The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	372145	405164	5259387	integrase,portal,tail,lysis,terminase,capsid,head,plate	Salmonella_phage(80.95%)	46	371672:371697	405230:405255
371672:371697	attL	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
WP_000290938.1|372145_373177_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	1.9e-105
WP_001513672.1|373365_373557_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	65.9	6.8e-09
WP_001047320.1|373572_374142_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.9	2.9e-39
WP_001247707.1|374267_374489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460891.1|374521_375031_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.2	1.3e-86
WP_000956182.1|375038_375239_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001504055.1|375202_375544_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	97.3	5.1e-55
WP_033813113.1|375611_375845_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	2.4e-32
WP_000752614.1|375844_376072_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	7.8e-36
WP_078207274.1|376068_376926_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.5	2.7e-161
WP_078207275.1|376922_379337_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	97.9	0.0e+00
WP_001154434.1|379490_379679_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|379689_379923_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000133007.1|380238_381399_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_078207276.1|381403_382183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078207277.1|382179_383211_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.7	2.0e-171
WP_078207278.1|383210_384977_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.5	0.0e+00
WP_000216248.1|385119_385953_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	91.0	8.2e-123
WP_000742511.1|385969_387028_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_001568687.1|387031_387682_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	9.6e-111
WP_000673500.1|387777_388242_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000868175.1|388241_388445_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|388448_388664_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_001341072.1|388683_389157_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.0	3.7e-80
WP_000730948.1|389158_389536_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	39.2	1.1e-15
WP_078207279.1|389532_389961_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	74.5	5.4e-46
WP_104772788.1|390056_390488_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.7	2.9e-71
WP_001748177.1|390480_390927_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	83.8	1.1e-62
WP_078207280.1|390971_391787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001748179.1|391894_392473_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	3.6e-93
WP_000177588.1|392469_392829_+|plate	baseplate assembly protein	plate	A0A1S6KZZ4	Salmonella_phage	84.9	8.0e-51
WP_000268301.1|392815_393724_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	91.1	4.1e-144
WP_001086820.1|393716_394322_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	5.2e-111
WP_078207281.1|394318_395701_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	76.4	2.3e-154
WP_078207282.1|395700_396144_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	62.4	1.5e-46
WP_078207283.1|396115_396709_-|tail	phage tail protein	tail	Q9MCR5	Enterobacteria_phage	63.4	1.3e-58
WP_078207284.1|396708_397278_-|tail	phage tail protein	tail	K7PH60	Enterobacterial_phage	58.1	1.4e-44
WP_024244557.1|397308_397875_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	2.9e-87
WP_000046146.1|398017_399190_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	7.8e-204
WP_001207660.1|399199_399715_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	2.1e-89
WP_001281007.1|399769_400072_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	1.6e-39
WP_000763311.1|400086_400206_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_078207285.1|400198_403276_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.1	0.0e+00
WP_000980391.1|403272_403758_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_001522728.1|403754_404855_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	88.0	4.5e-177
WP_000972391.1|404945_405164_+	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
405230:405255	attR	TAAATTTCAGGCAACAAAAAACCCAT	NA	NA	NA	NA
>prophage 2
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	439852	499597	5259387	integrase,tail,portal,holin,tRNA,terminase,capsid,protease,head,plate	Enterobacteria_phage(76.0%)	62	457799:457818	496309:496328
WP_000520781.1|439852_440173_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|440203_442480_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|443164_443383_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|443667_444372_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|444413_446135_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001043561.1|446135_447902_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|448024_448990_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|449533_450028_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|450162_454269_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|454427_455039_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|455049_456393_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|456483_457776_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
457799:457818	attL	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000078916.1|458081_458222_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|458413_458674_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|458714_459824_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|459981_461166_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|461165_461678_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|461733_462108_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|462116_462272_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|462258_465066_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|465078_465567_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|465595_466195_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000071703.1|470142_470673_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|470665_471562_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|471565_471916_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|471912_472494_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|472490_473126_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|473118_473586_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|473609_475487_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|475625_476021_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|476017_476410_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|476406_476730_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|476732_476933_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|476932_477427_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|477528_478329_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|478374_479427_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|479450_480287_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|480441_482193_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|482192_483239_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|483253_483778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|484501_484999_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|485038_485881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|485964_486279_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|486283_487243_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|487319_490142_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|490148_490514_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000013455.1|490586_490817_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
WP_000104290.1|491139_491439_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|491435_491702_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|491698_491902_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|491925_492336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|492429_492543_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|492539_492782_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|492793_493072_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|493082_493433_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|493570_493762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|493768_494191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|494195_494717_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|494821_495163_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|495232_496225_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|496524_498969_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
496309:496328	attR	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000213098.1|498979_499597_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 3
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	509995	549497	5259387	integrase,tail,transposase,head,plate	Burkholderia_virus(45.0%)	57	535095:535110	554416:554431
WP_000057158.1|509995_511084_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|511154_512438_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|512693_513266_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_023142129.1|513337_513799_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_000072165.1|513805_514420_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_001486917.1|514419_514902_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	44.7	7.5e-28
