The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	509	34160	5056072	tail,capsid,plate,head,terminase,integrase,lysis,portal	Salmonella_phage(88.37%)	45	8124:8145	39523:39544
WP_000980501.1|509_728_-	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_078174886.1|796_1897_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.2	3.2e-175
WP_000980397.1|1893_2379_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	2.2e-67
WP_078174888.1|2375_5453_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.6	0.0e+00
WP_000763312.1|5445_5565_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	1.1e-12
WP_078174890.1|5579_5882_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207660.1|5936_6452_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001522722.1|6461_7634_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.5	1.6e-204
WP_078174892.1|7776_8343_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	84.8	6.4e-87
8124:8145	attL	CAAGATGCCGCATACTGCGCCC	NA	NA	NA	NA
WP_078174894.1|8373_8763_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	5.5e-13
WP_001106828.1|8784_9225_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_078174896.1|9196_9799_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.5	1.1e-97
WP_078174898.1|9798_11340_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	71.8	2.4e-200
WP_001086836.1|11336_11942_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_078174900.1|11934_12843_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	5.9e-143
WP_001522712.1|12829_13189_-	hypothetical protein	NA	A0A1S6KZZ4	Salmonella_phage	88.2	5.0e-53
WP_078174902.1|13185_13764_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	8.0e-93
WP_000829146.1|13832_14279_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	6.6e-63
WP_001039945.1|14271_14703_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_078174904.1|14798_15227_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	76.6	8.4e-47
WP_021514966.1|15223_15601_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	5.1e-16
WP_001069909.1|15602_16115_-	lysozyme	NA	E5G6N1	Salmonella_phage	92.3	3.1e-88
WP_000171568.1|16095_16311_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|16314_16518_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000673523.1|16517_16982_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.6	6.4e-77
WP_000059191.1|17077_17728_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	96.3	8.7e-112
WP_078174906.1|17731_18790_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	92.6	1.7e-181
WP_000216237.1|18806_19640_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	2.8e-123
WP_001098431.1|19782_21549_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_078174908.1|21548_22574_+|portal	phage portal protein	portal	E5G6M3	Salmonella_phage	89.4	1.2e-171
WP_078174910.1|22635_24378_-	AIPR family protein	NA	NA	NA	NA	NA
WP_000700647.1|24653_25331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001217575.1|25444_25678_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154431.1|25688_25877_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	96.8	1.6e-26
WP_078174912.1|26031_28446_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_078174914.1|28442_29300_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	6.0e-161
WP_023135809.1|29296_29524_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	1.7e-35
WP_001244228.1|29523_29757_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	6.4e-33
WP_078174916.1|29824_30166_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	7.8e-56
WP_000956182.1|30129_30330_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_078174918.1|30337_30847_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	95.3	3.0e-83
WP_000102105.1|30879_31122_-	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_078174920.1|31241_31874_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	90.5	5.3e-106
WP_078174922.1|31875_32889_+|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	95.0	1.9e-190
WP_069914412.1|32903_34160_+	hypothetical protein	NA	E5G6K9	Salmonella_phage	39.3	2.5e-75
39523:39544	attR	CAAGATGCCGCATACTGCGCCC	NA	NA	NA	NA
>prophage 2
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	1906953	1975448	5056072	protease,tRNA,transposase	uncultured_Caudovirales_phage(16.67%)	59	NA	NA
WP_001162173.1|1906953_1908306_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232253.1|1908488_1908875_+	cytochrome b562	NA	NA	NA	NA	NA
WP_000212715.1|1909066_1909309_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001105433.1|1909298_1909589_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001009182.1|1909589_1910054_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_000187798.1|1910238_1912377_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001315166.1|1912770_1914426_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_001299664.1|1914475_1915897_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|1916015_1916963_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|1917147_1917201_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471847.1|1917341_1920038_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|1920243_1920630_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|1920702_1921164_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|1921176_1922112_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_078175028.1|1922115_1922250_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_001586593.1|1922530_1922926_-	RidA family protein	NA	NA	NA	NA	NA
WP_001586594.1|1923057_1923771_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256663.1|1923841_1924435_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001336307.1|1924579_1925032_+	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000036440.1|1925154_1926807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|1926879_1927884_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|1928045_1928462_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059397.1|1928507_1929011_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079628.1|1929203_1930400_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416403.1|1930455_1933311_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786393.1|1933310_1933754_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|1934107_1935619_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584114.1|1935885_1936986_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|1936985_1938068_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294573.1|1938228_1939731_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.2	4.6e-84
WP_001309159.1|1939808_1940807_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128347.1|1940873_1942193_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|1942255_1943020_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|1943043_1944075_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|1944291_1944855_+	gluconokinase	NA	NA	NA	NA	NA
WP_001318460.1|1944858_1945878_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_000050905.1|1950264_1950408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024187461.1|1950435_1951782_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000179691.1|1952390_1953608_+	MFS transporter	NA	NA	NA	NA	NA
