The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019865	Dehalococcoides mccartyi strain KBTCE2 chromosome, complete genome	1329198	426960	442383	1329198		Bacillus_phage(20.0%)	15	NA	NA
WP_077975133.1|426960_428253_+	phosphoglucosamine mutase	NA	A0A127AWJ1	Bacillus_phage	25.6	2.0e-22
WP_077975134.1|428254_429457_+	NTP transferase domain-containing protein	NA	G3MA50	Bacillus_virus	31.1	4.8e-15
WP_077975135.1|429472_430654_+	NTP transferase domain-containing protein	NA	A0A1D7XFC1	Escherichia_phage	33.3	3.2e-19
WP_077975136.1|430655_432437_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1HMK6	Paramecium_bursaria_Chlorella_virus	39.7	1.7e-109
WP_041341495.1|432444_432897_-	YbhB/YbcL family Raf kinase inhibitor-like protein	NA	NA	NA	NA	NA
WP_077975137.1|432908_433613_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_041341497.1|433752_435057_+	diaminopimelate decarboxylase	NA	A0A0N7KVV8	Yellowstone_lake_phycodnavirus	24.3	1.6e-16
WP_077975138.1|435071_436091_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	25.8	7.7e-14
WP_077975139.1|436093_436927_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_077975140.1|436912_437446_-	HNH endonuclease	NA	H6WG01	Cyanophage	37.2	2.6e-21
WP_077975141.1|437517_438930_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	32.8	8.7e-24
WP_077975142.1|438853_439564_-	DnaD domain protein	NA	NA	NA	NA	NA
WP_041330720.1|439560_440937_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	41.1	7.0e-87
WP_010936318.1|440937_441393_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_077975143.1|441462_442383_-	thioredoxin-disulfide reductase	NA	A0A249XZT7	Enterococcus_phage	41.0	5.6e-48
>prophage 2
NZ_CP019865	Dehalococcoides mccartyi strain KBTCE2 chromosome, complete genome	1329198	466750	475855	1329198	capsid	Erysipelothrix_phage(33.33%)	9	NA	NA
WP_077975151.1|466750_468421_-	DUF4368 domain-containing protein	NA	A0A097BYD1	Leuconostoc_phage	23.0	3.5e-16
WP_077975152.1|468476_468680_-	transposon-encoded TnpW family protein	NA	NA	NA	NA	NA
WP_171973476.1|468754_469669_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	38.9	2.1e-55
WP_149866958.1|469685_469973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975155.1|469978_470254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975156.1|470526_472824_-	nucleoside triphosphatase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	30.6	1.1e-95
WP_077975157.1|473413_473635_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B261	Erysipelothrix_phage	40.0	7.4e-07
WP_077975158.1|473631_474312_+	restriction endonuclease subunit M	NA	A0A219YCJ6	Aeromonas_phage	37.5	1.8e-06
WP_077975159.1|474304_475855_+	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2H4UUH6	Bodo_saltans_virus	26.5	6.2e-31
>prophage 3
NZ_CP019865	Dehalococcoides mccartyi strain KBTCE2 chromosome, complete genome	1329198	847630	962340	1329198	integrase,protease,head,tail,holin,tRNA,capsid,terminase,portal	Erysipelothrix_phage(44.68%)	112	934511:934570	936189:936258
WP_149866963.1|847630_848488_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A142F1N9	Bacillus_phage	32.0	2.1e-33
WP_171973442.1|851141_851855_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	33.7	1.6e-26
WP_010936721.1|851884_852025_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010936722.1|852046_852322_+	acylphosphatase	NA	NA	NA	NA	NA
WP_010936723.1|852347_853082_-	DUF362 domain-containing protein	NA	NA	NA	NA	NA
WP_077975366.1|853617_855105_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	1.2e-47
WP_077975367.1|855104_855707_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_041342418.1|855755_856610_-	DegV family protein	NA	NA	NA	NA	NA
WP_077975368.1|856685_858209_-	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	24.6	2.4e-27
WP_010936730.1|858779_860144_+	TrpB-like pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_041342424.1|860264_861080_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	33.1	3.0e-13
WP_077975369.1|861088_862210_+	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRH0	uncultured_Mediterranean_phage	30.4	2.2e-14
WP_077975370.1|862222_865267_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	33.4	1.3e-154
WP_041342429.1|865568_866249_-	protein jag	NA	NA	NA	NA	NA
WP_041223374.1|866160_867108_-	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_010936736.1|867119_868235_-	PQQ-binding-like beta-propeller repeat protein	NA	NA	NA	NA	NA