WP_023363137.1|514942_516190_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|516192_516771_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|516763_517867_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|517857_518205_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|518259_518856_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|518852_520007_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|519994_520210_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|520206_521091_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|521090_524042_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|524117_524276_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|524199_524535_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|524632_524914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|524916_525438_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|525437_526865_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|526854_527109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|527105_527570_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|527569_528016_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|528017_528356_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|528365_529319_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|529333_530449_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|530663_531122_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|531124_531946_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|531926_533423_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000167500.1|533422_535018_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_000124060.1|535014_535560_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
535095:535110	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|535559_535871_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|535870_536197_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|536193_536844_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|536827_537568_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|537570_537921_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|538051_538780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|538755_539160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|539158_539374_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|539564_540329_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|540445_540802_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|540895_541084_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|541136_541445_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|541455_542376_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|542375_542693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|542708_544478_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|544488_545655_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|545657_545927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|545954_546485_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|546773_547046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|547055_547352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|547366_547582_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|547578_548262_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|548258_548489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|548478_548685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|548686_549136_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|549107_549497_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
554416:554431	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 4
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	760823	806531	5259387	integrase,tail,portal,holin,tRNA,lysis,terminase,capsid,head	Enterobacteria_phage(57.14%)	57	759141:759155	787735:787749
759141:759155	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|760823_761930_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|761983_762445_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|762454_763108_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|763279_764530_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|764643_765786_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|765775_766012_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|766151_766391_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|766374_766701_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|766700_766922_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|767020_767302_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|767312_767504_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|767476_767659_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|767655_768336_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|768332_769118_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|769123_769420_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|769495_769702_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|770297_770987_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|771091_771322_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|771391_771931_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|772017_772947_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|772943_773645_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|773894_778160_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|778196_779240_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|779589_779691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|779687_780143_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|780142_780313_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|780305_780596_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|780592_780955_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|780951_781092_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|781088_781778_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|782099_782405_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|782391_782868_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|783084_783267_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|783357_783651_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|784131_784458_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|784664_784847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|785410_785956_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|785930_787856_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
787735:787749	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|787852_788059_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|788055_789657_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|789637_790957_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|790966_791299_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|791354_792380_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|792421_792820_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|792831_793185_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000683150.1|793770_794166_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|794173_794914_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|794929_795352_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|795333_795768_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|795760_798322_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|798318_798648_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|798647_799346_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|799350_800094_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|800030_800633_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|800693_804176_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|804234_806256_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|806252_806531_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 5
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	945745	1015460	5259387	integrase,portal,tail,holin,transposase,terminase,capsid,protease,head	Stx2-converting_phage(25.0%)	79	941919:941933	947829:947843
941919:941933	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|945745_946876_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|946853_947102_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|947166_949638_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
947829:947843	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|949730_949922_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|949918_950107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023142248.1|950456_950624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|950672_950891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|951050_951206_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|951478_952195_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|952244_952460_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|952456_952882_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|952904_953867_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|953873_954620_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|954641_955412_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|955427_955853_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|956027_956693_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|956873_957086_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|957253_957526_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|957527_958583_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|958583_958964_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|958960_959782_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|960008_960206_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|960357_961407_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|962208_962340_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|962620_962956_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|963216_965070_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|965220_965436_