The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	766	40904	5228864	head,tail,transposase,integrase,plate	Burkholderia_virus(41.03%)	57	24816:24831	33353:33368
WP_000859116.1|766_1114_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	61.5	1.7e-34
WP_000148265.1|1168_1765_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	5.4e-36
WP_001529032.1|1761_2934_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.1	7.3e-85
WP_012602373.1|2921_3137_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|3133_4018_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_078214764.1|4017_7230_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	31.3	9.9e-84
WP_001202894.1|7305_7464_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|7387_7723_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|7820_8102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|8104_8626_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|8625_10053_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|10042_10297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021539012.1|10293_10758_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.0	1.3e-37
WP_000271668.1|10757_11204_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|11205_11544_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|11553_12507_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|12521_13637_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|13851_14310_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117556.1|14312_15134_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.5	3.1e-98
WP_042069474.1|15114_16611_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.4	4.4e-167
WP_000137893.1|16610_18134_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.5	1.8e-184
WP_000533684.1|18130_18673_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	53.3	4.9e-44
WP_000227704.1|18675_18987_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	4.0e-30
WP_000175097.1|18986_19313_-	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
WP_001299256.1|19309_19921_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	34.2	6.9e-10
WP_001104438.1|19949_20687_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	59.5	2.9e-63
WP_000793145.1|20689_21040_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.9	9.0e-23
WP_000194949.1|21170_21914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972292.1|21889_22294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069609.1|22292_22508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001573937.1|22699_23464_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	4.0e-100
WP_000579778.1|23580_23919_-	helix-turn-helix domain-containing protein	NA	F6MII3	Haemophilus_phage	34.4	4.8e-05
WP_000123378.1|24019_24208_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047758.1|24260_24569_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	3.5e-23
WP_000533819.1|24579_25491_+	hypothetical protein	NA	A4JWN3	Burkholderia_virus	55.3	2.0e-74
24816:24831	attL	TGAACCTCACGGGGAC	NA	NA	NA	NA
WP_059218002.1|25494_27264_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.3	6.2e-229
WP_000960680.1|27274_28441_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_000843446.1|28443_28713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001381528.1|28740_29271_+	bacteriophage Mu Gam like family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_042203510.1|29559_29832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000197789.1|29841_30147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000131939.1|30143_30827_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.9	4.5e-34
WP_000631814.1|30823_31054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123379.1|31043_31259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000988473.1|31248_31701_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	46.6	1.6e-24
WP_001281696.1|31672_32071_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	55.9	3.9e-30
WP_001571573.1|32185_32818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542273.1|33924_34338_+	hypothetical protein	NA	NA	NA	NA	NA
33353:33368	attR	GTCCCCGTGAGGTTCA	NA	NA	NA	NA
WP_001298859.1|34452_35994_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|36008_36755_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_000846703.1|37203_37614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542275.1|37834_38653_+	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	8.8e-45
WP_001164966.1|38652_38898_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001542276.1|38991_39465_+	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.1	4.3e-12
WP_001186200.1|39480_39957_+	RadC family protein	NA	NA	NA	NA	NA
WP_000692345.1|40019_40241_+	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_000086752.1|40259_40904_+	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
>prophage 2
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	71707	78010	5228864		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001100793.1|71707_72250_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
WP_000857525.1|72254_73133_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001023641.1|73190_74090_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699407.1|74089_75175_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	8.8e-101
WP_000183040.1|75547_76441_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_001116066.1|76615_78010_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
>prophage 3
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	124728	164986	5228864	lysis,terminase,head,tail,plate,portal,holin,integrase,tRNA,capsid	Escherichia_phage(44.44%)	50	128325:128343	172114:172132
WP_000675176.1|124728_126132_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
WP_000137877.1|126128_126851_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000929408.1|127030_127363_+	YegP family protein	NA	NA	NA	NA	NA
WP_000476014.1|127509_128871_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
128325:128343	attL	CGCCCATGTTGAACGCCTG	NA	NA	NA	NA
WP_000468308.1|129143_129362_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000887625.1|129443_130607_-	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	99.0	1.2e-204
WP_000978916.1|130606_131086_-|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	2.5e-84
WP_001600133.1|131100_133548_-|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	99.1	0.0e+00
WP_000785970.1|133540_133660_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001599803.1|133692_133968_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	97.8	6.3e-40
WP_001251408.1|134024_134543_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286716.1|134555_135746_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_023908562.1|135824_135992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599801.1|136180_137260_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001516655.1|137588_138167_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	6.8e-68
WP_001599800.1|138166_140785_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.0	3.4e-284
WP_001285323.1|140795_141326_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	99.4	1.3e-102
WP_001121473.1|141318_142227_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	99.7	2.6e-162
WP_000127164.1|142231_142579_-|plate	baseplate assembly protein	plate	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001599799.1|142575_143211_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	2.6e-113
WP_001599798.1|143294_144080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001599797.1|144151_144604_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	97.3	1.3e-74
WP_001599796.1|144596_145064_-|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	98.1	9.7e-81
WP_001300730.1|145026_145200_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_023908563.1|145171_145597_-|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7L9Y0	Escherichia_phage	95.0	4.0e-65
WP_001605748.1|145584_146010_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	98.6	1.7e-60
WP_001144101.1|146024_146522_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|146521_146803_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846409.1|146806_147010_-|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000988633.1|147009_147519_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203428.1|147618_148362_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_032179100.1|148365_149439_-|capsid	phage major capsid protein, P2 family	capsid	Q94MI3	Enterobacteria_phage	99.2	1.6e-200