WP_077975371.1|868244_868457_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	58.0	1.3e-19
WP_171973443.1|868428_868791_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_010936738.1|868850_868991_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_058292646.1|869027_869471_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_010936740.1|869505_869913_-	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	43.7	3.4e-21
WP_010936741.1|869961_870291_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_077975668.1|870770_871736_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_010936745.1|872040_872283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975373.1|872358_872736_-	RidA family protein	NA	NA	NA	NA	NA
WP_077975374.1|872866_874192_+	ATPase	NA	NA	NA	NA	NA
WP_077975669.1|874284_875424_-	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_077975375.1|875607_877374_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_077975376.1|877376_878240_+	DMT family transporter	NA	NA	NA	NA	NA
WP_077975377.1|878343_878901_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975378.1|879004_879688_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.8	4.6e-39
WP_077975379.1|879694_881116_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	30.7	1.6e-30
WP_077975380.1|881323_882730_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_041342460.1|883097_883796_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_077975381.1|883792_887098_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_077975670.1|887232_888417_+	class I SAM-dependent RNA methyltransferase	NA	A0A2K5B251	Erysipelothrix_phage	26.5	5.9e-34
WP_077975382.1|888701_889184_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_077975671.1|889324_890884_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	52.6	5.6e-149
WP_077975383.1|890898_891312_-	recombinase	NA	A0A2K5B2B3	Erysipelothrix_phage	44.2	6.6e-25
WP_077975384.1|891312_892875_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	51.6	1.1e-152
WP_171973444.1|892925_893153_-	hypothetical protein	NA	A0A2K5B2B1	Erysipelothrix_phage	45.9	1.4e-05
WP_077975385.1|893241_893952_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	42.0	3.1e-46
WP_077975386.1|893948_894359_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	58.1	6.6e-41
WP_077975387.1|894374_895703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975388.1|895707_897996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975389.1|898008_899412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975390.1|899408_899756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975391.1|899752_901930_-|tail	phage tail protein	tail	A0A2K5B297	Erysipelothrix_phage	49.3	1.7e-26
WP_077975393.1|902140_902524_-	hypothetical protein	NA	A0A2K5B295	Erysipelothrix_phage	68.5	2.5e-42
WP_077975394.1|902530_903133_-|tail	phage tail protein	tail	A0A2K5B294	Erysipelothrix_phage	72.8	3.0e-74
WP_077975395.1|903138_903477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975396.1|903473_903908_-	HK97 gp10 family phage protein	NA	A0A2K5B292	Erysipelothrix_phage	46.8	2.2e-26
WP_077975397.1|903907_904243_-|head,tail	head-tail adaptor protein	head,tail	A0A2K5B291	Erysipelothrix_phage	50.0	5.0e-23
WP_077975398.1|904348_904768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975399.1|904764_905082_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2K5B290	Erysipelothrix_phage	69.0	2.5e-32
WP_077975400.1|905096_905468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975401.1|905483_906665_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	56.1	1.6e-116
WP_077975402.1|906684_907416_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	65.8	2.6e-80
WP_077975403.1|907412_908648_-|portal	phage portal protein	portal	Q6DMU2	Streptococcus_phage	66.4	1.8e-158
WP_077975404.1|908644_910255_-|terminase	terminase large subunit	terminase	A0A1X9I6B3	Streptococcus_phage	56.5	5.5e-176
WP_077975405.1|910400_910835_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_077975406.1|911995_913984_-	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	35.5	1.9e-29
WP_077975407.1|913949_915233_-	site-specific DNA-methyltransferase	NA	A0A2I4R670	Erysipelothrix_phage	49.9	7.7e-112
WP_078051068.1|915236_915875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975409.1|915877_916228_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	53.0	2.4e-31