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|965440_965785_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|965750_966023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|966128_966662_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|967216_967303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|967524_967710_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|967795_968011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|968209_968410_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|968451_968817_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|969107_969671_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|969667_971329_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|971392_973330_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|973374_973596_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|973541_976127_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|976123_976450_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|976459_976810_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|976806_977253_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|977249_977594_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|977660_978377_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000710949.1|978391_978766_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001513217.1|978861_979071_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|979118_982361_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|982353_982695_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|982694_983393_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|983403_984147_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|984092_984725_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|985067_988541_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|989181_990723_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|990737_991484_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_071550361.1|991945_994852_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001164137.1|994867_995395_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|995425_995959_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|995960_996746_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|996973_997156_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|997354_998023_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|998079_998349_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|998760_999318_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|999314_999590_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|999965_1000772_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|1000771_1001965_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|1001976_1003335_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|1003338_1004934_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|1004933_1006496_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1006587_1006632_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|1006769_1007651_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1007647_1008268_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|1008295_1010191_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1010403_1011279_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|1011484_1012471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|1012480_1012789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|1012845_1013436_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|1013432_1014191_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|1014410_1015460_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 6
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	1498463	1581141	5259387	integrase,tail,portal,holin,tRNA,transposase,terminase,capsid,plate	Escherichia_phage(23.26%)	98	1538591:1538650	1581203:1581327
WP_099156422.1|1498463_1499812_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|1499921_1500932_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|1500940_1501552_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|1501690_1501756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|1501826_1502429_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|1502430_1502952_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|1502986_1503727_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|1503755_1504208_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|1504200_1505973_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|1506282_1506849_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|1506845_1507664_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|1507716_1508112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|1508152_1508896_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|1508892_1509864_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|1509899_1512329_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_001214293.1|1512353_1513454_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|1513841_1514588_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|1514601_1515168_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|1515383_1517117_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|1517169_1517562_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|1517561_1519640_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|1519632_1520781_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|1520969_1521614_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|1521624_1522014_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|1522028_1523078_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|1523080_1523941_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|1524231_1525893_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|1526037_1526541_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|1526561_1528526_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|1528530_1529457_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|1529453_1530341_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|1530467_1531046_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|1531048_1531399_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|1532178_1532607_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_000179469.1|1533779_1534283_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|1534360_1534612_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|1534726_1534813_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|1535076_1535400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|1535571_1536069_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|1536106_1536346_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|1536536_1537748_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|1537798_1538464_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1538591:1538650	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|1538935_1539355_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|1540569_1540794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|1540955_1541345_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|1541380_1543021_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|1543129_1543411_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|1543423_1543936_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|1543953_1545456_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|1545452_1545842_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|1545841_1547026_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|1547018_1547645_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|1547647_1548568_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|1548564_1548906_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|1548908_1549811_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|1549791_1550328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1550324_1551005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|1551036_1551417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|1551413_1551833_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|1551867_1552902_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|1552960_1553290_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|1553289_1554597_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|1554596_1556171_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|1556167_1556401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|1556400_1558263_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|1558249_1558816_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|1559184_1559430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|1559489_1559684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|1559691_1560171_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|1560170_1560443_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|1560442_1560826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|1560938_1561610_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|1561609_1561903_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|1561899_1562496_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|1562573_1562753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1562904_1563546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|1563789_1564023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1564421_1564910_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|1564919_1565525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000536231.1|1565987_1566686_-	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001237642.1|1567874_1568798_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|1568972_1569761_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|1570442_1570667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1570663_1570975_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|1570971_1571208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|1571209_1571620_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609322.1|1571658_1573074_-	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_001023813.1|1573063_1573819_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|1573815_1574040_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|1574079_1574556_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|1574614_1574845_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|1574943_1575357_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|1576367_1576688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|1576718_1578935_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|1578931_1579501_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|1579500_1579683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|1579892_1580156_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|1580124_1581141_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