WP_000611568.1|1953619_1954738_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|1954780_1954906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|1954958_1955216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|1955529_1956696_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|1956631_1957045_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|1957107_1959105_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000336726.1|1959258_1960077_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.2	1.2e-65
WP_000088391.1|1960112_1960415_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000177057.1|1961348_1961606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|1962162_1962930_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|1962930_1963887_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|1963883_1964882_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|1964878_1965781_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|1965825_1968150_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068910.1|1968236_1969190_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|1969186_1969708_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|1971457_1971715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024187462.1|1971877_1972087_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	92.0	7.8e-06
WP_000823243.1|1972465_1973824_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_078175032.1|1974062_1975448_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.1	1.3e-258
>prophage 3
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	2320270	2389994	5056072	protease,tRNA,plate,transposase	Emiliania_huxleyi_virus(11.11%)	57	NA	NA
WP_001314482.1|2320270_2321623_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|2321652_2324085_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|2324206_2324692_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|2324695_2325721_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|2325825_2326281_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|2326284_2327073_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139685.1|2327072_2328221_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569423.1|2328217_2328814_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001294791.1|2328850_2332333_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000055746.1|2332345_2333305_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020966.1|2333403_2335545_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|2335601_2335991_+	VOC family protein	NA	NA	NA	NA	NA
WP_000176529.1|2336055_2337351_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062315.1|2337399_2337660_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|2337646_2337847_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185300.1|2338012_2338558_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|2338554_2338977_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000239179.1|2338990_2339701_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000360445.1|2339730_2340555_-	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001260707.1|2340607_2342326_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000094026.1|2342436_2343144_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202329.1|2343140_2343545_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874224.1|2343662_2344478_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001294600.1|2344517_2345171_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593994.1|2345163_2346195_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001140178.1|2346382_2346955_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000997023.1|2352716_2353520_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SKP9	Klosneuvirus	31.4	4.4e-33
WP_000648591.1|2353516_2354431_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|2354671_2355472_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000211713.1|2355548_2356319_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000644685.1|2356366_2357725_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052736.1|2357796_2358552_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001295200.1|2358585_2359308_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917883.1|2359304_2359772_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_024165575.1|2359836_2360568_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	38.6	7.6e-40
WP_001086160.1|2361103_2361889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000013179.1|2362228_2362708_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000073803.1|2362725_2364084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122986661.1|2364094_2367532_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001586684.1|2367641_2369084_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088845.1|2369088_2369832_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_078175039.1|2369828_2372561_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.0	1.2e-82
WP_024187425.1|2372570_2373335_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000224513.1|2373348_2374695_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013424.1|2374697_2375222_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_122986660.1|2375218_2376511_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896719.1|2376515_2377565_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863395.1|2377528_2379370_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_001189669.1|2379375_2379801_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111580.1|2379805_2381290_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041478.1|2381312_2381816_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|2382518_2383037_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001306807.1|2383257_2385216_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.7	1.9e-24
WP_000446997.1|2385215_2386055_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_001306805.1|2386076_2387648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536467.1|2387762_2388725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000400154.1|2389037_2389994_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	3312285	3348784	5056072	protease,capsid,transposase,head,terminase,integrase,portal	uncultured_Caudovirales_phage(58.82%)	41	3306271:3306285	3347654:3347668
3306271:3306285	attL	GCAGCAAAAGCGGCA	NA	NA	NA	NA
WP_113698257.1|3312285_3313633_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.1	6.7e-74
WP_001043459.1|3313811_3314351_+	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_001578163.1|3314412_3315045_-	TetR family copper-responsive transcriptional repressor ComR	NA	NA	NA	NA	NA
WP_000800153.1|3315285_3315543_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
WP_072148303.1|3315624_3316587_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
WP_024187418.1|3316730_3320177_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001586916.1|3320304_3321378_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|3321638_3322838_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033695.1|3322830_3323532_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.9e-35
