA	NA	NA
WP_023484876.1|3803623_3804169_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_036657474.1|3804316_3804709_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_036655983.1|3804746_3806717_-	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_024095275.1|3806763_3806964_-	KTSC domain-containing protein	NA	NA	NA	NA	NA
WP_024095273.1|3807151_3807577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144029657.1|3807822_3808782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484881.1|3809001_3809820_+	RNA polymerase sigma factor SigI	NA	NA	NA	NA	NA
WP_023484882.1|3809812_3810925_+	anti-sigma factor domain-containing protein	NA	NA	NA	NA	NA
WP_046655046.1|3811137_3812532_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_023484884.1|3812673_3813213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484885.1|3813573_3815040_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3ST28	Prochlorococcus_phage	39.4	5.2e-80
WP_036655985.1|3815036_3816392_-	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	38.1	2.4e-55
WP_023484887.1|3816432_3817539_-	glycine cleavage system aminomethyltransferase GcvT	NA	NA	NA	NA	NA
WP_024095265.1|3818153_3818543_+	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_023484889.1|3818764_3819199_+	universal stress protein	NA	NA	NA	NA	NA
WP_077585182.1|3819498_3819783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484891.1|3819812_3820769_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	63.7	6.7e-121
WP_023484892.1|3820823_3821309_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	42.5	1.1e-31
WP_144029658.1|3821400_3821685_+	metal-sensing transcriptional repressor	NA	NA	NA	NA	NA
WP_023484894.1|3821705_3821906_+	heavy-metal-associated domain-containing protein	NA	A0A218MNH0	uncultured_virus	40.0	6.3e-05
WP_023484895.1|3821985_3824427_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.0	3.7e-115
WP_036657482.1|3824483_3825107_-	YcnI family protein	NA	NA	NA	NA	NA
WP_023484897.1|3825196_3825874_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_036657484.1|3825870_3826677_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_077585183.1|3826920_3827208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023484899.1|3827931_3828216_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484900.1|3828388_3830077_+	copper resistance protein CopC	NA	NA	NA	NA	NA
WP_023484901.1|3830470_3830827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484902.1|3831216_3831696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655993.1|3832007_3832202_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_077585288.1|3835202_3835382_+	rubredoxin	NA	NA	NA	NA	NA
WP_036655998.1|3835453_3836161_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_023484907.1|3836435_3837089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036655999.1|3837204_3838386_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_024095253.1|3838571_3838733_+	hypothetical protein	NA	NA	NA	NA	NA
3839147:3839206	attL	TGATCTTACCCCCGTCAAGTAGACAGCATTAAAACTGATAGGTCCTAAGCAACCTTAGTA	NA	NA	NA	NA
WP_104932597.1|3839279_3839711_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.9	6.5e-23
WP_104932598.1|3839689_3839842_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036656001.1|3840056_3840374_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_158225718.1|3840532_3840673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656003.1|3840676_3842026_-	hypothetical protein	NA	A0A0K2CP77	Brevibacillus_phage	34.9	7.6e-70
WP_024095243.1|3842070_3842247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656005.1|3843324_3844314_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_024095245.1|3844306_3845185_+	ribokinase	NA	NA	NA	NA	NA
WP_023484945.1|3845186_3845585_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_023484944.1|3845599_3847081_+	sugar ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.6	4.1e-16
WP_023484943.1|3847082_3848051_+	ribose ABC transporter-like protein	NA	NA	NA	NA	NA
WP_023484942.1|3848069_3848987_+	ribose ABC transporter substrate-binding protein RbsB	NA	NA	NA	NA	NA
WP_023484941.1|3849568_3849727_+	thioredoxin-coupled arsenate reductase-like protein	NA	NA	NA	NA	NA
WP_036656007.1|3849990_3850434_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_023484940.1|3850507_3851302_+	arsenite methyltransferase	NA	NA	NA	NA	NA
WP_077585289.1|3852044_3852311_-	aspartyl-phosphate phosphatase Spo0E family protein	NA	NA	NA	NA	NA