1581203:1581327	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 7
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	1599385	1677379	5259387	integrase,tail,portal,holin,transposase,terminase,capsid,protease,head	Escherichia_phage(38.18%)	98	1656463:1656477	1678068:1678082
WP_001347174.1|1599385_1599910_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|1600066_1600864_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|1600873_1601425_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|1601593_1601926_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|1602269_1602584_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|1602798_1604457_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|1604449_1605445_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|1605437_1606124_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_044068544.1|1606123_1607497_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|1607515_1607959_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|1607955_1609083_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|1609187_1609652_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|1609656_1610661_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|1610657_1611071_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|1611073_1611439_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|1611438_1612176_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|1612185_1612455_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|1612463_1613249_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|1613538_1614162_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|1614205_1614448_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|1614556_1614784_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|1615079_1615895_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|1615891_1617586_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|1617756_1617939_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|1618017_1618935_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|1619107_1620028_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|1620016_1620487_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|1620467_1621886_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|1621952_1622648_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|1622687_1623053_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|1623618_1624734_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|1625326_1626178_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|1626285_1627644_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_001347103.1|1627643_1628315_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|1628447_1628861_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|1628969_1629974_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|1629974_1630610_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|1630693_1632042_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|1632302_1632953_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_016240857.1|1634033_1634321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204582.1|1634330_1634609_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_054575809.1|1634605_1636669_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_021571591.1|1636820_1637420_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.0	7.5e-102
WP_054575808.1|1637487_1641186_-	DUF1983 domain-containing protein	NA	A5LH43	Enterobacteria_phage	74.7	0.0e+00
WP_001445893.1|1641246_1641894_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	98.1	2.7e-113
WP_000194743.1|1641791_1642535_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_001152453.1|1642539_1643238_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	8.1e-132
WP_072189217.1|1643237_1643594_-|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	3.7e-40
WP_032180049.1|1643571_1646799_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.6	0.0e+00
WP_077628067.1|1646845_1647106_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.7e-39
WP_001324129.1|1647147_1647534_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097524.1|1647533_1648238_-	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	93.6	1.7e-113
WP_001206306.1|1648297_1648642_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_000968644.1|1648638_1649088_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_001147814.1|1649084_1649423_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719065.1|1649431_1649749_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	49.5	1.8e-22
WP_000766109.1|1649825_1651043_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|1651057_1651657_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923129.1|1651649_1652876_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.1	1.1e-203
WP_001140892.1|1653023_1654781_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_023153903.1|1654780_1655263_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	4.3e-84
WP_001111090.1|1655410_1655761_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	4.3e-65
WP_000351660.1|1655899_1656439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001100260.1|1656444_1656711_-	hypothetical protein	NA	NA	NA	NA	NA
1656463:1656477	attL	CGCCTTATTATGCTC	NA	NA	NA	NA
WP_001228685.1|1656928_1657114_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_016245373.1|1657330_1657864_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	96.0	4.8e-100
WP_000193280.1|1657927_1658278_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.9e-37
WP_000839572.1|1658282_1658498_-|holin	holin	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_001064894.1|1659293_1659983_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	9.6e-61
WP_000140004.1|1659979_1660345_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	3.2e-39
WP_024188444.1|1660345_1661401_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.1	7.5e-89
WP_024175747.1|1661402_1661681_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_000737636.1|1661977_1662370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001013636.1|1662513_1662726_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_000206826.1|1662959_1663304_-	hypothetical protein	NA	A0A2R2Z2X8	Escherichia_phage	99.1	3.8e-58
WP_000207997.1|1663300_1663468_-	hypothetical protein	NA	A0A192Y6F5	Salmonella_phage	89.4	2.1e-14
WP_000224227.1|1663478_1663742_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000206712.1|1663743_1664184_-	hypothetical protein	NA	A0A2I6PID2	Escherichia_phage	50.3	2.0e-19
WP_001514293.1|1664185_1664545_-	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	74.5	1.6e-38
WP_021539545.1|1664710_1664893_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	6.9e-27
WP_072189218.1|1664986_1665385_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	5.7e-58
WP_001514296.1|1665344_1665881_-	hypothetical protein	NA	A0A2I6TD51	Escherichia_phage	97.9	6.3e-52
WP_001514297.1|1665873_1666173_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	97.0	5.6e-50
WP_001514298.1|1666169_1666592_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.1	4.7e-66
WP_001514299.1|1666632_1667703_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	3.2e-63
WP_000693853.1|1667774_1668200_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001261754.1|1668196_1668424_-	cell division control protein	NA	NA	NA	NA	NA
WP_000444613.1|1668523_1669168_+	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	25.9	8.8e-08
WP_053881715.1|1669445_1669601_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001171942.1|1669760_1669979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001299931.1|1669982_1670147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854564.1|1670547_1670736_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|1670732_1670924_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_001544673.1|1671017_1673459_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.8	9.2e-114
WP_000096344.1|1673517_1673721_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533619.1|1673720_1674746_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_001311896.1|1674981_1675779_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|1676116_1677379_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
1678068:1678082	attR	CGCCTTATTATGCTC	NA	NA	NA	NA
>prophage 8
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	1764694	1771146	5259387	transposase	Acidithiobacillus_phage(16.67%)	9	NA	NA
WP_001298859.1|1764694_1766236_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|1766250_1766997_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|1767445_1767856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|1768076_1768895_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|1768894_1769140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|1769233_1769707_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|1769722_1770199_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|1770261_1770483_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|1770501_1771146_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 9
