The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	482877	496060	4708839		Escherichia_phage(50.0%)	12	NA	NA
WP_001295182.1|482877_483639_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
WP_000254708.1|483632_484259_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|484398_485538_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|485600_486593_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104441.1|486686_488051_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136934.1|488139_488916_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|488920_489559_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590403.1|489555_490818_-	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.7e-135
WP_000847985.1|490814_491723_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001272547.1|491888_492686_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.0	1.3e-69
WP_001141322.1|492736_493393_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001272898.1|493498_496060_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.3e-30
>prophage 2
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	576952	585385	4708839	integrase	Salmonella_phage(76.92%)	13	575251:575288	584333:584370
575251:575288	attL	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_032260686.1|576952_577972_-|integrase	site-specific integrase	integrase	E5G6L0	Salmonella_phage	95.3	1.7e-191
WP_032260684.1|577975_578608_-	phage repressor protein	NA	A0A1S6KZZ7	Salmonella_phage	57.1	2.2e-64
WP_000102105.1|578724_578967_+	Rha family transcriptional regulator	NA	A0A1S6KZZ6	Salmonella_phage	97.5	6.8e-38
WP_032260683.1|578999_579509_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	94.7	6.6e-83
WP_000956182.1|579516_579717_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_001311552.1|579680_580022_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_032434758.1|580089_580323_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	98.7	4.9e-33
WP_000752613.1|580322_580550_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_078232680.1|580546_581404_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	96.8	5.1e-160
WP_078232681.1|582458_583406_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	90.5	2.1e-154
WP_000980501.1|583474_583693_+	transcriptional regulator	NA	Q53ZE7	Salmonella_virus	77.8	7.5e-28
WP_021534458.1|583719_584202_-	hypothetical protein	NA	Q19UP0	Mannheimia_phage	34.3	1.6e-17
WP_000162569.1|584902_585385_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	45.7	6.8e-29
584333:584370	attR	GCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
>prophage 3
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	1090319	1099760	4708839		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569356.1|1090319_1091246_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
WP_000783120.1|1091250_1091982_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1091962_1092070_-	protein YohO	NA	NA	NA	NA	NA
WP_021570169.1|1092129_1092861_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	1.4e-110
WP_001295431.1|1093082_1094768_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1094764_1095484_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_000950409.1|1095530_1096001_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	5.2e-82
WP_001295429.1|1096040_1096502_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001774944.1|1096626_1098627_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_001774943.1|1098623_1099760_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 4
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	1620968	1668849	4708839	integrase,protease,tail,lysis,holin,transposase	Enterobacteria_phage(25.0%)	55	1628544:1628560	1657187:1657203
WP_001260865.1|1620968_1621790_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|1621889_1621973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743957.1|1622065_1622401_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091840.1|1622797_1624051_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019525.1|1624157_1625051_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225262.1|1625185_1626406_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|1626530_1627226_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071826094.1|1627178_1628471_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
1628544:1628560	attL	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000148710.1|1628629_1629244_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526503.1|1629286_1630141_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|1630142_1630760_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001340362.1|1630770_1633194_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_077785974.1|1633254_1634364_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	47.1	2.4e-85
WP_162782303.1|1634346_1635939_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_077260224.1|1637592_1638276_+	hypothetical protein	NA	Q5MBW0	Stx1-converting_phage	56.2	9.3e-16
WP_048987007.1|1638590_1639100_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048987006.1|1639164_1640154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078232728.1|1640824_1642282_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.9	3.9e-120