WP_001251363.1|3323531_3324776_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|3324804_3325716_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952755.1|3325731_3326553_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_001550962.1|3326690_3327476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586917.1|3327472_3327934_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759309.1|3327991_3329038_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|3329034_3329829_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000799401.1|3329825_3330683_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|3330666_3331803_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001586919.1|3332052_3333279_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|3333327_3334449_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_001557264.1|3334697_3335927_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.9	3.8e-132
WP_000953274.1|3336287_3336476_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_001674252.1|3336528_3337821_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000336139.1|3337810_3338035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|3338027_3338393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204077.1|3338385_3338607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204962.1|3338608_3338842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001403029.1|3338847_3339147_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001586920.1|3339143_3340898_+	phage/plasmid primase P4 family domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	40.0	3.2e-92
WP_001586921.1|3341186_3341465_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126692.1|3341461_3341872_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233308.1|3341882_3342155_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137345.1|3342442_3343600_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.8e-137
WP_000504054.1|3343639_3344212_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_000267608.1|3344213_3345425_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001586922.1|3345421_3345760_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.3e-31
WP_000134113.1|3345756_3346053_+	hypothetical protein	NA	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	4.0e-32
WP_001145905.1|3346052_3346493_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174067.1|3346476_3346659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|3346782_3347139_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001586923.1|3347122_3348784_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.7	5.2e-278
3347654:3347668	attR	GCAGCAAAAGCGGCA	NA	NA	NA	NA
>prophage 5
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	3469395	3540441	5056072	tail,capsid,transposase,protease,holin,head,terminase,integrase	Enterobacteria_phage(32.14%)	85	3468417:3468431	3516143:3516157
3468417:3468431	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_000113680.1|3469395_3470526_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	2.6e-103
WP_000113189.1|3470503_3470752_-	excisionase	NA	NA	NA	NA	NA
WP_000048437.1|3470816_3473288_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001093951.1|3473367_3473571_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|3473567_3473756_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001586950.1|3473766_3474621_-	rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_024187413.1|3475035_3475473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586951.1|3475450_3475771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|3475793_3476012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|3476171_3476327_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000362153.1|3476592_3477012_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000391950.1|3477112_3477394_+	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000693943.1|3477377_3477803_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|3477825_3478788_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_001151131.1|3478828_3479251_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	76.8	3.1e-54
WP_001275732.1|3479247_3479742_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.5	2.9e-67
WP_001300192.1|3479728_3479914_+	ead/Ea22-like family protein	NA	NA	NA	NA	NA
WP_001586955.1|3479910_3480354_+	hypothetical protein	NA	A0A076G839	Escherichia_phage	65.1	2.1e-32
WP_001289900.1|3480350_3481100_+	ead/Ea22-like family protein	NA	Q1MVF9	Enterobacteria_phage	89.1	1.8e-108
WP_000224227.1|3482022_3482286_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000761439.1|3482360_3482774_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	100.0	5.4e-59
WP_001224662.1|3482867_3483050_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_011076332.1|3483663_3483882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|3484140_3484296_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001341382.1|3484463_3484742_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001586958.1|3484743_3485799_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	8.9e-90
WP_000140014.1|3485799_3486180_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001586959.1|3486176_3486998_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	2.9e-80
WP_000917767.1|3487224_3487422_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_001586960.1|3487572_3488622_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.1	1.7e-197
WP_106104550.1|3488919_3489006_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001333559.1|3489494_3489707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586961.1|3489777_3490113_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	4.0e-44
WP_001615156.1|3490373_3492230_+	SASA family carbohydrate esterase	NA	H6WZJ9	Escherichia_phage	89.3	0.0e+00
WP_000284510.1|3492380_3492596_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|3492600_3492945_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369851.1|3492910_3493183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|3493288_3493822_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_032140280.1|3494376_3494463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|3494684_3494870_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000736383.1|3494955_3495180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|3495378_3495579_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|3495620_3495986_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958372.1|3496275_3496839_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.5	3.3e-83
WP_001339613.1|3496835_3498497_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.1	0.0e+00
WP_000173030.1|3498560_3500498_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|3500542_3500764_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000174402.1|3501572_3503072_+|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_000065240.1|3503068_3503824_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000125990.1|3505707_3506034_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|3506043_3506394_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573362.1|3506390_3506837_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_000133388.1|3506833_3507178_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|3507242_3507959_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|3507973_3508348_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|3508443_3508653_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001586965.1|3508700_3511943_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	93.2	0.0e+00