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	1801949	1808252	5259387		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|1801949_1802492_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|1802496_1803375_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|1803432_1804332_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|1804331_1805417_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|1805789_1806683_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|1806857_1808252_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 10
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	1854970	1919414	5259387	integrase,tail,holin,tRNA,lysis,head,plate	Escherichia_phage(41.03%)	68	1841364:1841381	1903316:1903333
1841364:1841381	attL	GGTGGAATGCGGTTGCCA	NA	NA	NA	NA
WP_000675176.1|1854970_1856374_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|1856370_1857093_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|1857272_1857605_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|1857751_1859113_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_000468308.1|1859385_1859604_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_078207293.1|1859684_1860848_-	phage late control D family protein	NA	Q858U5	Yersinia_virus	99.2	1.2e-204
WP_000978916.1|1860847_1861327_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_078207294.1|1861341_1863789_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_000785970.1|1863781_1863901_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|1863933_1864209_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|1864265_1864784_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|1864796_1865987_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_023908562.1|1866065_1866233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599801.1|1866421_1867501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001516655.1|1867829_1868408_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
WP_078207295.1|1868407_1871026_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	72.9	2.9e-283
WP_078207296.1|1871036_1871567_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	98.9	1.7e-102
WP_001543006.1|1871559_1872468_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	4.4e-162
WP_069906210.1|1872472_1872820_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_039022208.1|1872816_1873452_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.7e-112
WP_001001780.1|1873518_1873971_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_000917151.1|1873963_1874431_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001300730.1|1874393_1874567_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_021565816.1|1874538_1874964_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	94.3	4.0e-65
WP_021565817.1|1874951_1875377_-	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	7.5e-56
WP_006778002.1|1875391_1875889_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_000123124.1|1875888_1876170_-|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_000846399.1|1876173_1876377_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|1876376_1876886_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_063267205.1|1883009_1884332_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063267204.1|1884415_1886683_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.5	0.0e+00
WP_000027667.1|1886672_1886948_-	hypothetical protein	NA	Q858T5	Yersinia_virus	100.0	3.8e-45
WP_001113264.1|1886944_1887169_-	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_032246799.1|1887168_1887471_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	98.0	3.8e-46
WP_000557703.1|1887470_1887695_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217670.1|1887758_1888259_-	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000453532.1|1888428_1888701_-	hypothetical protein	NA	Q1JS20	Enterobacteria_phage	100.0	5.3e-47
WP_001017512.1|1888836_1889130_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	100.0	4.0e-48
WP_000985249.1|1889199_1890180_+|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	98.2	1.7e-183
WP_001223800.1|1890365_1890866_-	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
WP_001033720.1|1891015_1891714_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580417.1|1891710_1893084_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001270242.1|1893254_1893929_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_001166063.1|1894077_1895061_-	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001296619.1|1895320_1895941_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_000063507.1|1896225_1897260_+	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296618.1|1897256_1898195_-	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000217147.1|1898178_1899015_-	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_000144100.1|1899302_1900772_+	rhamnulokinase	NA	NA	NA	NA	NA
WP_001296617.1|1900768_1902028_+	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_001179746.1|1902294_1903119_+	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_000619499.1|1903128_1903443_+	L-rhamnose mutarotase	NA	NA	NA	NA	NA
1903316:1903333	attR	GGTGGAATGCGGTTGCCA	NA	NA	NA	NA
WP_000749934.1|1903483_1904878_-	glycoporin	NA	NA	NA	NA	NA
WP_000753589.1|1905873_1906707_-	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_077633686.1|1906900_1909951_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000331383.1|1909963_1910866_+	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000829013.1|1910862_1911498_+	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000027696.1|1911494_1912424_+	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_001068514.1|1912605_1912848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038650.1|1913137_1913986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032140890.1|1914301_1914751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|1914935_1915154_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_001296612.1|1915550_1915829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|1916187_1916478_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000897302.1|1916478_1916790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001385591.1|1917018_1917927_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001297068.1|1917990_1918932_-	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_000560981.1|1918976_1919414_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	1924844	1963910	5259387	integrase,tail,transposase,head,plate	Burkholderia_virus(38.46%)	54	1931136:1931152	1965490:1965506
WP_000357981.1|1924844_1925855_-	alcohol dehydrogenase catalytic domain-containing protein	NA	A0A0K0KVL7	Prochlorococcus_phage	22.2	1.3e-05
WP_153302085.1|1925887_1926685_-	aldolase	NA	NA	NA	NA	NA
WP_001281697.1|1926846_1927236_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	53.4	3.8e-30
WP_000967768.1|1927650_1927866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001135926.1|1927862_1928552_-	DUF2786 domain-containing protein	NA	A0A1W6DYA0	Aeromonas_phage	33.9	5.9e-26
WP_001569383.1|1928538_1928835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246284.1|1928850_1929123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016246283.1|1929119_1929308_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000005725.1|1929386_1929998_-	DUF3164 family protein	NA	A0A2D1GNM4	Pseudomonas_phage	68.5	7.2e-76
WP_000835317.1|1930015_1930285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011410679.1|1930287_1931454_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	61.1	1.3e-121
1931136:1931152	attL	CAAACGCTTTTTTGGTT	NA	NA	NA	NA
WP_011410680.1|1931464_1933234_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	67.8	6.2e-229
WP_006687266.1|1933237_1934146_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	55.4	6.3e-76
WP_000042842.1|1934155_1934461_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	9.2e-24
WP_001041677.1|1934457_1934682_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001569385.1|1934770_1935181_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001569386.1|1935216_1935750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000664222.1|1935797_1936568_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.9	7.6e-99
WP_000793140.1|1936815_1937166_+	membrane protein	NA	A4JWP3	Burkholderia_virus	54.8	4.0e-23
WP_001569387.1|1937165_1937903_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	58.8	1.9e-62
WP_011410681.1|1937892_1938546_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	30.7	2.4e-08
WP_000175096.1|1938542_1938875_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	47.7	1.1e-17
WP_006122433.1|1938867_1939179_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	63.6	3.2e-32
WP_011410682.1|1939178_1939724_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	1.2e-58
WP_016246282.1|1939720_1941244_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	3.4e-183
WP_011410684.1|1941243_1942740_+	DUF935 domain-containing protein	NA	Q6QIC0	Burkholderia_phage	59.8	1.5e-170
WP_011410685.1|1942720_1943542_+|head	phage head morphogenesis protein	head	Q6QIB9	Burkholderia_phage	61.5	5.8e-97
WP_011410686.1|1943544_1944003_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	43.6	1.3e-29
WP_011410687.1|1944217_1945315_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	49.6	5.0e-96
WP_011410688.1|1945328_1946282_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	44.0	7.5e-64
WP_011410689.1|1946292_1946649_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271666.1|1946650_1947097_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	51.7	1.1e-33
WP_001101809.1|1947096_1947561_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	4.1e-39