WP_001601069.1|149497_150352_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.0	2.7e-137
WP_000156861.1|150525_152298_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001600135.1|152297_153332_+|portal	phage portal protein	portal	Q858W8	Yersinia_virus	98.8	3.9e-199
WP_032179103.1|153750_154692_+	hypothetical protein	NA	Q2P9W7	Enterobacteria_phage	81.2	2.7e-146
WP_072164333.1|154764_154917_-	meiotically up-regulated 80 protein	NA	Q2P9X3	Enterobacteria_phage	89.8	1.7e-18
WP_023136039.1|155011_155692_-	hypothetical protein	NA	Q2P9W8	Enterobacteria_phage	99.1	4.6e-124
WP_077250945.1|155719_155941_-	DUF2158 domain-containing protein	NA	Q2P9W9	Enterobacteria_phage	98.6	2.9e-35
WP_032179106.1|156037_158323_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.7	0.0e+00
WP_001541416.1|159324_159606_-	hypothetical protein	NA	S4TP00	Salmonella_phage	71.4	3.6e-30
WP_001113270.1|159602_159827_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_001277957.1|159826_160129_-	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_000557703.1|160128_160353_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|160416_160917_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001081582.1|161094_161370_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_000020919.1|161491_161791_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|161906_162920_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001531820.1|163354_163672_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807341.1|164086_164986_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
172114:172132	attR	CGCCCATGTTGAACGCCTG	NA	NA	NA	NA
>prophage 4
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	206170	215615	5228864		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292786.1|206170_207307_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
WP_001296230.1|207303_209307_+	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001296231.1|209431_209893_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|209933_210404_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|210450_211170_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|211166_212852_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240408.1|213073_213805_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001216963.1|213864_213972_+	protein YohO	NA	NA	NA	NA	NA
WP_000783109.1|213952_214684_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569347.1|214688_215615_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
>prophage 5
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	792163	799303	5228864		Escherichia_phage(83.33%)	6	NA	NA
WP_000103863.1|792163_794725_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
WP_001141293.1|794830_795487_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_001296319.1|795537_796305_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847996.1|796500_797409_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_000590411.1|797405_798668_+	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279004.1|798664_799303_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 6
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	1057525	1121234	5228864	transposase,integrase,tRNA,protease	Escherichia_phage(28.57%)	50	1049781:1049798	1110059:1110076
1049781:1049798	attL	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_001296359.1|1057525_1058023_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_000286500.1|1058117_1058825_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001222509.1|1058904_1059636_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593274.1|1059648_1060599_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|1060707_1061271_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017111.1|1061270_1061687_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001296360.1|1061801_1062782_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|1062799_1063504_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|1063521_1064088_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277229.1|1064084_1064375_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174754.1|1064382_1064976_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239963.1|1064968_1066105_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000783999.1|1066419_1067406_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577034.1|1067450_1067954_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_000378955.1|1067953_1069255_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_000745240.1|1069310_1070318_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|1070434_1071481_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984796.1|1071656_1072376_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_001296361.1|1072396_1072537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001107566.1|1072559_1072886_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|1072885_1073605_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001296362.1|1073765_1074818_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|1074845_1075121_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_000760323.1|1075185_1076265_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001296363.1|1076466_1077723_+	nucleoside permease	NA	NA	NA	NA	NA
WP_000839781.1|1077771_1079907_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234526.1|1080299_1081007_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218869.1|1081385_1082651_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000147017.1|1082906_1083950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001774069.1|1085643_1086195_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000006213.1|1088686_1088920_+	Major pilus subunit operon regulatory protein	NA	NA	NA	NA	NA
WP_023146305.1|1089386_1089602_+	hypothetical protein	NA	A0A0N7C1Y0	Escherichia_phage	85.2	1.7e-27
WP_099156432.1|1089570_1090697_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
WP_001513409.1|1090787_1090901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001110186.1|1092734_1092995_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109147.1|1093036_1093597_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|1093636_1094065_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_000074472.1|1094782_1095976_-	MFS transporter	NA	NA	NA	NA	NA
WP_001296374.1|1096111_1097836_+	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_001287500.1|1097836_1098784_+	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001015715.1|1098783_1100526_+	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000750130.1|1100522_1101800_+	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_000973516.1|1101881_1104083_+	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_001034083.1|1105026_1108914_+|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_001254932.1|1109510_1110662_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
1110059:1110076	attR	CCTGAATATACAGCATCT	NA	NA	NA	NA
WP_000266542.1|1115442_1115658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|1115661_1116021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001305021.1|1116311_1116584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001223344.1|1117415_1119506_-	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_096928816.1|1120005_1121234_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
>prophage 7
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	2179013	2254636	5228864	lysis,terminase,head,tail,plate,portal,protease,holin,integrase,tRNA,capsid	Escherichia_phage(58.7%)	88	2208086:2208132	2238656:2238702
WP_000560981.1|2179013_2179451_+|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001297068.1|2179495_2180437_+	fatty acid biosynthesis protein FabY	NA	NA	NA	NA	NA
WP_001385591.1|2180500_2181409_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000897302.1|2181637_2181949_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000356397.1|2181949_2182240_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001296612.1|2182598_2182877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001251293.1|2183273_2183492_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_032140890.1|2183676_2184126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001038650.1|2184441_2185290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068514.1|2185579_2185822_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000027696.1|2186003_2186933_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_000829013.1|2186929_2187565_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_000331383.1|2187561_2188464_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_077633686.1|2188476_2191527_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