WP_000807924.1|3511935_3512277_+|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	96.5	2.4e-60
WP_001375867.1|3512276_3512975_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.1	4.2e-128
WP_000194703.1|3512985_3513729_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	2.9e-148
WP_061089814.1|3513674_3514307_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_078175059.1|3514649_3518039_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	87.1	0.0e+00
3516143:3516157	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
WP_001228252.1|3518106_3518706_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_001586968.1|3518770_3521149_+|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	4.8e-184
WP_000654143.1|3521148_3521430_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001615176.1|3521439_3522480_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.0	9.3e-124
WP_000355601.1|3522522_3522816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000240999.1|3523009_3523678_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937498.1|3523734_3524004_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	77.8	2.7e-19
WP_001079499.1|3524777_3525284_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056488.1|3525329_3525830_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|3525915_3526095_-	general stress protein	NA	NA	NA	NA	NA
WP_001586972.1|3526475_3527282_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|3527281_3528475_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001586974.1|3528486_3529845_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_001586975.1|3529848_3531444_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	3.8e-52
WP_001194627.1|3531443_3533006_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|3533097_3533142_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285692.1|3533279_3534161_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|3534157_3534778_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001309470.1|3534805_3536701_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|3536911_3537787_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278887.1|3537826_3538417_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559257.1|3538413_3539172_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	9.7e-06
WP_000422053.1|3539391_3540441_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	32.0	3.5e-22
>prophage 6
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	3615989	3667648	5056072	tail,tRNA,integrase,lysis	Escherichia_phage(54.35%)	56	3610374:3610389	3649718:3649733
3610374:3610389	attL	ATCGCAGCAATAAAAA	NA	NA	NA	NA
WP_001306539.1|3615989_3617222_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|3617476_3618460_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123754.1|3618937_3620311_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	2.5e-52
WP_001157407.1|3620439_3621375_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040858.1|3621426_3622662_-|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	98.5	1.6e-239
WP_000079604.1|3622663_3622879_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|3622957_3623167_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|3623159_3623354_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|3623410_3624220_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_001586992.1|3624212_3626813_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	1.8e-248
WP_000632297.1|3626914_3627190_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|3627264_3627435_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|3627434_3627656_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|3628097_3628586_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|3628582_3628738_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|3628748_3628928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|3629170_3629590_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|3629669_3629924_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693800.1|3629920_3630343_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.1	5.0e-68
WP_000788982.1|3631216_3631963_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	1.3e-114
WP_000450652.1|3631985_3632711_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.8	6.1e-82
WP_001586994.1|3632727_3633150_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	82.7	6.7e-57
WP_001586995.1|3633310_3633829_+	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	57.4	5.8e-34
WP_001586996.1|3633859_3635293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586997.1|3635264_3636323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001586998.1|3636595_3636808_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	59.7	1.9e-12
WP_000940324.1|3637271_3637871_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	2.0e-107
WP_001586999.1|3637870_3638161_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	6.9e-45
WP_000640136.1|3638157_3638700_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_001587000.1|3639986_3640202_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	97.2	1.3e-32
WP_001135296.1|3640201_3640699_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_001228696.1|3640915_3641101_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097893.1|3641297_3642755_+	potassium transporter TrkG	NA	NA	NA	NA	NA
WP_001291102.1|3642892_3643681_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.9	7.4e-49
WP_001204032.1|3643673_3644606_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.9e-83
WP_000126788.1|3644583_3644793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089446.1|3644796_3645891_+	hypothetical protein	NA	A0A0U2RXW9	Escherichia_phage	80.2	4.5e-113
WP_001587002.1|3645871_3647173_+	hypothetical protein	NA	A0A1B1P9C9	Acinetobacter_phage	59.6	8.8e-148
WP_000763709.1|3647175_3648582_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	68.8	8.8e-186
WP_001317036.1|3648565_3649678_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.8	6.0e-113
WP_000770038.1|3649782_3650547_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	66.5	3.9e-87
3649718:3649733	attR	TTTTTATTGCTGCGAT	NA	NA	NA	NA
WP_000918483.1|3650645_3651785_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	3.3e-159
WP_000634214.1|3652007_3652403_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524262.1|3652402_3652786_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	40.2	4.4e-15
WP_001029815.1|3652786_3653167_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000144678.1|3653163_3653556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000094292.1|3653582_3654545_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	39.2	4.5e-56
WP_012565075.1|3654695_3655055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001587006.1|3655528_3658762_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	34.5	8.7e-112
WP_000024051.1|3658754_3659093_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001578255.1|3659092_3659791_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.4	1.9e-128
WP_021520058.1|3659796_3660540_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	95.5	4.0e-145
WP_000090934.1|3660476_3661085_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.1	4.2e-100
WP_001615196.1|3661145_3664541_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.2	0.0e+00
WP_001228247.1|3664608_3665208_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	5.4e-100
