The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019401	Planococcus faecalis strain AJ003 chromosome, complete genome	3495892	546909	554236	3495892	protease,integrase	uncultured_virus(33.33%)	10	550638:550656	559313:559331
WP_058386359.1|546909_547680_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	29.9	2.1e-19
WP_078080124.1|547697_548516_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_006831533.1|548707_548992_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	48.4	4.1e-18
WP_071154661.1|549023_550655_+	chaperonin GroEL	NA	A0A240F755	uncultured_virus	54.0	2.9e-156
550638:550656	attL	ATGGGCGGCATGATGTAAT	NA	NA	NA	NA
WP_071154660.1|550748_551918_-|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	44.3	2.7e-87
WP_071154659.1|551952_552420_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_071154658.1|552549_552801_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_169835252.1|552821_553100_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071154656.1|553113_553413_+	hypothetical protein	NA	A0A1B1P7U4	Bacillus_phage	31.8	2.6e-07
WP_071154655.1|553417_554236_+	bifunctional DNA primase/polymerase	NA	A0A173H0P8	Pseudoalteromonas_phage	40.7	2.1e-22
559313:559331	attR	ATGGGCGGCATGATGTAAT	NA	NA	NA	NA
>prophage 2
NZ_CP019401	Planococcus faecalis strain AJ003 chromosome, complete genome	3495892	940058	949828	3495892		Synechococcus_phage(37.5%)	9	NA	NA
WP_071153246.1|940058_941354_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	31.7	2.7e-16
WP_071153247.1|941370_942087_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SCX8	Cyanophage	42.4	5.9e-45
WP_058386059.1|942083_942338_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	M4QPE7	Synechococcus_phage	34.1	6.1e-05
WP_049695147.1|942334_943018_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_071153248.1|943001_945227_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.8	2.3e-164
WP_038705370.1|945202_946624_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.9	1.4e-53
WP_071153249.1|946636_947698_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.6	3.0e-61
WP_071153250.1|947687_948260_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	33.0	6.8e-20
WP_071153251.1|948292_949828_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.0	6.2e-76
>prophage 3
NZ_CP019401	Planococcus faecalis strain AJ003 chromosome, complete genome	3495892	1227799	1233395	3495892		Staphylococcus_phage(83.33%)	6	NA	NA
WP_058385824.1|1227799_1228030_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	66.7	1.9e-21
WP_058385823.1|1228136_1228583_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	61.6	2.8e-45
WP_071153366.1|1228649_1229108_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	38.0	9.3e-20
WP_071153367.1|1229088_1229868_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	37.2	3.5e-35
WP_071153368.1|1229910_1231500_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	62.2	7.6e-186
WP_071153369.1|1232198_1233395_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	75.6	1.1e-160
>prophage 4
NZ_CP019401	Planococcus faecalis strain AJ003 chromosome, complete genome	3495892	2120847	2167439	3495892	holin,tail,terminase,integrase,plate,capsid	Bacillus_phage(25.0%)	74	2116538:2116597	2166065:2166157
2116538:2116597	attL	AAAAAACCGTTGGAGCCTTAGAGCCCCAACGGTTTTCAACTTAATACATTTTCAAGTATT	NA	NA	NA	NA
WP_071152976.1|2120847_2121117_-|holin	holin	holin	A0A0U4JE55	Bacillus_phage	48.8	3.1e-15
WP_071152977.1|2121132_2121513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169835269.1|2122154_2123123_+	EpsG family protein	NA	NA	NA	NA	NA
WP_078080527.1|2123203_2124412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080528.1|2124413_2125625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071152983.1|2125626_2126325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080529.1|2126371_2126503_-	XkdX family protein	NA	NA	NA	NA	NA
WP_071152985.1|2126906_2127656_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_071152986.1|2127659_2128313_-	DUF2313 domain-containing protein	NA	S6BFJ0	Thermus_phage	25.3	8.4e-14
WP_078080530.1|2128312_2129401_-|plate	baseplate J/gp47 family protein	plate	A0A0A7RUN3	Clostridium_phage	31.7	3.4e-36
WP_078080531.1|2129397_2129811_-	DUF2634 domain-containing protein	NA	NA	NA	NA	NA
WP_071152990.1|2129812_2130157_-	DUF2577 family protein	NA	NA	NA	NA	NA
WP_078080532.1|2130199_2132125_-	C40 family peptidase	NA	A0A2H4IZP4	uncultured_Caudovirales_phage	32.5	1.1e-40
WP_071152992.1|2132136_2132835_-	LysM peptidoglycan-binding domain-containing protein	NA	S6BFJ4	Thermus_phage	28.5	2.0e-13
WP_071152993.1|2132831_2134223_-	hypothetical protein	NA	A0A1S5S8I3	Streptococcus_phage	42.4	6.5e-32
WP_078080533.1|2134497_2135250_-	hypothetical protein	NA	A0A1X9I6B4	Streptococcus_phage	53.7	3.9e-23
WP_169835270.1|2135284_2135443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071152996.1|2135457_2135865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071152997.1|2135911_2136343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080534.1|2136346_2137375_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0A7S087	Clostridium_phage	24.0	8.0e-11