WP_000753589.1|2191720_2192554_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_000749934.1|2193549_2194944_+	glycoporin	NA	NA	NA	NA	NA
WP_000619499.1|2194984_2195299_-	L-rhamnose mutarotase	NA	NA	NA	NA	NA
WP_001179746.1|2195308_2196133_-	rhamnulose-1-phosphate aldolase	NA	NA	NA	NA	NA
WP_001296617.1|2196399_2197659_-	L-rhamnose isomerase	NA	NA	NA	NA	NA
WP_000144100.1|2197655_2199125_-	rhamnulokinase	NA	NA	NA	NA	NA
WP_000217147.1|2199412_2200249_+	HTH-type transcriptional activator RhaS	NA	NA	NA	NA	NA
WP_001296618.1|2200232_2201171_+	HTH-type transcriptional activator RhaR	NA	NA	NA	NA	NA
WP_000063507.1|2201167_2202202_-	L-rhamnose/proton symporter RhaT	NA	NA	NA	NA	NA
WP_001296619.1|2202486_2203107_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	5.4e-63
WP_001166063.1|2203366_2204350_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270242.1|2204498_2205173_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|2205343_2206717_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_001033720.1|2206713_2207412_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_001223800.1|2207561_2208062_+	cell-envelope stress modulator CpxP	NA	NA	NA	NA	NA
2208086:2208132	attL	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000985243.1|2208248_2209229_-|integrase	tyrosine-type recombinase/integrase	integrase	S4TP66	Salmonella_phage	99.7	1.0e-185
WP_000777028.1|2209298_2209592_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	99.0	4.7e-49
WP_001308179.1|2209728_2210001_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	100.0	1.4e-47
WP_000217670.1|2210170_2210671_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_078214771.1|2210734_2210959_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	1.0e-32
WP_001277952.1|2210958_2211261_+	hypothetical protein	NA	A0A0F7LDT6	Escherichia_phage	96.0	2.5e-45
WP_001113270.1|2211260_2211485_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	3.8e-35
WP_000027664.1|2211481_2211757_+	hypothetical protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_078214772.1|2211746_2214023_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.6	0.0e+00
WP_001774096.1|2214201_2214753_+	3'-5' exoribonuclease	NA	D4HTX2	Vibrio_phage	47.0	7.0e-38
WP_001774097.1|2214846_2216406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038159.1|2216759_2217794_-|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.4	2.1e-200
WP_000156847.1|2217793_2219566_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_078214773.1|2219739_2220594_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	88.4	7.1e-138
WP_001530537.1|2220652_2221726_+|capsid	phage major capsid protein, P2 family	capsid	Q94MK7	Enterobacteria_phage	99.4	1.1e-201
WP_078214774.1|2221729_2222467_+|terminase	terminase endonuclease subunit	terminase	Q94MJ2	Enterobacteria_phage	99.6	1.6e-130
WP_000988633.1|2222566_2223076_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846409.1|2223075_2223279_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|2223282_2223564_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|2223563_2224061_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_078214775.1|2224075_2224501_+	protein lysA	NA	A0A0F7LBP4	Escherichia_phage	93.6	1.0e-57
WP_078214776.1|2224488_2224914_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	97.2	9.4e-67
WP_001119522.1|2224900_2225059_+	hypothetical protein	NA	A0A0F7LCN5	Escherichia_phage	100.0	2.6e-22
WP_000917169.1|2225021_2225489_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	1.9e-81
WP_001001780.1|2225481_2225934_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	100.0	6.3e-77
WP_001297867.1|2226000_2226636_+|plate	phage baseplate assembly protein V	plate	Q858V7	Yersinia_virus	98.1	5.9e-113
WP_032277167.1|2226632_2226980_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121474.1|2226984_2227893_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285340.1|2227885_2228497_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_078214777.1|2228493_2229828_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	67.8	1.3e-175
WP_040072409.1|2229827_2230430_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.4	6.6e-98
WP_021546685.1|2230401_2230842_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	69.7	4.7e-53
WP_143370061.1|2230868_2231258_-	hypothetical protein	NA	F1BUP1	Erwinia_phage	43.8	4.7e-12
WP_000905101.1|2231288_2231882_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.7e-104
WP_001286716.1|2231941_2233132_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	100.0	1.6e-225
WP_001251408.1|2233144_2233663_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|2233719_2233995_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|2234027_2234147_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_046617802.1|2234139_2236587_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.8	0.0e+00
WP_000978896.1|2236601_2237081_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	100.0	6.6e-85
WP_000882963.1|2237080_2238244_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.7	2.4e-205
WP_000468308.1|2238325_2238544_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001076748.1|2238780_2239683_+	CDF family cation-efflux transporter FieF	NA	NA	NA	NA	NA
2238656:2238702	attR	GACACCATCCCTGTCTTCCCCCACATGATGTGGGGGTTTTTTTTATC	NA	NA	NA	NA
WP_000591795.1|2239863_2240826_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_000758732.1|2241145_2242135_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001296622.1|2242241_2242997_+	CDP-diacylglycerol diphosphatase	NA	NA	NA	NA	NA
WP_001216325.1|2243051_2243819_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_000802235.1|2243926_2244526_-	YiiQ family protein	NA	NA	NA	NA	NA
WP_000155252.1|2244626_2245067_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_000655986.1|2245278_2245578_+	DUF406 domain-containing protein	NA	NA	NA	NA	NA
WP_000323555.1|2245604_2246033_+	universal stress protein UspD	NA	NA	NA	NA	NA
WP_000796342.1|2246037_2246784_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_001250644.1|2246880_2247891_-	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000136804.1|2248061_2249570_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_000084268.1|2249592_2250438_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|2250862_2251108_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|2251192_2251678_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_001305044.1|2251770_2252697_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000208242.1|2254105_2254636_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 8
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	3891631	4001423	5228864	terminase,head,tail,plate,protease,portal,holin,transposase,integrase,tRNA,capsid	Enterobacteria_phage(43.75%)	131	3987021:3987036	4006342:4006357
WP_000520781.1|3891631_3891952_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|3891982_3894259_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|3894943_3895162_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241674.1|3895446_3896151_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202204.1|3896192_3897914_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.4e-20