WP_001446463.1|1947557_1947812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016246280.1|1947801_1949229_+	hypothetical protein	NA	A4JWK5	Burkholderia_virus	78.4	1.3e-216
WP_001062395.1|1949228_1949750_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	68.8	1.0e-67
WP_000215406.1|1949752_1950034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011410690.1|1950132_1950447_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001148841.1|1950412_1950550_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_011410691.1|1950642_1953108_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	42.8	7.4e-172
WP_000458380.1|1953107_1953992_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	3.1e-51
WP_011410692.1|1953988_1954204_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.6e-17
WP_000808003.1|1954191_1955361_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	49.1	3.0e-86
WP_000929399.1|1955360_1955873_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	38.5	9.4e-21
WP_000859115.1|1955927_1956275_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	63.3	7.8e-35
WP_001569394.1|1956265_1957369_+|plate	baseplate J/gp47 family protein	plate	A4JWL6	Burkholderia_virus	53.5	9.2e-106
WP_078207297.1|1957361_1957940_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	65.8	2.9e-66
WP_000876492.1|1958766_1959207_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	63.3	2.8e-45
WP_078207298.1|1959178_1959781_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	1.5e-94
WP_078207299.1|1959781_1960306_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	51.1	1.3e-41
WP_001569399.1|1960354_1960936_+	DNA-invertase Hin	NA	A0A0A7NPV4	Enterobacteria_phage	71.5	2.9e-66
WP_000190782.1|1961134_1962013_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	73.6	2.0e-47
WP_000196715.1|1962185_1963082_+	sugar kinase	NA	NA	NA	NA	NA
WP_000022287.1|1963121_1963910_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.8	1.3e-21
1965490:1965506	attR	CAAACGCTTTTTTGGTT	NA	NA	NA	NA
>prophage 12
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	2999322	3045522	5259387	protease,transposase	Stx2-converting_phage(38.46%)	33	NA	NA
WP_000997995.1|2999322_3000861_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|3001988_3002339_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|3002335_3002761_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|3003132_3003270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|3003421_3004339_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|3004372_3005248_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|3005296_3006769_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|3006772_3007603_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|3007648_3008359_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|3008371_3009481_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|3009542_3010466_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|3010501_3011236_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|3011335_3012322_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|3012473_3013701_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|3014201_3016292_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|3017123_3017396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|3017686_3018046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|3018049_3018265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|3021482_3023096_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3023126_3023477_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3023473_3023899_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_001254932.1|3025585_3026737_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_153302087.1|3027333_3031221_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_000973516.1|3032164_3034366_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|3034447_3035725_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|3035721_3037464_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|3037463_3038411_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|3038411_3040136_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|3040271_3041465_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|3042182_3042611_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|3042650_3043211_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|3043252_3043513_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000952382.1|3044349_3045522_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	100.0	2.2e-230
>prophage 13
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	3339855	3348621	5259387	integrase	Escherichia_phage(71.43%)	7	3333687:3333700	3349660:3349673
3333687:3333700	attL	TTTCTATATCGCCT	NA	NA	NA	NA
WP_001279004.1|3339855_3340494_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|3340490_3341753_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|3341749_3342658_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|3342853_3343621_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|3343671_3344328_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_078207310.1|3344433_3347001_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.2e-31
WP_078207311.1|3347160_3348621_+|integrase	integrase	integrase	A0A0R6PHM8	Moraxella_phage	24.4	1.0e-19
3349660:3349673	attR	AGGCGATATAGAAA	NA	NA	NA	NA
>prophage 14
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	3486961	3528424	5259387	integrase,holin,tail,terminase	Salmonella_phage(53.19%)	53	NA	NA
WP_000054755.1|3486961_3487222_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	54.7	1.7e-18
WP_001138328.1|3487436_3488834_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001127138.1|3489027_3490422_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	74.7	7.3e-217
WP_000212683.1|3490456_3490777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085961393.1|3490773_3491805_-	DNA cytosine methyltransferase	NA	Q858D4	Salmonella_phage	53.0	1.1e-100
WP_000312950.1|3491774_3492068_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	5.0e-27
WP_000128190.1|3492067_3492550_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	79.6	3.6e-70
WP_000008824.1|3492539_3492761_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000216034.1|3492766_3492970_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	55.4	3.2e-12
WP_000065468.1|3492975_3495039_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.8	8.7e-275
WP_000490741.1|3495095_3495365_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298623.1|3495432_3496071_-	hypothetical protein	NA	H6WRY3	Salmonella_phage	68.8	3.9e-72
WP_000769011.1|3496122_3496671_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	1.6e-66
WP_001113502.1|3496686_3497988_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	56.4	7.2e-134
WP_000051353.1|3497990_3498893_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000049986.1|3499672_3500296_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.8	3.3e-36
WP_000170998.1|3500416_3500629_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_001337135.1|3500632_3502825_+	replication protein	NA	B6SCY1	Bacteriophage	71.3	1.2e-173
WP_001244506.1|3503106_3503529_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001174015.1|3503560_3503902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|3504347_3504689_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194119.1|3504692_3505169_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_000779565.1|3505152_3505677_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162795.1|3505738_3506311_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	6.1e-61
WP_001130788.1|3506313_3507936_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.4	0.0e+00
WP_000113489.1|3507935_3509402_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	6.7e-261
WP_000184961.1|3509292_3510027_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	85.6	1.8e-97
WP_000873175.1|3510041_3511262_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	3.2e-200
WP_001066729.1|3511265_3511772_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.3	1.1e-69
WP_000627477.1|3511783_3512725_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.3	3.2e-155
WP_001107515.1|3512766_3512988_+	hypothetical protein	NA	A0A0M4RTX5	Salmonella_phage	68.6	7.7e-12
WP_001125664.1|3512953_3513361_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	4.3e-69
WP_000008727.1|3513357_3513912_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.2	1.7e-79
WP_001142475.1|3513898_3514288_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	5.6e-66
WP_001298391.1|3514262_3514826_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_000046934.1|3514829_3515975_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.2	5.2e-160
WP_000109249.1|3515985_3516426_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393960.1|3516429_3516882_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	6.1e-56
WP_000990889.1|3517059_3519045_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_001298404.1|3519044_3519632_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000155120.1|3519631_3519934_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	91.0	6.3e-49
WP_000081732.1|3519936_3521001_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	3.2e-156
WP_000824896.1|3521000_3521333_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	70.5	1.1e-22
WP_000718774.1|3521428_3522202_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000301073.1|3522643_3523396_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.9	2.5e-86
WP_001270631.1|3523395_3523749_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_001197080.1|3523748_3524948_+	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	83.9	1.7e-185
WP_000049952.1|3524944_3525625_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	3.4e-103