WP_144029548.1|3852559_3853462_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_024095250.1|3854377_3854758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484938.1|3854901_3855807_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A7AR08	Bacillus_phage	57.0	1.4e-91
WP_104932598.1|3857856_3858009_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_104932597.1|3857987_3858419_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	47.9	6.5e-23
3858493:3858625	attR	TACTAAGGTTGCTTAGGACCTATCAGTTTTAATGCTGTCTACTTGACGGGGGTAAGATCACTCTACCGGCGTCAGCTTGTTTAATTTTCGTTGTGGTCGGCTTTGGTTGTAAAAATGAATATATTCCTCAATT	NA	NA	NA	NA
>prophage 18
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	3957523	4028474	4289950	integrase,transposase,coat	Paenibacillus_phage(56.52%)	80	3959252:3959268	4031616:4031632
WP_077585190.1|3957523_3957724_+|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	44.7	2.8e-05
WP_167552509.1|3958016_3958184_-	hypothetical protein	NA	NA	NA	NA	NA
3959252:3959268	attL	TTTTGTTTAACAAGGTT	NA	NA	NA	NA
WP_051427992.1|3959472_3959979_+	hypothetical protein	NA	NA	NA	NA	NA
3959252:3959268	attL	TTTTGTTTAACAAGGTT	NA	NA	NA	NA
WP_023484408.1|3960978_3963078_+	S8 family serine peptidase	NA	A0A218KC60	Bacillus_phage	35.9	3.4e-32
WP_077585191.1|3963269_3963491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484407.1|3963565_3965119_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_024095162.1|3965340_3965595_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484406.1|3965887_3966427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096761292.1|3966727_3966913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046655148.1|3967527_3968961_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_023485369.1|3968957_3970109_-	sporulation protein YhbH	NA	X2JIL8	Bacillus_phage	40.7	5.6e-21
WP_158225712.1|3970710_3971001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656169.1|3970997_3971369_-	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_144029536.1|3971538_3972615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656171.1|3973033_3973228_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485366.1|3974162_3974681_-	stage II sporulation protein M	NA	NA	NA	NA	NA
WP_023485365.1|3975579_3976023_-	glyoxalase/bleomycin resistance/extradiol dioxygenase family protein	NA	NA	NA	NA	NA
WP_023485364.1|3976379_3976751_+	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_023485363.1|3976827_3978339_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_024093275.1|3978362_3978623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485362.1|3978693_3979032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485361.1|3979296_3979608_+	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_023485360.1|3979990_3980632_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_036656176.1|3980767_3981778_-	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_023485358.1|3981797_3983027_-	S-methyl-5-thioribose kinase	NA	NA	NA	NA	NA
WP_024093280.1|3983245_3983695_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.3	8.5e-42
WP_023485355.1|3984620_3985454_+	Fe-S cluster assembly ATPase SufC	NA	W8CYL7	Bacillus_phage	25.3	2.2e-06
WP_023485354.1|3985521_3986817_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_023485353.1|3986813_3988040_+	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	46.2	2.8e-111
WP_023485352.1|3988026_3988464_+	SUF system NifU family Fe-S cluster assembly protein	NA	A0A218MKD1	uncultured_virus	31.2	1.1e-12
WP_023485351.1|3988488_3989886_+	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_024093285.1|3990128_3990320_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_052337377.1|3990351_3990651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656178.1|3990969_3991152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051428002.1|3991167_3991902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023485349.1|3992145_3992748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225711.1|3992741_3993080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023485348.1|3993110_3993512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093291.1|3993787_3994450_+	hypothetical protein	NA	A0A2I7SC02	Paenibacillus_phage	46.7	5.1e-11
WP_024093292.1|3994425_3994656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093293.1|3994915_3995155_+	hypothetical protein	NA	R9W0N4	Paenibacillus_phage	96.2	4.1e-35
WP_077585291.1|3995154_3995790_+	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0K2CXQ8	Paenibacillus_phage	97.2	4.3e-124