WP_078232730.1|1642480_1642786_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|1642893_1643604_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|1643606_1644167_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|1644201_1644543_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|1644677_1645004_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001457992.1|1645209_1646424_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	28.8	1.5e-45
WP_000836066.1|1646435_1647455_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_021531328.1|1647512_1647623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|1647642_1648923_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_001296941.1|1648957_1649194_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.7	6.1e-15
WP_000048324.1|1649281_1651753_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	8.5e-59
WP_001083280.1|1651846_1652038_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_078232888.1|1652034_1652202_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_114145436.1|1652188_1652326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047135.1|1652941_1653694_+	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_120795389.1|1653971_1654061_-	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_000087756.1|1654115_1654328_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_000066484.1|1654628_1654844_+	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_078232732.1|1655597_1655813_+|holin	holin	holin	A5LH82	Enterobacteria_phage	93.0	5.5e-31
WP_078232734.1|1655817_1656132_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	92.3	1.1e-48
WP_001092965.1|1656187_1656721_+	lysozyme	NA	Q08J98	Stx2-converting_phage	92.7	9.9e-98
WP_001071777.1|1656717_1657215_+	DUF2514 domain-containing protein	NA	NA	NA	NA	NA
1657187:1657203	attR	CTTTAAGAGATAAAAAA	NA	NA	NA	NA
WP_000066495.1|1657578_1657791_+	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_071526745.1|1657801_1657990_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001443523.1|1658136_1658292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001019207.1|1658464_1658638_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_020239410.1|1658933_1659140_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	79.4	3.4e-22
WP_032145128.1|1659390_1659585_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	95.2	1.6e-26
WP_000453617.1|1659973_1660519_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	6.8e-94
WP_001439069.1|1661917_1662493_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	5.5e-102
WP_000078178.1|1662590_1663181_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836768.1|1663497_1663731_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1663799_1663913_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000878218.1|1665668_1666535_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	2.3e-51
WP_000169527.1|1666531_1666831_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000527806.1|1667149_1668610_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|1668645_1668849_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 5
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	2056035	2108312	4708839	capsid,terminase,integrase,protease,head,portal,tail,tRNA,holin	Escherichia_phage(47.83%)	63	2064227:2064241	2108414:2108428
WP_001297484.1|2056035_2057142_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001340977.1|2057177_2057819_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423742.1|2057822_2059193_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001265471.1|2059361_2060033_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735411.1|2060032_2061493_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_025269739.1|2061568_2062690_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359441.1|2062738_2063965_-	peptidase T	NA	NA	NA	NA	NA
WP_000531601.1|2064214_2065351_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	9.4e-29
2064227:2064241	attL	AAAAAATTGAATAAA	NA	NA	NA	NA
WP_000799406.1|2065334_2066198_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_123010489.1|2066752_2067421_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_078232758.1|2067658_2071435_-	peptidase S74	NA	A0A2D1UII2	Escherichia_phage	83.1	0.0e+00
WP_024250642.1|2071499_2072099_-	Ail/Lom family outer membrane beta-barrel protein	NA	A5LH44	Enterobacteria_phage	96.5	1.2e-107
WP_061349347.1|2072165_2075648_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	91.0	0.0e+00
WP_032338103.1|2075708_2076356_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_061349346.1|2076253_2076997_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.9e-151
WP_021570076.1|2077002_2077701_-|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	97.8	1.8e-131
WP_001330090.1|2077700_2078057_-|tail	tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	66.7	2.8e-40
WP_078232760.1|2078034_2081262_-|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.4	0.0e+00
WP_074185540.1|2081308_2081569_-	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	96.5	1.0e-39
WP_077249358.1|2081610_2081997_-|tail	phage tail protein	tail	A0A1B5FP91	Escherichia_phage	99.2	2.6e-63
WP_024241194.1|2081996_2082701_-|tail	tail protein	tail	A0A1B5FP82	Escherichia_phage	93.2	5.0e-113
WP_001206307.1|2082760_2083105_-	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	96.5	3.9e-55