WP_077975673.1|916330_916753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975410.1|916830_918189_-	DEAD/DEAH box helicase	NA	A0A2K5B273	Erysipelothrix_phage	66.9	1.1e-153
WP_077975411.1|918169_918451_-	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	61.1	6.5e-24
WP_171973445.1|918682_921010_-	hypothetical protein	NA	A0A1W6JQ82	Corynebacterium_phage	48.3	4.5e-219
WP_077975412.1|920997_921237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975413.1|921226_921649_-	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	57.6	1.5e-40
WP_077975414.1|921629_921902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975415.1|921894_922674_-	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AEJ9	Bacteriophage	55.2	1.7e-74
WP_077975416.1|922763_924758_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	67.5	1.5e-263
WP_077975417.1|924823_925414_-	DUF2815 family protein	NA	A0A1B0RXA9	Streptococcus_phage	74.4	7.9e-72
WP_077975418.1|925406_926540_-	DUF2800 domain-containing protein	NA	Q6DMW2	Streptococcus_phage	56.7	2.2e-118
WP_077975419.1|926532_926880_-	DNA ligase	NA	A0A2K5B2A7	Erysipelothrix_phage	39.8	2.3e-10
WP_077975420.1|926863_927046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975421.1|927134_927596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171973446.1|927756_927915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975422.1|928132_929059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975423.1|929055_929502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975424.1|929506_931405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975675.1|931475_931712_+	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	62.3	1.1e-19
WP_077975425.1|931711_933223_+	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	30.9	3.2e-56
WP_077975426.1|933212_933716_+	restriction endonuclease subunit S	NA	A0A240FAT6	Liberibacter_phage	36.0	1.1e-26
WP_149866965.1|933915_934560_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
934511:934570	attL	CCGAATGGCTCGAAGTCCACGAACCAAGACTTGAAAATGGCCTGTGCCATCTGCTCTAAA	NA	NA	NA	NA
WP_077975428.1|934631_935624_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JAA2	uncultured_Caudovirales_phage	28.8	1.5e-35
WP_077975429.1|935637_936312_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
936189:936258	attR	TTTAGAGCAGATGGCACAGGCCATTTTCAAGTCTTGGTTCGTGGACTTCGAGCCATTCGGTGGCGTAATG	NA	NA	NA	NA
WP_077975430.1|937033_939097_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_077975431.1|941751_942426_+	septum formation protein Maf	NA	NA	NA	NA	NA
WP_077975433.1|942477_942903_-	DUF3795 domain-containing protein	NA	NA	NA	NA	NA
WP_041343624.1|942971_944672_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	35.2	4.5e-83
WP_010936816.1|944757_946089_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_010936817.1|946210_946549_-	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_010936818.1|946545_947772_-	ammonium transporter	NA	NA	NA	NA	NA
WP_041342471.1|947911_948583_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.3	1.0e-19
WP_010936820.1|948604_949375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041342474.1|949375_950878_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_077975434.1|950879_951641_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_041342480.1|951634_952765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010936824.1|952777_954085_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_077975435.1|954081_954699_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_010936826.1|954714_955146_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_077975436.1|955266_955848_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_077975437.1|955969_956932_+	cysteine synthase A	NA	A0A1W6JHY1	Lactococcus_phage	52.5	6.2e-74
WP_077975438.1|957020_957521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077975440.1|958046_958595_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_077975441.1|958594_959371_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_077975442.1|959410_960850_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_041342510.1|960859_961522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077975443.1|961518_962340_-|protease	PrsW family intramembrane metalloprotease	protease	NA	NA	NA	NA