WP_001043561.1|3897914_3899681_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001385255.1|3899803_3900769_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_000228473.1|3901312_3901807_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077041.1|3901941_3906048_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|3906206_3906818_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|3906828_3908172_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|3908262_3909555_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000078916.1|3909860_3910001_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488106.1|3910192_3910453_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132830.1|3910493_3911603_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000005447.1|3911760_3912945_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000290462.1|3912944_3913457_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000651577.1|3913512_3913887_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000333503.1|3913895_3914051_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853410.1|3914037_3916845_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000979945.1|3916857_3917346_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|3917374_3917974_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_032142265.1|3918192_3918750_+	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000972134.1|3918752_3919286_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_001554335.1|3919314_3919842_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_032140708.1|3919843_3922066_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_000071703.1|3922068_3922599_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_001111954.1|3922591_3923488_-|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000213444.1|3923491_3923842_-|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001271941.1|3923838_3924420_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000356366.1|3924416_3925052_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000921127.1|3925044_3925512_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000202148.1|3925535_3927413_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000780577.1|3927551_3927947_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000072341.1|3927943_3928336_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_001342221.1|3928332_3928656_-|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000864901.1|3928658_3928859_-|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063100.1|3928858_3929353_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	97.0	1.9e-87
WP_000632309.1|3929454_3930255_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_001055083.1|3930300_3931353_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_001262655.1|3931376_3932213_-|capsid	phage capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	2.7e-150
WP_000613780.1|3932367_3934119_+|terminase	terminase	terminase	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087814.1|3934118_3935165_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	2.2e-202
WP_000236495.1|3935179_3935704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001068329.1|3936427_3936925_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193205.1|3936964_3937807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211282.1|3937890_3938205_-	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
WP_000686485.1|3938209_3939169_-	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000123489.1|3939245_3942068_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000599382.1|3942074_3942440_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	1.7e-61
WP_000013455.1|3942512_3942743_-	hypothetical protein	NA	A0A0A7NV48	Enterobacteria_phage	97.4	9.1e-32
WP_000104290.1|3943065_3943365_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_000153700.1|3943361_3943628_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|3943624_3943828_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543036.1|3943851_3944262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021715.1|3944355_3944469_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000514277.1|3944465_3944708_-	DUF4754 domain-containing protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000159455.1|3944719_3944998_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000776267.1|3945008_3945359_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_001287828.1|3945496_3945688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856387.1|3945694_3946117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204236.1|3946121_3946643_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001368591.1|3946747_3947089_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_000023739.1|3947158_3948151_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_000850306.1|3948450_3950895_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|3950905_3951523_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534666.1|3951524_3952388_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000165876.1|3952423_3953050_-	hydrolase	NA	NA	NA	NA	NA
WP_000109283.1|3953363_3954512_+	MFS transporter	NA	NA	NA	NA	NA
WP_000111043.1|3954608_3955349_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|3955540_3957823_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
WP_001295917.1|3957877_3958735_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_000194832.1|3959140_3960901_-	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642852.1|3961030_3961723_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057158.1|3961921_3963010_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
WP_000445240.1|3963080_3964364_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000904922.1|3964619_3965192_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_063269479.1|3965251_3965776_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	48.6	1.8e-35
WP_000072165.1|3965775_3966390_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|3966396_3966858_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_023363137.1|3966868_3968116_-|tail	tail protein	tail	A0A0K2FIZ6	Escherichia_phage	43.7	2.0e-40
WP_000138756.1|3968118_3968697_-|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_001219098.1|3968689_3969793_-|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000859111.1|3969783_3970131_-|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_000148266.1|3970185_3970782_-|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000808007.1|3970778_3971933_-	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_012602373.1|3971920_3972136_-	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000458387.1|3972132_3973017_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000016538.1|3973016_3975968_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_001202894.1|3976043_3976202_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000084213.1|3976125_3976461_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000110114.1|3976558_3976840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000034294.1|3976842_3977364_-|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000729834.1|3977363_3978791_-|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_012602372.1|3978780_3979035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001101804.1|3979031_3979496_-	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000271668.1|3979495_3979942_-	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_000537457.1|3979943_3980282_-	DUF2190 family protein	NA	NA	NA	NA	NA
WP_001286908.1|3980291_3981245_-	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_001273074.1|3981259_3982375_-	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_000135514.1|3982589_3983048_-	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_000117548.1|3983050_3983872_-|head	phage head morphogenesis protein	head	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000090684.1|3983852_3985349_-	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000167500.1|3985348_3986944_-	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.5e-185
WP_000124060.1|3986940_3987486_-	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
3987021:3987036	attL	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
WP_000227701.1|3987485_3987797_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000175099.1|3987796_3988123_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000264665.1|3988119_3988770_-	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_001104440.1|3988753_3989494_-	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000793146.1|3989496_3989847_-	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_000194951.1|3989977_3990706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|3990681_3991086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069611.1|3991084_3991300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783854.1|3991490_3992255_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_000031013.1|3992371_3992728_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000123378.1|3992821_3993010_+	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000047759.1|3993062_3993371_+	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000533817.1|3993381_3994302_+	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_001095645.1|3994301_3994619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000186588.1|3994634_3996404_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_000960679.1|3996414_3997581_+	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000843446.1|3997583_3997853_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|3997880_3998411_+	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000632576.1|3998699_3998972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|3998981_3999278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000763554.1|3999292_3999508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|3999504_4000188_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000631813.1|4000184_4000415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000206212.1|4000404_4000611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001170114.1|4000612_4001062_+	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_001281701.1|4001033_4001423_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