WP_000968644.1|2083101_2083551_-	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	81.2	6.1e-64
WP_021570071.1|2083547_2083886_-|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	89.3	1.7e-50
WP_000719066.1|2083894_2084212_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	50.5	6.2e-23
WP_000766109.1|2084288_2085506_-|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	71.6	5.9e-162
WP_000999828.1|2085520_2086120_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	1.9e-89
WP_000923134.1|2086112_2087339_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	83.3	3.7e-204
WP_001140892.1|2087486_2089244_-|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.3	0.0e+00
WP_001333563.1|2089243_2089726_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	98.1	8.7e-85
WP_001135104.1|2089873_2090224_-	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	96.6	8.0e-64
WP_000738421.1|2090749_2091043_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_075202333.1|2091133_2091316_-	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	77.0	2.2e-17
WP_000992097.1|2091532_2092066_-	lysozyme	NA	Q08J98	Stx2-converting_phage	93.2	1.5e-98
WP_000193264.1|2092129_2092480_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	1.4e-36
WP_000372595.1|2092484_2092700_-|holin	holin	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_001333561.1|2092849_2093011_-	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	87.0	5.9e-14
WP_000874243.1|2093007_2093196_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	95.2	7.2e-27
WP_053920480.1|2093456_2093792_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	1.4e-44
WP_072280667.1|2093862_2094075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106104550.1|2094563_2094650_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000762879.1|2095044_2095866_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	5.1e-77
WP_000139999.1|2095862_2096243_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	1.3e-35
WP_001221526.1|2096243_2097302_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.0	7.5e-89
WP_032155008.1|2097303_2097582_-	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	6.1e-06
WP_001013636.1|2097749_2097962_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	96.9	8.9e-26
WP_011076332.1|2098164_2098383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061349399.1|2098817_2099003_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.5	3.9e-25
WP_001224662.1|2098995_2099178_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_072280668.1|2099271_2099685_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.0e-57
WP_001151150.1|2099685_2100108_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|2100148_2101219_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693853.1|2101290_2101716_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001072337.1|2101712_2101967_-	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	60.3	2.8e-18
WP_000233320.1|2102046_2102466_+	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	47.5	4.2e-19
WP_001092153.1|2102902_2103103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|2103195_2103414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|2103378_2103582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|2103982_2104171_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070255.1|2104167_2104359_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|2104452_2106894_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|2106955_2107225_+	excisionase	NA	NA	NA	NA	NA
WP_078232762.1|2107193_2108312_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z04	Phage_21	43.9	2.9e-83
2108414:2108428	attR	AAAAAATTGAATAAA	NA	NA	NA	NA
>prophage 6
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	2201026	2209474	4708839	transposase	Escherichia_phage(71.43%)	10	NA	NA
WP_032247122.1|2201026_2202076_+	ferric ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	37.6	4.9e-32
WP_000081352.1|2202184_2203117_-	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_001373486.1|2203103_2204507_-	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_012372828.1|2204714_2205731_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	4.9e-186
WP_001513659.1|2205958_2206276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513660.1|2206562_2206922_-	hypothetical protein	NA	A0A077SLM1	Escherichia_phage	98.9	5.0e-45
WP_001513661.1|2206949_2207129_-	hypothetical protein	NA	Q71TH5	Escherichia_phage	96.6	3.5e-23
WP_001216034.1|2207133_2207514_-	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A077SK56	Escherichia_phage	100.0	1.1e-63
WP_001190712.1|2207513_2207735_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	100.0	6.7e-32
WP_001617892.1|2207917_2209474_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	42.7	3.2e-104
>prophage 7
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	2365646	2454228	4708839	plate,lysis,capsid,terminase,protease,head,portal,tail,tRNA,integrase,transposase	Salmonella_phage(59.65%)	89	2358609:2358624	2457173:2457188
2358609:2358624	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_078232772.1|2365646_2366939_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.6	1.9e-94