WP_078175068.1|3665272_3667648_+|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	2.4e-167
>prophage 7
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	3854538	3914764	5056072	tail,protease,transposase,holin,terminase,integrase,portal	Enterobacteria_phage(42.0%)	72	3887242:3887258	3919458:3919474
WP_001587075.1|3854538_3855999_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
WP_000347484.1|3856088_3857372_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|3857975_3858089_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|3858157_3858391_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_001587076.1|3858707_3859298_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.3	4.7e-24
WP_000355609.1|3859525_3859819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235980.1|3859829_3860534_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654160.1|3860543_3860825_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	5.9e-17
WP_001615228.1|3860824_3863230_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	69.8	1.3e-160
WP_000065240.1|3863831_3864587_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000174402.1|3864583_3866083_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_021520225.1|3866377_3869773_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	90.6	0.0e+00
WP_000741589.1|3869833_3870481_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	1.9e-111
WP_032140186.1|3870378_3871122_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	3.3e-147
WP_001152385.1|3871127_3871826_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	100.0	6.0e-135
WP_000447253.1|3871835_3872165_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001587081.1|3872164_3875230_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.0	0.0e+00
WP_001161009.1|3875201_3875531_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001366333.1|3875539_3875926_-|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	96.9	7.5e-63
WP_001587082.1|3875986_3876730_-|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	96.8	1.1e-129
WP_001079412.1|3876740_3877142_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	97.7	1.2e-71
WP_000677119.1|3877138_3877729_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	79.6	2.1e-80
WP_001283153.1|3877740_3878016_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097055.1|3878008_3878332_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	99.1	2.5e-51
WP_001136590.1|3878418_3880446_-|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.5	0.0e+00
WP_000985923.1|3880390_3881899_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.4	1.1e-287
WP_001072975.1|3881898_3882111_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001587083.1|3882107_3884207_-|terminase	phage terminase large subunit family protein	terminase	A5LH27	Enterobacteria_phage	99.3	0.0e+00
WP_077633327.1|3884215_3884755_-	DUF1441 family protein	NA	A5LH26	Enterobacteria_phage	99.4	4.0e-94
WP_000548593.1|3885305_3885512_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_001019207.1|3885805_3885979_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_072148339.1|3886151_3886307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071528545.1|3886454_3886643_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|3886653_3886866_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071778.1|3887229_3887727_-	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
3887242:3887258	attL	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
WP_001101173.1|3887723_3888257_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.8	1.4e-96
WP_001557934.1|3888370_3888631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000189900.1|3888578_3889130_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	51.1	1.0e-36
WP_000839588.1|3889134_3889350_-|holin	holin	holin	A5LH82	Enterobacteria_phage	91.5	1.2e-30
WP_001587085.1|3889540_3890254_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001587086.1|3890660_3891620_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_001587087.1|3891812_3892337_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	53.5	1.2e-47
WP_001587088.1|3892492_3892870_-	antitermination protein Q	NA	Q777W5	Enterobacteria_phage	81.7	1.2e-52
WP_001587089.1|3892887_3893937_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.6	9.7e-113
WP_015912508.1|3893938_3894217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062344.1|3894323_3895469_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	30.1	2.8e-41
WP_001180546.1|3895465_3896080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001587090.1|3896246_3896459_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-28
WP_001557860.1|3896503_3896611_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_001557861.1|3897025_3897274_+	hypothetical protein	NA	E5E3R2	Burkholderia_phage	52.6	1.2e-16
WP_001557863.1|3897427_3897655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557864.1|3897895_3898321_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.6	6.6e-60
WP_001557865.1|3898361_3899432_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.1	2.3e-61
WP_000693892.1|3899503_3899929_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747949.1|3899912_3900155_-	transcriptional regulator	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3900546_3900885_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000379597.1|3901177_3901333_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.2e-06
WP_000344950.1|3901334_3901910_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854561.1|3902396_3902585_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3902581_3902773_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001615240.1|3902866_3905338_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	55.6	9.4e-58
WP_001296941.1|3905425_3905662_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000876982.1|3905696_3906977_+|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	1.5e-155
WP_001389342.1|3906978_3907107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836035.1|3907164_3908184_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	5.7e-17
WP_001295394.1|3908195_3909410_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_001314753.1|3909615_3909942_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.2e-23
WP_000705205.1|3910076_3910418_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138584.1|3910452_3911013_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001445899.1|3911015_3911726_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001295396.1|3911833_3912139_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041646.1|3912337_3914764_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	1.3e-213
3919458:3919474	attR	TTTTTTATCTCTTAAAG	NA	NA	NA	NA
>prophage 8
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	4508199	4517642	5056072		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292789.1|4508199_4509336_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.7	1.3e-163
WP_001309586.1|4509332_4511333_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.8	0.0e+00