4006342:4006357	attR	CGGCGTTGCTGGCTGC	NA	NA	NA	NA
>prophage 9
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	4212749	4258458	5228864	lysis,terminase,head,tail,portal,holin,integrase,tRNA,capsid	Enterobacteria_phage(56.0%)	58	4211067:4211081	4239661:4239675
4211067:4211081	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_001295972.1|4212749_4213856_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|4213909_4214371_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248677.1|4214380_4215034_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|4215205_4216456_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|4216569_4217712_-|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|4217701_4217938_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|4218077_4218317_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|4218300_4218627_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|4218626_4218848_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_021533932.1|4218946_4219228_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000548516.1|4219238_4219430_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|4219402_4219585_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|4219581_4220262_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|4220258_4221044_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995418.1|4221049_4221346_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000233576.1|4221421_4221628_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000858975.1|4222223_4222913_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067458.1|4223017_4223248_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_001182900.1|4223317_4223857_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001435464.1|4223943_4224873_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_000788794.1|4224869_4225571_+	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_022645049.1|4225820_4230086_+	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000700202.1|4230122_4231166_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072147164.1|4231515_4231617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053005.1|4231613_4232069_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_000224914.1|4232068_4232239_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774479.1|4232231_4232522_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_001099488.1|4232518_4232881_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000971096.1|4232877_4233018_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001097224.1|4233014_4233704_+	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000544528.1|4234025_4234331_+|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180486.1|4234317_4234794_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_001228695.1|4235010_4235193_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|4235283_4235577_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|4236057_4236384_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|4236590_4236773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000453620.1|4237336_4237882_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_001027261.1|4237856_4239782_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
4239661:4239675	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
WP_000198149.1|4239778_4239985_+|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001295977.1|4239981_4241583_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000123268.1|4241563_4242883_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295978.1|4242892_4243225_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063293.1|4243280_4244306_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_000158908.1|4244347_4244746_+	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000753018.1|4244757_4245111_+|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000985120.1|4245122_4245701_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000683150.1|4245697_4246093_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_001295979.1|4246100_4246841_+|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000479203.1|4246856_4247279_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_000459457.1|4247260_4247695_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840216.1|4247687_4250249_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000847375.1|4250245_4250575_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_001152626.1|4250574_4251273_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_023146277.1|4251277_4252021_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_023149564.1|4251957_4252560_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_001531667.1|4252620_4256103_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_000290538.1|4256161_4258183_+	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_000654172.1|4258179_4258458_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
>prophage 10
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	4396419	4466134	5228864	terminase,head,tail,portal,protease,holin,transposase,integrase,capsid	Stx2-converting_phage(25.0%)	79	4392593:4392607	4398503:4398517
4392593:4392607	attL	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_000113700.1|4396419_4397550_-|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|4397527_4397776_-	excisionase	NA	NA	NA	NA	NA
WP_016230610.1|4397840_4400312_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
4398503:4398517	attR	ACTCCTTGTTCGGGA	NA	NA	NA	NA
WP_001090200.1|4400404_4400596_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449179.1|4400592_4400781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023142248.1|4401130_4401298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171951.1|4401346_4401565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|4401724_4401880_-	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_000103687.1|4402152_4402869_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000471549.1|4402918_4403134_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000693845.1|4403130_4403556_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095675.1|4403578_4404541_+	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000788950.1|4404547_4405294_+	DNA replication protein DnaC	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000450998.1|4405315_4406086_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_001151161.1|4406101_4406527_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000150294.1|4406701_4407367_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000018429.1|4407547_4407760_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_001329966.1|4407927_4408200_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001265085.1|4408201_4409257_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_000140014.1|4409257_4409638_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.5	2.9e-35