WP_000067755.1|2367029_2368373_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|2368383_2368995_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_052921291.1|2369149_2373139_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|2373273_2373768_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537403.1|2374312_2375278_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001543600.1|2375400_2377167_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_025269752.1|2377167_2378889_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	6.4e-21
WP_001241678.1|2378930_2379635_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|2379919_2380138_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934040.1|2380938_2383215_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.2	2.5e-166
WP_000520781.1|2383245_2383566_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000410785.1|2383888_2384113_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188140.1|2384185_2386132_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000746460.1|2386128_2387244_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_001355621.1|2387394_2388351_+	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000599806.1|2388347_2390006_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001338421.1|2391583_2392483_+	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_000458809.1|2392626_2394279_+	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000178677.1|2394290_2395259_+	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000815362.1|2395391_2397110_+	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.0	5.2e-31
WP_000566376.1|2397146_2398148_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_001136554.1|2398158_2399589_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001338420.1|2399687_2400701_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_025269753.1|2400697_2401528_-	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001160737.1|2401524_2401848_-	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001270734.1|2401973_2402489_+	lipoprotein	NA	NA	NA	NA	NA
WP_000027205.1|2402706_2403435_+	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_000756569.1|2403452_2404184_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001001691.1|2404190_2404907_+	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000464491.1|2404906_2405575_+	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001295339.1|2405865_2406597_+	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001149756.1|2406795_2407923_-	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.0	6.0e-28
WP_000389260.1|2407963_2408452_-	YbjO family protein	NA	NA	NA	NA	NA
WP_001061665.1|2408511_2409357_-	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_001093854.1|2409353_2410307_-	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_000996005.1|2410316_2411450_-	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000126073.1|2411544_2412657_-	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000203025.1|2413007_2413484_-	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000684321.1|2413571_2414474_-	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_078232774.1|2414534_2415257_-	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_001201560.1|2415240_2415528_-	DUF1418 family protein	NA	NA	NA	NA	NA
WP_001195231.1|2415687_2415945_+	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	63.1	7.8e-24
WP_000681108.1|2415974_2416352_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020239548.1|2416621_2418307_+	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000972391.1|2418542_2418761_-	transcriptional activator Ogr/delta	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_078232776.1|2418851_2419952_-	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	86.9	7.1e-175
WP_078232778.1|2419948_2420434_-|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.0	8.3e-67
WP_078232781.1|2420430_2423508_-|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	62.1	0.0e+00
WP_000763311.1|2423500_2423620_-|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	2.8e-13
WP_001281009.1|2423634_2423937_-|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	89.0	5.3e-40
WP_001207665.1|2423991_2424507_-|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	6.2e-89
WP_000046130.1|2424516_2425689_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.0	3.0e-203
WP_000994392.1|2425795_2426209_-|tail	tail fiber assembly protein	tail	U5P0S4	Shigella_phage	71.6	5.8e-21
WP_078232782.1|2426208_2428524_-|tail	phage tail protein	tail	A0A0F7LDR4	Escherichia_phage	47.1	6.3e-80
WP_078232784.1|2428520_2429126_-|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	8.9e-111
WP_078232786.1|2429118_2430027_-|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.4	1.0e-142
WP_023147319.1|2430013_2430373_-	lysozyme	NA	A0A1S6KZZ4	Salmonella_phage	85.7	6.1e-51
WP_047204264.1|2430369_2430948_-|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	87.0	5.5e-94
WP_001513684.1|2431032_2432322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001513682.1|2432368_2432815_-	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.9e-62
WP_001039945.1|2432807_2433239_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	94.4	4.4e-72
WP_001513680.1|2433334_2433763_-|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	74.5	7.1e-46