WP_001295429.1|4511457_4511919_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|4511960_4512431_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|4512477_4513197_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|4513193_4514879_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|4515100_4515832_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|4515891_4515999_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|4515979_4516711_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569372.1|4516715_4517642_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.3	1.1e-22
>prophage 9
NZ_CP018957	Escherichia coli strain Ecol_316 chromosome, complete genome	5056072	4764436	4777358	5056072	integrase	Escherichia_phage(83.33%)	6	4774711:4774725	4784536:4784550
WP_000368134.1|4764436_4765369_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	2.7e-167
WP_000100045.1|4765956_4766487_-	OmpH family outer membrane protein	NA	A0A2L1IV11	Escherichia_phage	96.6	2.8e-84
WP_001587278.1|4766534_4774448_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV38	Escherichia_phage	95.5	0.0e+00
WP_000243047.1|4774472_4775093_-	LuxR family transcriptional regulator	NA	A0A2L1IV08	Escherichia_phage	99.5	3.5e-118
4774711:4774725	attL	TTTTTTTTGCACCTC	NA	NA	NA	NA
WP_001181151.1|4775410_4776040_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	99.0	4.1e-119
WP_001224626.1|4776788_4777358_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	52.2	7.0e-49
4784536:4784550	attR	GAGGTGCAAAAAAAA	NA	NA	NA	NA
>prophage 1
NZ_CP018955	Escherichia coli strain Ecol_316 plasmid pEC316_2, complete sequence	101186	24018	71712	101186	transposase	Escherichia_phage(20.0%)	47	NA	NA
WP_001067855.1|24018_24723_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050482665.1|25746_26265_+	MltR family transcriptional regulator	NA	NA	NA	NA	NA
WP_032427578.1|26270_26486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|28460_29165_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004197500.1|29495_32858_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_004197497.1|32857_35998_-	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	28.2	3.6e-30
WP_078174833.1|36052_39016_-	DEAD/DEAH box helicase	NA	A0A2H4J643	uncultured_Caudovirales_phage	51.7	3.0e-276
WP_001568063.1|39002_39248_-	helix-turn-helix transcriptional regulator	NA	S5MTW4	Brevibacillus_phage	43.5	7.4e-08
WP_040063370.1|39773_40925_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.7	3.7e-41
WP_085949440.1|42132_43502_-|transposase	IS3-like element ISKpn8 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	95.5	9.4e-108
WP_001568060.1|43705_44080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568059.1|44135_44462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568058.1|44458_45187_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_020804497.1|45183_45615_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_009310025.1|45659_47717_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	25.4	2.6e-21
WP_009310026.1|47786_48035_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_020804498.1|48083_48626_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	76.7	4.6e-50
WP_009310029.1|49456_50020_-	methyltransferase	NA	A0A2I7RHK4	Vibrio_phage	34.3	4.4e-19
WP_009310030.1|50067_51423_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_009310031.1|51474_51705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568050.1|51796_52024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032425556.1|52042_52471_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568049.1|52703_53024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977779.1|53058_53313_-	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	48.8	4.0e-12
WP_023332910.1|53500_53692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023332911.1|53734_54241_-	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	32.2	5.3e-08
WP_013023797.1|54283_54949_-	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_032425557.1|54963_55320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001568044.1|55392_56160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029497570.1|56213_56633_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001568042.1|56642_56864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011977792.1|56863_57565_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	2.4e-27
WP_162138571.1|57766_57850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194745.1|57950_58286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004194746.1|58282_58516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162780336.1|58569_58863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162780337.1|58888_59017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009309993.1|59123_59354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078174835.1|59417_60089_-	Mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568038.1|60091_61063_-	hypothetical protein	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_023332914.1|61311_62799_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	34.1	1.1e-29
WP_004197746.1|63204_63636_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	7.9e-29
WP_004197749.1|65510_66407_+	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	2.5e-69
WP_004152349.1|66728_67934_+	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004197750.1|67930_68905_+	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.6	8.1e-106
WP_072269220.1|69423_70392_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.6	1.7e-180
WP_001101446.1|70686_71712_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP018954	Escherichia coli strain Ecol_316 plasmid pEC316_3, complete sequence	97654	7746	78257	97654	integrase,protease,transposase	Macacine_betaherpesvirus(38.46%)	58	1343:1402	78374:78441
1343:1402	attL	GTCAGGAGCTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGA	NA	NA	NA	NA
WP_000616807.1|7746_8400_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_013023861.1|9613_9826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024194459.1|13565_15275_-	type IV conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001542066.1|16996_17455_-	adenine-specific DNA-methyltransferase	NA	A0A2I7RE86	Vibrio_phage	35.0	3.0e-18
WP_001348615.1|17839_18742_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|19608_20580_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|20579_21746_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|22333_23089_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|23862_24669_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|24669_24975_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|24976_25195_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000246635.1|25902_26898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991831.1|26901_27834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586223.1|28126_28312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024187432.1|28312_29215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586225.1|29216_30086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001586226.1|30142_31708_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_001586228.1|31994_32507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545985.1|32540_33674_-	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000065240.1|35126_35882_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000174402.1|35878_37378_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_001586230.1|37931_40553_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.7	5.9e-18