WP_078080535.1|2137405_2137951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080536.1|2137955_2138348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080537.1|2138344_2138680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080538.1|2138676_2139060_-	hypothetical protein	NA	A0A1U9WQS7	Geobacillus_phage	34.7	2.1e-09
WP_071154213.1|2139094_2139361_-	hypothetical protein	NA	M4ZS13	Bacillus_phage	48.3	1.8e-07
WP_078080539.1|2139424_2140411_-|capsid	major capsid protein	capsid	A0A1U9WQS4	Geobacillus_phage	56.7	2.9e-103
WP_071154210.1|2140435_2140786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080540.1|2140785_2141541_-	hypothetical protein	NA	M4ZSA3	Bacillus_phage	29.1	8.8e-07
WP_078080541.1|2141705_2141888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154207.1|2142108_2142339_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154206.1|2142343_2142592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154205.1|2142639_2143548_-	hypothetical protein	NA	A0A1S5SAA4	Streptococcus_phage	42.2	1.5e-08
WP_071154204.1|2143544_2145107_-	hypothetical protein	NA	A0A1U9WQP5	Geobacillus_phage	48.9	2.3e-134
WP_071154203.1|2145110_2146397_-|terminase	PBSX family phage terminase large subunit	terminase	M4ZRM5	Bacillus_phage	61.9	1.3e-151
WP_071154202.1|2146396_2147239_-|terminase	terminase small subunit	terminase	Q5YA77	Bacillus_phage	56.1	9.9e-68
WP_071154201.1|2147275_2147722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154200.1|2147924_2148320_-	hypothetical protein	NA	A0A290FZR5	Caldibacillus_phage	53.0	2.0e-34
WP_071154199.1|2148331_2148526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154198.1|2148539_2148914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154197.1|2149023_2149203_-	DUF3954 domain-containing protein	NA	A0A2P1JTX5	Anoxybacillus_phage	53.7	4.0e-11
WP_071154196.1|2149248_2149440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154195.1|2149552_2149834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154194.1|2149836_2150271_-	RusA family crossover junction endodeoxyribonuclease	NA	A8ATL5	Listeria_phage	39.3	1.8e-20
WP_071154193.1|2150366_2150615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154191.1|2150946_2151150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154190.1|2151142_2151712_-	hypothetical protein	NA	A0A2P1JTZ1	Anoxybacillus_phage	49.5	1.3e-39
WP_169835271.1|2151731_2151872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154189.1|2151887_2152109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154188.1|2152316_2152580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_169835272.1|2152734_2152911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154187.1|2153006_2153432_-	single-stranded DNA-binding protein	NA	D7RWG9	Brochothrix_phage	74.8	1.1e-41
WP_071154186.1|2153443_2153692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154185.1|2153691_2154279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154184.1|2154359_2154539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_151897524.1|2154550_2155357_-	ATP-binding protein	NA	A0A1B1P8D0	Bacillus_phage	50.0	2.0e-70
WP_071154183.1|2155313_2156237_-	DnaD domain protein	NA	D2XR43	Bacillus_phage	40.1	9.9e-45
WP_071154182.1|2156329_2156569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080543.1|2156599_2157406_-	PD-(D/E)XK nuclease family protein	NA	A0A290GJV0	Caldibacillus_phage	61.5	8.8e-90
WP_078080544.1|2157368_2158268_-	hypothetical protein	NA	A0A2P1JTZ5	Anoxybacillus_phage	67.9	3.1e-107
WP_071154180.1|2158353_2158572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154179.1|2158544_2158760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154178.1|2158759_2158999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080545.1|2159261_2159786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154175.1|2159873_2160152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078080546.1|2160158_2161145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154173.1|2161162_2161915_-	antA/AntB antirepressor family protein	NA	Q6R850	Staphylococcus_virus	54.0	3.6e-61
WP_143039543.1|2162254_2162443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071154171.1|2162459_2162696_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071154170.1|2162849_2163275_+	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	54.0	5.6e-11
WP_078080547.1|2163336_2163537_+	YqaE/Pmp3 family membrane protein	NA	A0A2I7SCF5	Paenibacillus_phage	62.3	1.8e-12
WP_078080548.1|2163565_2164276_+	PH domain-containing protein	NA	A0A0D4DCT6	Staphylococcus_phage	36.5	1.4e-22
WP_071154169.1|2164345_2164807_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A2H4JA43	uncultured_Caudovirales_phage	33.8	2.7e-19
WP_071154168.1|2164874_2165999_+|integrase	site-specific integrase	integrase	A0A0S2SXP1	Bacillus_phage	54.6	7.6e-47
WP_058384986.1|2166104_2167439_-	type I glutamate--ammonia ligase	NA	A0A1V0SJ53	Klosneuvirus	25.2	5.2e-10
2166065:2166157	attR	AAAAAACCGTTGGAGCCTTAGAGCCCCAACGGTTTTCAACTTAATACATTTTCAAGTATTGCTCACGTTCCCACGGGTGGACGCTTGTGCGGA	NA	NA	NA	NA