WP_001513679.1|2433759_2434137_-	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	36.3	9.7e-15
WP_001513678.1|2434138_2434651_-	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	9.0e-88
WP_000171568.1|2434631_2434847_-	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_000868175.1|2434850_2435054_-|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_016237793.1|2435053_2435518_-|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	2.4e-76
WP_000059204.1|2435613_2436264_-|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	95.8	1.5e-111
WP_024224403.1|2436267_2437326_-|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	3.8e-181
WP_032307922.1|2437342_2438176_-|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	8.2e-123
WP_078232788.1|2438318_2440085_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_078232790.1|2440084_2441134_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.0	1.2e-171
WP_001300563.1|2441335_2442448_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_078232792.1|2442521_2444714_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_001513123.1|2444706_2445789_-	AAA family ATPase	NA	M4QMW8	Micromonas_pusilla_virus	32.9	4.3e-15
WP_001217575.1|2446203_2446437_-	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_001154434.1|2446447_2446636_-	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_078232794.1|2446788_2449203_-	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.5	0.0e+00
WP_032427919.1|2449199_2450057_-	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	95.8	5.6e-159
WP_000752613.1|2450053_2450281_-	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_032427918.1|2450280_2450514_-	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	94.8	7.8e-31
WP_000996717.1|2450581_2450923_-	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_000956176.1|2451040_2451337_-	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	90.4	4.9e-22
WP_000460893.1|2451344_2451854_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_001247707.1|2451886_2452108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047324.1|2452233_2452803_+	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	42.9	4.2e-38
WP_001321204.1|2452818_2453010_+	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_078232795.1|2453196_2454228_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	55.8	9.5e-105
2457173:2457188	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 8
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	3042622	3089629	4708839	terminase,integrase,protease,lysis,holin	Enterobacteria_phage(31.75%)	71	3042329:3042377	3085725:3085773
3042329:3042377	attL	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_072651276.1|3042622_3042754_+|integrase	integrase	integrase	A5VW56	Enterobacteria_phage	93.1	4.0e-08
WP_059334147.1|3042806_3043838_-	hypothetical protein	NA	A0A0U2SAV1	Escherichia_phage	37.9	7.3e-12
WP_078232815.1|3043849_3044167_-	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	49.0	6.9e-22
WP_025270003.1|3044280_3044460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162782304.1|3044468_3046553_-	hypothetical protein	NA	A0A0C5Q3X6	Klebsiella_phage	47.3	7.1e-107
WP_016244718.1|3046611_3046809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078232816.1|3046808_3047678_-	hypothetical protein	NA	A0A2H4IYR0	uncultured_Caudovirales_phage	62.7	9.1e-32
WP_004152575.1|3047677_3048451_-	DUF2612 domain-containing protein	NA	A0A2H4J1A9	uncultured_Caudovirales_phage	54.4	2.8e-77
WP_078232817.1|3048447_3049644_-	hypothetical protein	NA	A0A0M4RD32	Salmonella_phage	72.9	3.0e-158
WP_004152573.1|3049643_3049997_-	hypothetical protein	NA	A0A2H4J629	uncultured_Caudovirales_phage	80.3	2.3e-50
WP_000539208.1|3049996_3050728_-	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	72.8	4.7e-98
WP_000506882.1|3050815_3051133_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_000734772.1|3051163_3051496_-	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	64.5	3.4e-19
WP_078232818.1|3051492_3052560_-	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	68.5	4.0e-138
WP_020804067.1|3052562_3052790_-	hypothetical protein	NA	A0A2H4J495	uncultured_Caudovirales_phage	52.0	5.6e-18
WP_000353827.1|3052865_3053441_-	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	66.0	5.0e-63
WP_052921361.1|3053440_3055357_-	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	58.4	3.3e-199
WP_016244729.1|3055346_3055499_-	hypothetical protein	NA	A0A2H4J1A2	uncultured_Caudovirales_phage	84.0	1.4e-17
WP_029363719.1|3055540_3055960_-	hypothetical protein	NA	A0A2H4J2V6	uncultured_Caudovirales_phage	65.2	1.5e-40
WP_029363718.1|3055963_3056407_-	DUF3277 family protein	NA	A0A0M5M1K6	Salmonella_phage	80.0	3.3e-62
WP_078232819.1|3056416_3057562_-	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	76.1	2.7e-164
WP_004152176.1|3057565_3058006_-	hypothetical protein	NA	A0A2H4J1A0	uncultured_Caudovirales_phage	51.7	1.6e-40
WP_023312779.1|3058100_3058487_-	hypothetical protein	NA	A0A2H4J1A4	uncultured_Caudovirales_phage	79.0	2.8e-49
WP_078232820.1|3058486_3058993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000113538.1|3058989_3059409_-	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	60.7	3.3e-40