WP_001261274.1|40751_40982_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000348883.1|41568_42099_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001275013.1|42102_42372_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_123002471.1|43259_44249_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.7	2.5e-102
WP_001586233.1|44571_45312_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	56.9	5.4e-25
WP_032355874.1|45432_45558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072355.1|46757_47927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001105060.1|48122_48416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421272.1|48521_48797_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001387467.1|48796_49081_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000562172.1|49685_50438_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001022265.1|50483_51449_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_000710783.1|51481_51862_-	reactive intermediate/imine deaminase	NA	NA	NA	NA	NA
WP_001077068.1|51886_52777_-	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_000796505.1|53009_53204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000338039.1|53748_54627_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_001271561.1|54616_55504_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_000922702.1|55514_56339_+	phosphodiesterase	NA	NA	NA	NA	NA
WP_000950177.1|56344_57418_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.7	2.6e-28
WP_000476108.1|57410_58721_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000874189.1|62054_62540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267177.1|62564_63050_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|63036_63732_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729220.1|63736_64867_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|64856_66140_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|66142_67522_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|67625_68153_-	iron transporter	NA	NA	NA	NA	NA
WP_000118029.1|68193_70080_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|70426_71242_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000949452.1|71424_71931_-	protein disulfide oxidoreductase	NA	NA	NA	NA	NA
WP_000449408.1|71920_72079_-	copper-sensitivity suppressor C	NA	NA	NA	NA	NA
WP_001067855.1|73449_74154_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000219391.1|74275_75181_+	Mph(A) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000004159.1|75177_76416_+	MFS transporter	NA	NA	NA	NA	NA
WP_001137892.1|76415_77000_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001389365.1|77492_78257_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
78374:78441	attR	GTCAGGAGCTGGCTGCACAACAGCCATTACGCCCAATCAACTGGTGCAGTCGTCTTCTGAAAATGACA	NA	NA	NA	NA
>prophage 1
NZ_CP018956	Escherichia coli strain Ecol_316 plasmid pEC316_KPC, complete sequence	216226	0	37896	216226	lysis,holin,tail,capsid,integrase,head,transposase,plate,portal,terminase	Escherichia_phage(55.0%)	58	22170:22185	26122:26137
WP_001251408.1|0_519_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286737.1|531_1722_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	1.8e-224
WP_000905113.1|1781_2375_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	95.9	2.5e-102
WP_001322807.1|2405_2795_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	52.9	5.5e-13
WP_001106830.1|2816_3257_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	71.0	1.5e-54
WP_001030526.1|3228_3831_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	2.9e-93
WP_032413564.1|3830_5165_-|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.7	1.4e-177
WP_001285340.1|5161_5773_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_032413563.1|5765_6674_-|plate	baseplate assembly protein	plate	Q858V6	Yersinia_virus	99.7	3.4e-162
WP_000127164.1|6678_7026_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_032413562.1|7022_7658_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	97.6	3.2e-111
WP_032413561.1|7724_8177_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	2.6e-75
WP_032413560.1|8169_8637_-|tail	phage tail protein	tail	A0A0F7LDF5	Escherichia_phage	97.4	6.9e-79
WP_072146842.1|8599_8773_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	93.0	2.6e-23
WP_000040630.1|8744_9170_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	95.7	2.3e-65
WP_021563761.1|9157_9583_-	hypothetical protein	NA	M1SV74	Escherichia_phage	97.9	1.2e-58
WP_001144101.1|9597_10095_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|10094_10376_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|10379_10583_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_032413559.1|10582_11092_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	99.4	2.5e-90
WP_032413558.1|11191_11935_-|terminase	terminase endonuclease subunit	terminase	Q94MH8	Enterobacteria_phage	99.2	6.0e-125
WP_001248583.1|11938_13012_-|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	100.0	6.7e-202
WP_001607695.1|13070_13925_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0F7LA11	Escherichia_phage	100.0	1.7e-139
WP_032413555.1|14098_15871_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.3	0.0e+00
WP_032413553.1|15870_16905_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.4	1.6e-200
WP_000725496.1|17299_18844_+	RNA-directed DNA polymerase	NA	A0A0F7LCK9	Escherichia_phage	99.0	4.7e-289
WP_032413551.1|19331_21608_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	99.5	0.0e+00
WP_000027673.1|21597_21873_-	DUF5405 family protein	NA	S4TP00	Salmonella_phage	97.8	1.9e-44
WP_001113264.1|21869_22094_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_001277898.1|22096_22396_-	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
22170:22185	attL	AGTTCATCCACTGAGG	NA	NA	NA	NA
WP_000557703.1|22395_22620_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|22683_23184_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001081582.1|23361_23637_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|23758_24058_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|24173_25187_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_050485594.1|25249_25636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000039129.1|25632_25980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342201.1|25991_26663_-	hypothetical protein	NA	NA	NA	NA	NA
26122:26137	attR	AGTTCATCCACTGAGG	NA	NA	NA	NA
WP_014342199.1|27193_27853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000277953.1|27809_28139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000454742.1|28144_28291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001280522.1|28294_29758_-	AAA family ATPase	NA	U5XGM6	Phormidium_phage	38.2	2.4e-45
WP_000434071.1|29831_30764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342198.1|30958_31129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000062185.1|31325_31823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001273096.1|31825_32314_-	DUF1643 domain-containing protein	NA	B5WZV8	Pseudomonas_phage	61.7	1.7e-51