WP_001513213.1|4409634_4410456_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_000917751.1|4410682_4410880_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_000024331.1|4411031_4412081_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_023142244.1|4412882_4413014_+	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000871291.1|4413294_4413630_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_016230612.1|4413890_4415744_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|4415894_4416110_+|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|4416114_4416459_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|4416424_4416697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|4416802_4417336_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_032140280.1|4417890_4417977_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|4418198_4418384_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_000736382.1|4418469_4418685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095741.1|4418883_4419084_-	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000829185.1|4419125_4419491_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000958366.1|4419781_4420345_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_001296023.1|4420341_4422003_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000173031.1|4422066_4424004_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001063099.1|4424048_4424270_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267294.1|4424215_4426801_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125990.1|4426797_4427124_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|4427133_4427484_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|4427480_4427927_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|4427923_4428268_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275441.1|4428334_4429051_+|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_078214786.1|4429065_4429440_+|tail	phage tail protein	tail	A0A0P0ZE84	Stx2-converting_phage	98.4	8.6e-64
WP_001513217.1|4429535_4429745_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000212991.1|4429792_4433035_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_000807937.1|4433027_4433369_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_001296027.1|4433368_4434067_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000194730.1|4434077_4434821_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_061089814.1|4434766_4435399_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000514710.1|4435741_4439215_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
WP_001298859.1|4439855_4441397_+|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001016257.1|4441411_4442158_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_071550361.1|4442619_4445526_+	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001164137.1|4445541_4446069_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_000972097.1|4446099_4446633_-|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_022645053.1|4446634_4447420_-	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_001421220.1|4447647_4447830_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_000240999.1|4448028_4448697_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|4448753_4449023_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_001348267.1|4449434_4449992_-	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_001296031.1|4449988_4450264_-	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_000443082.1|4450639_4451446_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209513.1|4451445_4452639_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195273.1|4452650_4454009_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000763535.1|4454012_4455608_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001194644.1|4455607_4457170_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|4457261_4457306_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285702.1|4457443_4458325_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|4458321_4458942_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001296033.1|4458969_4460865_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|4461077_4461953_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_023141019.1|4462158_4463145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001000715.1|4463154_4463463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278898.1|4463519_4464110_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559273.1|4464106_4464865_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_000422062.1|4465084_4466134_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 11
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	4957303	5046801	5228864	terminase,tail,holin,portal,plate,transposase,integrase,tRNA,capsid	Escherichia_phage(23.26%)	102	5003000:5003059	5046863:5046987
WP_099156422.1|4957303_4958652_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
WP_000568520.1|4958761_4959772_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|4959780_4960392_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_072093883.1|4960530_4960596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024911.1|4960666_4961269_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|4961270_4961792_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|4961826_4962567_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_077249130.1|4962595_4963048_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001258676.1|4963040_4964813_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000891625.1|4965122_4965689_+	hydrolase	NA	NA	NA	NA	NA
WP_000639277.1|4965685_4966504_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|4966556_4966952_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019588.1|4966992_4967736_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000564759.1|4967732_4968704_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000176764.1|4968739_4971169_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_001214293.1|4971193_4972294_-	cytochrome c	NA	NA	NA	NA	NA
WP_001185734.1|4972681_4973428_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001490174.1|4973441_4974008_-	VOC family protein	NA	NA	NA	NA	NA
WP_001025326.1|4974223_4975957_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001202076.1|4976009_4976402_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000066973.1|4976401_4978480_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278946.1|4978472_4979621_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983600.1|4979809_4980454_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|4980464_4980854_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|4980868_4981918_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204320.1|4981920_4982781_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_001296146.1|4983071_4984733_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000147302.1|4984877_4985381_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001531763.1|4985401_4987366_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795641.1|4987370_4988297_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906342.1|4988293_4989181_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|4989307_4989886_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001295647.1|4989888_4990239_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122413.1|4991018_4991447_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001296148.1|4991453_4992878_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001296149.1|4992852_4993653_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_000100203.1|4993819_4994806_-	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187827.1|4994820_4996335_-	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000548680.1|4996404_4997394_-	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000179469.1|4998188_4998692_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000082127.1|4998769_4999021_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|4999135_4999222_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237881.1|4999485_4999809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|4999980_5000478_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|5000515_5000755_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797555.1|5000945_5002157_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|5002207_5002873_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
5003000:5003059	attL	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTA	NA	NA	NA	NA