WP_001096981.1|3525624_3526314_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	70.0	3.7e-28
WP_001106827.1|3526340_3526781_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	5.6e-54
WP_000805550.1|3526752_3527346_-|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	4.5e-59
WP_001115569.1|3527345_3527840_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	92.8	1.1e-79
WP_000904982.1|3527869_3528424_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	87.3	3.7e-87
>prophage 15
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	3579239	3645958	5259387	integrase,tail,holin,tRNA,terminase	Escherichia_phage(50.0%)	65	3604211:3604227	3644303:3644319
WP_000003317.1|3579239_3580394_+|tRNA	bifunctional tRNA (adenosine(37)-C2)-methyltransferase TrmG/ribosomal RNA large subunit methyltransferase RlmN	tRNA	NA	NA	NA	NA
WP_001090837.1|3580678_3581686_+	cytoskeleton protein RodZ	NA	NA	NA	NA	NA
WP_000551807.1|3581712_3582831_+	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_001107179.1|3582941_3584216_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000409203.1|3584233_3584854_+	YfgM family protein	NA	NA	NA	NA	NA
WP_001177062.1|3584864_3586043_+	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_001296291.1|3586160_3587633_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_001196896.1|3587695_3587911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531885.1|3588116_3590291_+	intimin-like inverse autotransporter SinH	NA	NA	NA	NA	NA
WP_000802329.1|3590346_3591339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000109687.1|3591448_3599530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000937876.1|3599583_3600951_-	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	41.2	2.3e-45
WP_001296289.1|3601112_3602579_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|3602647_3604225_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
3604211:3604227	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_020231273.1|3604417_3605668_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	99.3	8.0e-239
WP_078207333.1|3605701_3606358_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	80.3	3.7e-54
WP_078207334.1|3606611_3607262_-	adenine methylase	NA	G9L699	Escherichia_phage	97.2	3.1e-125
WP_001335975.1|3607254_3607506_-	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_000675390.1|3607663_3607912_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063821.1|3607961_3608843_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	99.0	6.8e-160
WP_078207335.1|3608839_3609661_-	exodeoxyribonuclease VIII	NA	G9L6A3	Escherichia_phage	98.5	4.0e-162
WP_078207336.1|3609657_3609957_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	98.0	6.4e-46
WP_000836293.1|3610265_3610850_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	99.5	2.7e-104
WP_001282459.1|3611004_3611235_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_078207337.1|3611601_3612435_+	primosomal protein	NA	Q286X4	Escherichia_phage	93.7	3.3e-100
WP_078207338.1|3612409_3613192_+	replication protein	NA	G9L6A9	Escherichia_phage	90.4	1.9e-137
WP_001231263.1|3613309_3613657_+	hypothetical protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	98.3	3.1e-60
WP_078207339.1|3613718_3614372_+	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	58.4	1.2e-57
WP_078207340.1|3614368_3615007_+	hypothetical protein	NA	Q1MVG0	Enterobacteria_phage	95.8	7.9e-126
WP_078207341.1|3615003_3615744_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	90.1	1.3e-42
WP_072165672.1|3615745_3615943_+	hypothetical protein	NA	A0A1I9SEY0	Klebsiella_phage	86.2	1.1e-30
WP_078207342.1|3615953_3616973_+	DUF551 domain-containing protein	NA	A0A1B0V865	Salmonella_phage	61.3	2.1e-88
WP_078207343.1|3616972_3617341_+	DUF2591 domain-containing protein	NA	G9L6B5	Escherichia_phage	71.3	4.4e-44
WP_001129693.1|3617333_3617672_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	8.3e-58
WP_001090120.1|3617712_3618387_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	100.0	9.0e-120
WP_078207344.1|3618383_3619859_+|terminase	terminase	terminase	A0A0F6TK57	Escherichia_coli_O157_typing_phage	99.2	2.9e-296
WP_001280573.1|3619949_3620321_-	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	99.2	1.1e-63
WP_000335899.1|3621027_3621234_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_078207345.1|3621248_3622928_+|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	1.8e-302
WP_000133160.1|3622924_3623221_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_001048086.1|3623223_3623919_+	peptidase	NA	G9L6C4	Escherichia_phage	97.8	3.7e-92
WP_000268712.1|3623933_3624920_+	hypothetical protein	NA	A0A0F6TJQ9	Escherichia_coli_O157_typing_phage	100.0	1.5e-187
WP_000627083.1|3624971_3625409_+	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.9	2.9e-71
WP_078207346.1|3625419_3625755_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	96.4	1.6e-53
WP_000424495.1|3625805_3626129_+	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_078207347.1|3626128_3626734_+	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	99.5	4.7e-112
WP_078207348.1|3626733_3629205_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	98.9	0.0e+00
WP_000568023.1|3629204_3629669_+	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_000332878.1|3629668_3630214_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_078207349.1|3630213_3632835_+	transglycosylase SLT domain-containing protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	39.1	6.4e-73
WP_078207350.1|3632836_3634534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644858.1|3634533_3637083_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	45.5	3.1e-205
WP_000643933.1|3637085_3637646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077871029.1|3637744_3638260_-	DUF2335 domain-containing protein	NA	S5WJ01	Leptospira_phage	28.8	1.9e-08
WP_078207351.1|3638482_3638692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078207352.1|3638805_3639516_-	BRO-like protein	NA	G9L6E2	Escherichia_phage	79.8	3.4e-101
WP_001190175.1|3639831_3640089_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	98.8	3.7e-42
WP_124800788.1|3640284_3642306_+|tail	phage tail protein	tail	G9L6E4	Escherichia_phage	56.1	1.8e-59
WP_063269816.1|3642402_3642807_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	91.8	1.6e-60
WP_063269817.1|3642793_3643102_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	98.0	6.4e-49
WP_078207353.1|3643091_3643721_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.6	3.4e-113
WP_042634137.1|3643717_3644215_+	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	69.6	1.3e-51
WP_000755178.1|3644409_3644949_-	hypothetical protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
3644303:3644319	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000669398.1|3644964_3645480_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_001344399.1|3645784_3645958_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	6.8e-24
>prophage 16
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	4022688	4032133	5259387		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|4022688_4023615_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|4023619_4024351_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|4024331_4024439_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|4024498_4025230_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|4025451_4027137_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|4027133_4027853_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|4027899_4028370_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|4028410_4028872_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|4028996_4031000_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|4030996_4032133_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 17
NZ_CP018970	Escherichia coli strain Ecol_542 chromosome, complete genome	5259387	4047939	4125159	5259387	integrase,portal,tail,holin,tRNA,transposase,lysis,terminase,capsid,protease,head,plate	Escherichia_phage(34.09%)	85	4048164:4048181	4125730:4125747
WP_001296226.1|4047939_4049973_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
4048164:4048181	attL	CCAGCGTCAGGCGCAGCA	NA	NA	NA	NA
WP_001005448.1|4050104_4051214_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001046487.1|4051476_4051758_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830464.1|4052050_4052593_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677331.1|4052673_4053348_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945369.1|4053363_4055844_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405718.1|4055859_4056894_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|4056975_4057314_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134616.1|4057532_4058357_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|4058477_4058750_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195621.1|4058972_4059761_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822280.1|4059757_4060558_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001296225.1|4060622_4061441_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
WP_000434047.1|4061492_4062239_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011972.1|4062212_4063178_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846228.1|4063174_4064179_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858523.1|4064175_4065453_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129562.1|4065709_4066762_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289802.1|4066988_4067843_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853832.1|4067871_4069134_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182880.1|4069143_4069596_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823284.1|4069626_4069911_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000844233.1|4071316_4072357_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|4072456_4073236_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807341.1|4073317_4074217_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_001531820.1|4074631_4074949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985261.1|4075383_4076397_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_000020919.1|4076512_4076812_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|4076933_4077209_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000217677.1|4077387_4077888_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|4077951_4078176_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277966.1|4078175_4078478_+	hypothetical protein	NA	U5N0U2	Enterobacteria_phage	99.0	1.7e-46