WP_000683476.1|32410_32746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001281821.1|32760_33231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000516916.1|33223_33595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343597.1|33605_33800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014342197.1|33827_34019_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001061574.1|34140_34689_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000270043.1|34851_35202_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000124640.1|35206_35509_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_001239997.1|35535_35829_-	chromosome segregation protein ParM	NA	NA	NA	NA	NA
WP_001043047.1|35916_36189_-	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	59.6	4.2e-20
WP_032413569.1|36246_36792_-	nuclease	NA	O64020	Bacillus_phage	37.0	1.4e-09
WP_012569499.1|36915_37896_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.8	6.8e-185
>prophage 2
NZ_CP018956	Escherichia coli strain Ecol_316 plasmid pEC316_KPC, complete sequence	216226	130062	170185	216226	transposase,integrase	Escherichia_phage(33.33%)	56	131587:131602	161805:161820
WP_000255956.1|130062_131085_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_001297096.1|131084_131864_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	99.6	4.5e-139
131587:131602	attL	TCATCATTGATGAAAT	NA	NA	NA	NA
WP_001102700.1|132107_132332_+	2Fe-2S ferredoxin-like protein	NA	NA	NA	NA	NA
WP_000026577.1|132393_132783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176699.1|132772_133225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002210529.1|133302_133545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000651508.1|133562_133754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001337696.1|133798_134176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|134350_135463_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001077335.1|135582_135969_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001032042.1|136075_136222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000595210.1|136426_137278_-	hypothetical protein	NA	A0A219UQS0	Bacillus_phage	29.4	3.6e-09
WP_000064432.1|137352_137910_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000260293.1|137983_138202_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000184110.1|138215_138485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000071870.1|138477_139083_-	5'-deoxynucleotidase	NA	NA	NA	NA	NA
WP_000050848.1|139154_139358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001187970.1|139559_142013_-	phosphoadenosine phosphosulfate reductase	NA	NA	NA	NA	NA
WP_000042274.1|142100_142487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001093868.1|142719_143274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015058950.1|143347_143824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201432.1|143839_145465_-	DNA cytosine methyltransferase	NA	A0A0N9SK84	Staphylococcus_phage	25.8	1.2e-05
WP_000410925.1|145542_145845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000209093.1|145922_146267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001300563.1|146521_147634_+|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_000122923.1|147928_149656_+	hypothetical protein	NA	A0A0P0ZFY3	Escherichia_phage	32.6	9.9e-14
WP_000268337.1|149642_149921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000714162.1|149993_150233_+	permease	NA	NA	NA	NA	NA
WP_000338626.1|150242_150359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868821.1|150479_150854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988732.1|150967_151693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014342218.1|151667_151871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162780338.1|151933_156088_+	type IV secretion protein Rhs	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	53.4	5.7e-23
WP_000787563.1|156084_156357_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_000750746.1|156361_156604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011872911.1|156651_156951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000791469.1|157117_157570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000278322.1|157585_158188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000575657.1|158449_158731_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000949433.1|159029_159566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000543934.1|159568_160579_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0K0N6I5	Gordonia_phage	31.9	3.1e-07
WP_000997323.1|160583_161453_+	3'-5' exonuclease	NA	A0A1S6L012	Salmonella_phage	35.1	3.5e-23
WP_000139718.1|161449_161932_+	hypothetical protein	NA	NA	NA	NA	NA
161805:161820	attR	ATTTCATCAATGATGA	NA	NA	NA	NA
WP_001166628.1|161921_162377_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294656.1|162448_162814_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_000732275.1|162829_163105_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_000522996.1|163132_163558_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000209296.1|163596_165282_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.8e-39
WP_001277466.1|165299_165665_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_001087807.1|165661_165898_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001446012.1|165881_166001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000993245.1|165963_166176_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|166363_167068_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|167138_167999_-	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001217881.1|168181_168739_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_000427620.1|169180_170185_-|transposase	IS110-like element IS4321 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP018956	Escherichia coli strain Ecol_316 plasmid pEC316_KPC, complete sequence	216226	188835	197830	216226	transposase	Escherichia_phage(28.57%)	10	NA	NA
WP_004152397.1|188835_190155_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|190404_191286_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|191417_192197_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|192193_193219_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_000703827.1|193931_194204_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|194252_195434_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|195437_196223_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_014342215.1|196250_196382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000338945.1|196396_196708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|197014_197830_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
>prophage 4
NZ_CP018956	Escherichia coli strain Ecol_316 plasmid pEC316_KPC, complete sequence	216226	208418	216170	216226	tail	Escherichia_phage(71.43%)	10	NA	NA
WP_000268395.1|208418_209357_-	hypothetical protein	NA	A0A2P9HXK7	Yersinia_phage	50.2	1.5e-69
WP_000435224.1|209473_210019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001256128.1|210021_210591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000004673.1|210602_211166_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000468308.1|211345_211564_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_032413567.1|211645_212809_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.2	3.1e-205
WP_032413566.1|212808_213288_-|tail	phage tail protein	tail	O64315	Escherichia_phage	99.4	1.5e-84
WP_032413565.1|213302_215750_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|215742_215862_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001461862.1|215894_216170_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	1.3e-40