WP_001296152.1|5003344_5003764_-	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_001531767.1|5004978_5005203_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531768.1|5005364_5005754_-|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001018353.1|5005789_5007430_-	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_000444667.1|5007538_5007820_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000785563.1|5007832_5008345_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000117510.1|5008362_5009865_-|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000626358.1|5009861_5010251_-	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000829621.1|5010250_5011435_-|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000203868.1|5011427_5012054_-|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000633314.1|5012056_5012977_-|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000901289.1|5012973_5013315_-|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000079174.1|5013317_5014220_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000015612.1|5014200_5014737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|5014733_5015414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001531773.1|5015445_5015826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000105179.1|5015822_5016242_-	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001283997.1|5016276_5017311_-|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000206292.1|5017369_5017699_-	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001145892.1|5017698_5019006_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000126513.1|5019005_5020580_-|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_000203897.1|5020576_5020810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000148195.1|5020809_5022672_-|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000168117.1|5022658_5023225_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_001531775.1|5023593_5023839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000734931.1|5023898_5024093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131873.1|5024100_5024580_-	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000172496.1|5024579_5024852_-|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_001294589.1|5024851_5025235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064384.1|5025347_5026019_-	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_000717783.1|5026018_5026312_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000057010.1|5026308_5026905_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_001025459.1|5026982_5027162_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|5027313_5027955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000536919.1|5028198_5028432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|5028830_5029319_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_001138663.1|5029328_5029934_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078214787.1|5032281_5033205_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001531776.1|5033379_5034168_-	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_000661082.1|5034849_5035074_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|5035070_5035382_-	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000918616.1|5035378_5035615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000214056.1|5035616_5036027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085949154.1|5036646_5037793_+|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.3	2.4e-173
WP_001023813.1|5038723_5039479_-	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000943914.1|5039475_5039700_-	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_000431205.1|5039739_5040216_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000360804.1|5040274_5040505_-	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_001296165.1|5040603_5041017_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000388260.1|5042027_5042348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000151806.1|5042378_5044595_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000100753.1|5044591_5045161_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000916334.1|5045160_5045343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000833838.1|5045552_5045816_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_001531780.1|5045784_5046801_+|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
5046863:5046987	attR	ACAAAAAAACCACCCGAAGGTGGTTTCACGACACTGCTTATTGCTTTGATTTTATTCTTATCTTTCCCATGGTACCCGGAGCGGGACTTGAACCCGCACAGCGCGAACGCCGAGGGATTTTAAAT	NA	NA	NA	NA
>prophage 12
NZ_CP018979	Escherichia coli strain Ecol_656 chromosome, complete genome	5228864	5065045	5143178	5228864	terminase,head,tail,protease,portal,holin,transposase,integrase,capsid	Escherichia_phage(40.0%)	94	5099821:5099836	5166180:5166195
WP_001347174.1|5065045_5065570_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
WP_000879824.1|5065726_5066524_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001310919.1|5066533_5067085_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001070440.1|5067253_5067586_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001274299.1|5067929_5068244_-	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000994425.1|5068458_5070117_+	flagellar basal body M-ring protein FliF	NA	NA	NA	NA	NA
WP_000067950.1|5070109_5071105_+	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001282677.1|5071097_5071784_+	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000213308.1|5071783_5073157_+	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_000807584.1|5073175_5073619_+	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000620069.1|5073615_5074743_+	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000133106.1|5074847_5075312_+	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_001295641.1|5075316_5076321_+	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_001282103.1|5076317_5076731_+	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001313947.1|5076733_5077099_+	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001253318.1|5077098_5077836_+	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_000187358.1|5077845_5078115_+	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_000983988.1|5078123_5078909_+	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000103992.1|5079198_5079822_+	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_071524607.1|5079865_5080108_-	protein DsrB	NA	NA	NA	NA	NA
WP_000844800.1|5080216_5080444_+	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000491527.1|5080739_5081555_+	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_001531784.1|5081551_5083246_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009307.1|5083416_5083599_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_032179065.1|5083677_5084595_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|5084767_5085688_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000228686.1|5085676_5086147_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001157265.1|5086127_5087546_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_001296176.1|5087612_5088308_-	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001330593.1|5088347_5088713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824383.1|5089278_5090394_+	outer membrane protein F	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_000218217.1|5090986_5091838_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000826711.1|5091945_5093304_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_001347103.1|5093303_5093975_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000920127.1|5094107_5094521_+	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_000740067.1|5094629_5095634_+	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_001240063.1|5095634_5096270_+	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_099156434.1|5096353_5097702_-|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001007778.1|5097962_5098613_+	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_000355363.1|5099696_5099984_-	hypothetical protein	NA	NA	NA	NA	NA
5099821:5099836	attL	TGCCCGAACATTTCGA	NA	NA	NA	NA
WP_000235978.1|5099994_5100699_-|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	4.6e-58
WP_000654141.1|5100708_5100990_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001554173.1|5100989_5103368_-|tail	phage tail fiber protein	tail	A0A1X7QGG5	Escherichia_phage	76.1	1.9e-185
WP_000526135.1|5103488_5103947_-|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001228252.1|5104143_5104743_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	92.5	3.4e-102
WP_001554175.1|5104810_5108206_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	88.6	0.0e+00
WP_000741570.1|5108266_5108914_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	97.2	6.6e-112
WP_000140743.1|5108811_5109555_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.1e-150
WP_001152448.1|5109560_5110259_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	94.8	3.8e-129
WP_001330090.1|5110258_5110615_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_000224009.1|5110592_5113820_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.7	0.0e+00
WP_071590020.1|5113866_5114127_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	97.7	1.6e-40
WP_001324129.1|5114168_5114555_-|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	8.9e-64
WP_000097526.1|5114554_5115259_-	immunoglobulin domain-containing protein	NA	A0A1B5FP82	Escherichia_phage	94.4	3.7e-116