WP_001113264.1|4078477_4078702_+	TraR/DksA family transcriptional regulator	NA	S4TRY6	Salmonella_phage	100.0	2.9e-35
WP_000027664.1|4078698_4078974_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_078207359.1|4078963_4081240_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_047603079.1|4082415_4083450_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	9.3e-201
WP_078207360.1|4083449_4085222_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.7	0.0e+00
WP_047603076.1|4085395_4086250_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	97.2	7.6e-132
WP_001391285.1|4086308_4087382_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK2	Enterobacteria_phage	99.7	1.9e-201
WP_000203433.1|4087385_4088129_+|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.4	6.0e-125
WP_000988633.1|4088228_4088738_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|4088737_4088941_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|4088944_4089226_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_006778002.1|4089225_4089723_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	9.0e-93
WP_021565817.1|4089737_4090163_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	92.9	7.5e-56
WP_021565816.1|4090150_4090576_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	94.3	4.0e-65
WP_001300730.1|4090547_4090721_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917151.1|4090683_4091151_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	100.0	6.1e-83
WP_001001780.1|4091143_4091596_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_039022208.1|4091662_4092298_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.7e-112
WP_069906210.1|4092294_4092642_+|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	99.1	3.8e-58
WP_001543006.1|4092646_4093555_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.3	4.4e-162
WP_001285323.1|4093547_4094078_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_078207295.1|4094088_4096707_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	72.9	2.9e-283
WP_001516655.1|4096706_4097285_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
WP_001599801.1|4097613_4098693_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023908562.1|4098881_4099049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|4099646_4100393_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|4100407_4101949_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001251408.1|4102916_4103435_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|4103491_4103767_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|4103799_4103919_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_078207294.1|4103911_4106359_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.3	0.0e+00
WP_000978916.1|4106373_4106853_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_078207361.1|4106852_4108016_+	phage late control D family protein	NA	Q858U5	Yersinia_virus	99.5	1.4e-205
WP_000468308.1|4108096_4108315_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001145759.1|4108584_4109097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001076748.1|4109304_4110207_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
WP_000591795.1|4110387_4111350_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758732.1|4111669_4112659_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001296622.1|4112765_4113521_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|4113575_4114343_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802235.1|4114450_4115050_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|4115150_4115591_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|4115802_4116102_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|4116128_4116557_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|4116561_4117308_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|4117404_4118415_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|4118585_4120094_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|4120116_4120962_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4121386_4121632_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4121716_4122202_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|4122294_4123221_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293344.1|4123287_4124619_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
WP_000208242.1|4124628_4125159_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
4125730:4125747	attR	TGCTGCGCCTGACGCTGG	NA	NA	NA	NA
>prophage 1
NZ_CP018969	Escherichia coli strain Ecol_542 plasmid pEC542_1, complete sequence	82364	13023	72613	82364	integrase,transposase	Escherichia_phage(29.17%)	56	27859:27875	44387:44403
WP_000080195.1|13023_14637_+|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000012107.1|14920_15232_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000338606.1|15236_15599_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254388.1|15632_15860_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_001348626.1|15947_16625_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_001151566.1|16758_17142_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000243712.1|17472_18075_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001234469.1|18371_19193_-	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000107535.1|19311_19599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032143370.1|19831_20020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|20520_20679_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_085947770.1|20789_22159_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_001276232.1|22404_23124_-	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000845940.1|23120_23555_-	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_000117179.1|23609_25568_-	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.4	1.3e-22
WP_000005990.1|25633_25867_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_000290841.1|25929_26469_-	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.9	1.2e-45
WP_032143370.1|26702_26891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001617878.1|27111_27354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001348621.1|27379_27943_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	1.0e-20
27859:27875	attL	ATTCAGCCCGGATTTCA	NA	NA	NA	NA
WP_000170714.1|27990_29352_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|29403_29634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027516.1|30668_30860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271753.1|30856_31279_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|31325_31628_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000274437.1|32994_33429_-	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001104873.1|33442_33664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000086185.1|33664_34348_-	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001348615.1|34732_35635_-	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000817036.1|36501_37473_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_000772446.1|37472_38639_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000852146.1|39226_39982_-	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000016982.1|40755_41562_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_001159868.1|41562_41868_-	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000813634.1|41869_42088_-	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_000246636.1|42795_43791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000991832.1|43794_44727_+	hypothetical protein	NA	NA	NA	NA	NA
44387:44403	attR	TGAAATCCGGGCTGAAT	NA	NA	NA	NA
WP_001553854.1|45774_48891_-	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	24.0	3.7e-27
WP_001617890.1|49012_50296_-	restriction endonuclease subunit S	NA	F2Y1N5	Organic_Lake_phycodnavirus	26.5	2.2e-10
WP_001617892.1|50292_51849_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
WP_001190712.1|52031_52253_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001216034.1|52252_52633_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001513661.1|52637_52817_+	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001513660.1|52844_53204_+	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513659.1|53490_53808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012372828.1|54035_55052_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001373486.1|55259_56663_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|56649_57582_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000361610.1|60924_61902_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_001066941.1|62186_62927_-	site-specific recombinase	NA	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001309252.1|63047_63236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|63602_64772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|65618_65891_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001067858.1|68478_69183_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001235713.1|69357_69915_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_012579081.1|71689_72613_-|transposase	IS5 family transposase	transposase	Q9MCT5	Escherichia_phage	99.7	2.2e-177