WP_024093295.1|3995903_3996146_+	hypothetical protein	NA	A0A2I7SC00	Paenibacillus_phage	90.0	6.2e-31
WP_036655055.1|3996794_3997082_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_158442223.1|3997180_3997849_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_023483374.1|3997961_3998264_+	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	45.0	9.8e-10
WP_046655151.1|3998716_3999712_+	amidinotransferase	NA	NA	NA	NA	NA
WP_144029696.1|4000048_4000417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023483236.1|4000409_4001633_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	100.0	4.7e-228
WP_036656185.1|4003186_4003453_+	hypothetical protein	NA	A0A0C5AEH5	Bacteriophage	76.1	7.5e-30
WP_036656186.1|4004052_4004352_+	SH3 domain-containing protein	NA	A0A0K2CXS6	Paenibacillus_phage	93.9	1.1e-45
4003613:4003629	attR	AACCTTGTTAAACAAAA	NA	NA	NA	NA
WP_155116292.1|4004362_4004533_+	hypothetical protein	NA	A0A2I7SCU7	Paenibacillus_phage	86.0	2.9e-19
4003613:4003629	attR	AACCTTGTTAAACAAAA	NA	NA	NA	NA
WP_040931737.1|4004660_4005641_+	hypothetical protein	NA	A0A2I7SDE4	Paenibacillus_phage	81.6	1.4e-68
WP_036656190.1|4005904_4006309_+	hypothetical protein	NA	A0A2I7SDE8	Paenibacillus_phage	100.0	8.7e-70
WP_096761311.1|4006544_4007616_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	98.9	2.8e-152
WP_024093300.1|4008003_4008330_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_024093302.1|4008740_4009007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024093303.1|4009090_4010134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036656192.1|4010153_4010417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225766.1|4010489_4010588_+	sporulation protein YjcZ	NA	NA	NA	NA	NA
WP_023484376.1|4010821_4011217_+	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_023484377.1|4011411_4012458_-	HD-GYP domain-containing protein	NA	NA	NA	NA	NA
WP_036656196.1|4012536_4012869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036656198.1|4013061_4013778_+	collagen-like repeat preface domain-containing protein	NA	NA	NA	NA	NA
WP_144029662.1|4013838_4014030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023484380.1|4014214_4015630_+	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_023484381.1|4015774_4016626_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_077585292.1|4017014_4018118_+	radical SAM/CxCxxxxC motif protein YfkAB	NA	NA	NA	NA	NA
WP_023484383.1|4018170_4019541_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_104932592.1|4019700_4020570_-|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	97.9	1.1e-133
WP_036656200.1|4020590_4021274_-	helix-turn-helix domain-containing protein	NA	A0A0C5AJ29	Paenibacillus_phage	99.1	9.7e-122
WP_077585196.1|4021454_4021667_+|coat	spore coat associated protein CotJA	coat	NA	NA	NA	NA
WP_024093310.1|4021939_4022206_+|coat	spore coat protein CotJB	coat	NA	NA	NA	NA
WP_040932682.1|4022247_4022817_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_036657842.1|4023209_4023506_+	hypothetical protein	NA	A0A0K2CZ50	Paenibacillus_phage	70.6	3.5e-12
WP_023484389.1|4023735_4024641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158225767.1|4024763_4024898_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_036657844.1|4025844_4026042_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077585197.1|4028020_4028230_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_158673690.1|4028264_4028474_+|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	53.7	5.9e-14
4031616:4031632	attR	CACCTCAAGGCTCTTTT	NA	NA	NA	NA
>prophage 19
NZ_CP019687	Paenibacillus larvae subsp. larvae strain ATCC-9545 chromosome, complete genome	4289950	4069422	4076179	4289950		Staphylococcus_phage(57.14%)	7	NA	NA
WP_023482600.1|4069422_4069860_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	45.3	1.6e-21
WP_036658391.1|4070804_4071917_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	35.5	1.2e-52
WP_023482602.1|4071920_4072586_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	43.3	3.4e-39
WP_040931955.1|4072620_4073850_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	51.0	8.1e-111
WP_023482604.1|4073885_4074356_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	57.9	1.1e-42
WP_036657869.1|4074786_4075569_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	34.2	9.7e-09
WP_036658393.1|4075537_4076179_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	31.9	8.2e-14