WP_001206306.1|5115319_5115664_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	97.4	1.4e-55
WP_014639219.1|5115660_5116110_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.5	1.0e-63
WP_001147814.1|5116106_5116445_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	90.2	7.5e-51
WP_000719066.1|5116453_5116771_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766111.1|5116847_5118065_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	4.5e-162
WP_000999828.1|5118079_5118679_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923132.1|5118671_5119898_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	82.6	1.5e-202
WP_001140907.1|5120045_5121803_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	98.9	0.0e+00
WP_001554177.1|5121802_5122285_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	96.9	7.4e-84
WP_001135103.1|5122432_5122783_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	97.4	4.7e-64
WP_000738421.1|5123308_5123602_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|5123692_5123875_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992101.1|5124091_5124625_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.8	1.1e-99
WP_000193269.1|5124688_5125039_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.9e-36
WP_000372595.1|5125043_5125259_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000874243.1|5125566_5125755_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_023281677.1|5126014_5126350_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_000562553.1|5126630_5126762_-	DUF3927 domain-containing protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_021538919.1|5127657_5128479_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	1.5e-76
WP_000139998.1|5128493_5128856_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001296186.1|5128856_5129915_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	7.5e-89
WP_023141427.1|5129916_5130189_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|5130356_5130512_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001224667.1|5131602_5131785_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	96.7	2.0e-26
WP_001296187.1|5131878_5132235_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	3.9e-58
WP_001151210.1|5132292_5132715_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	1.3e-63
WP_000095675.1|5132755_5133718_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693943.1|5133740_5134166_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000391951.1|5134149_5134431_-	hypothetical protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|5134531_5134951_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_000379575.1|5135216_5135372_+	DUF1391 domain-containing protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171947.1|5135531_5135750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|5135753_5135918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|5136317_5136506_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070254.1|5136502_5136694_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_023363203.1|5136786_5139258_+	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.9	3.8e-59
WP_000096342.1|5139316_5139520_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000533615.1|5139519_5140545_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_001311896.1|5140780_5141578_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000060157.1|5141915_5143178_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
5166180:5166195	attR	TGCCCGAACATTTCGA	NA	NA	NA	NA
>prophage 1
NZ_CP018977	Escherichia coli strain Ecol_656 plasmid pEC656_KPC, complete sequence	58431	1635	54051	58431	integrase,transposase,protease	Escherichia_phage(20.0%)	61	NA	NA
WP_001452808.1|1635_2427_-|protease	zinc metalloprotease	protease	NA	NA	NA	NA
WP_016359299.1|2577_3843_-	translesion error-prone DNA polymerase V subunit MucB	NA	F1C5A5	Cronobacter_phage	54.0	4.4e-120
WP_000861760.1|3830_4271_-	translesion error-prone DNA polymerase V autoproteolytic subunit MucA	NA	A0A1W6JNS2	Morganella_phage	48.8	1.2e-27
WP_000447669.1|4686_5112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000881513.1|5169_5574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016359300.1|5583_5823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000545925.1|6707_7004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001750003.1|7000_7360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_013263793.1|7428_7713_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016359303.1|7921_8254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012561131.1|9613_10123_+	antirestriction protein ArdA	NA	NA	NA	NA	NA
WP_012561134.1|10954_11134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020326461.1|11595_11829_-	hypothetical protein	NA	Q6UAT7	Klebsiella_phage	45.5	3.3e-05
WP_012561138.1|12140_12509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561139.1|12510_13227_-	StdB	NA	NA	NA	NA	NA
WP_013279398.1|13235_13622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749975.1|14210_14627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342688.1|14628_16158_+	type IV secretion system DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_012561142.1|16157_19394_+	conjugative relaxase	NA	NA	NA	NA	NA
WP_012561143.1|19393_19792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247892.1|19855_20146_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_001293886.1|20142_20544_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000215515.1|20533_20890_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_000091613.1|21144_21459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094387719.1|21631_22096_-	phospholipase D family protein	NA	A0A1B2LRT6	Wolbachia_phage	36.2	1.9e-20
WP_004152391.1|22120_23836_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|23945_26975_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004199214.1|27081_28107_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|28103_28883_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199234.1|29269_30151_+	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152397.1|30400_31720_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_016359293.1|31996_32176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012561144.1|32175_33171_-	conjugal transfer protein TraG	NA	NA	NA	NA	NA
WP_000101710.1|33212_34373_-	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_019706045.1|34372_35194_-	conjugal transfer protein TraO	NA	NA	NA	NA	NA
WP_000646594.1|35267_35966_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001257173.1|35955_36102_-	conjugal transfer protein TraN	NA	NA	NA	NA	NA
WP_001749958.1|36184_37225_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_001749959.1|37240_37468_-	IncN-type entry exclusion lipoprotein EexN	NA	NA	NA	NA	NA
WP_001749960.1|37475_38189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749961.1|38206_40807_-	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_000496058.1|40806_41124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749962.1|41173_41467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000440698.1|41476_41758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001749963.1|41766_42501_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_024129965.1|42564_42915_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_001749964.1|42930_43275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749965.1|43271_43586_+	KikA protein	NA	NA	NA	NA	NA
WP_001452736.1|43621_43933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001749966.1|43988_44630_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_001749967.1|44634_44841_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001288432.1|45222_46656_+	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.6	7.0e-106
WP_004098817.1|46689_47904_-	type II site-specific deoxyribonuclease	NA	E5E3X4	Burkholderia_phage	42.5	1.2e-34
WP_001389365.1|48164_48929_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_004152787.1|49312_49453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376623.1|49435_49936_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|50063_50903_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|50896_51244_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_004187529.1|51430_51928_-	trimethoprim-resistant dihydrofolate reductase DfrA21	NA	A0A076GDN3	Bacillus_phage	36.2	4.9e-22
WP_000845048.1|52075_53089_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_016359304.1|53481_54051_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	42.6	9.8e-35