WP_000725700.1|3059377_3059659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078232821.1|3059698_3060640_-	DUF2184 domain-containing protein	NA	A0A2H4J191	uncultured_Caudovirales_phage	77.1	1.7e-137
WP_029363699.1|3060651_3061146_-	hypothetical protein	NA	A0A2H4JHM9	uncultured_Caudovirales_phage	62.1	2.1e-49
WP_064733417.1|3061149_3062352_-	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	49.5	3.7e-100
WP_029363697.1|3062407_3062830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050008874.1|3062868_3063417_-	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	55.8	5.3e-46
WP_078232822.1|3063472_3064924_-	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	69.0	1.9e-191
WP_078232823.1|3064927_3066541_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	86.2	1.4e-283
WP_001218991.1|3066543_3067095_-|terminase	terminase small subunit	terminase	G0ZND3	Cronobacter_phage	69.8	7.2e-67
WP_029487544.1|3067122_3067332_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_032317197.1|3067379_3067616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001059339.1|3067746_3068271_-	Rha family transcriptional regulator	NA	G8C7W4	Escherichia_phage	94.2	4.5e-87
WP_078232824.1|3068476_3068935_-|lysis	lysis protein	lysis	K7PJW6	Enterobacteria_phage	78.9	4.0e-55
WP_000229394.1|3068931_3069408_-	glycoside hydrolase family protein	NA	K7PKI0	Enterobacteria_phage	100.0	1.3e-88
WP_000783734.1|3069391_3069715_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|3070077_3070701_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_078232825.1|3070697_3071363_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	97.7	2.7e-129
WP_021552626.1|3071359_3071971_-	recombination protein NinG	NA	K7PHM2	Enterobacterial_phage	99.0	5.1e-98
WP_000566868.1|3071963_3072134_-	protein ninF	NA	Q8H9Z5	Enterobacteria_phage	98.2	1.2e-25
WP_001254257.1|3072130_3072313_-	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	4.3e-29
WP_000153280.1|3072309_3072837_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_016063039.1|3072833_3073274_-	recombination protein NinB	NA	K7PGZ3	Enterobacteria_phage	100.0	1.6e-80
WP_078232826.1|3073347_3074724_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.6	6.3e-253
WP_001608293.1|3074720_3075542_-	replication protein	NA	K7PJZ3	Enterobacterial_phage	99.6	2.0e-153
WP_000536663.1|3075724_3076006_-	hypothetical protein	NA	K7PMG0	Enterobacteria_phage	98.9	7.4e-44
WP_059334175.1|3076122_3076338_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	97.2	2.4e-34
WP_001519589.1|3076413_3077109_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_078232827.1|3077495_3077864_+	antitermination protein	NA	Q716D8	Shigella_phage	99.1	3.2e-55
WP_000915090.1|3077872_3078010_+	hypothetical protein	NA	Q716D9	Shigella_phage	100.0	1.3e-22
WP_000167585.1|3078064_3078535_+	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	99.4	1.1e-87
WP_078232828.1|3078677_3079646_+	cell envelope biogenesis protein TolA	NA	K7P6J9	Enterobacteria_phage	99.1	1.4e-54
WP_000638547.1|3079670_3079802_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243356.1|3079786_3079939_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	98.0	1.8e-20
WP_000365280.1|3080193_3080901_+	recombinase	NA	K7PKU3	Enterobacteria_phage	100.0	7.6e-138
WP_000168274.1|3080901_3081408_+	single-stranded DNA-binding protein	NA	K7PHK1	Enterobacteria_phage	100.0	2.3e-80
WP_001016185.1|3081416_3081965_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	98.4	1.6e-103
WP_040062513.1|3081981_3082278_+	DUF2856 family protein	NA	Q76H42	Enterobacteria_phage	89.8	5.6e-42
WP_001214452.1|3082288_3082453_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	98.1	4.6e-22
WP_059334192.1|3082449_3082962_+	hypothetical protein	NA	K7P858	Enterobacteria_phage	77.3	1.0e-67
WP_078232829.1|3082958_3083534_+	DUF551 domain-containing protein	NA	A0A088CPS0	Enterobacteria_phage	93.0	4.4e-99
WP_032229698.1|3083530_3083791_+	hypothetical protein	NA	A0A1B1W289	Salmonella_phage	97.6	9.3e-41
WP_078232830.1|3083898_3084243_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	97.4	3.8e-58
WP_078232831.1|3084552_3085713_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	99.7	3.4e-228
WP_000893278.1|3085917_3087171_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
3085725:3085773	attR	AAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3087182_3088286_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3088573_3089629_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 9
NZ_CP018995	Escherichia coli strain Ecol_AZ147 chromosome, complete genome	4708839	3489432	3499602	4708839	transposase	Enterobacteria_phage(50.0%)	11	NA	NA
WP_000684856.1|3489432_3490389_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|3490389_3491157_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|3491714_3491972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000747102.1|3493105_3493456_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|3493556_3494129_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|3494177_3495002_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
WP_000016230.1|3495907_3498238_-	DNA primase	NA	Q7M2A8	Enterobacteria_phage	73.2	0.0e+00
WP_000842357.1|3498252_3498576_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001014981.1|3498575_3498797_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000982476.1|3498796_3499342_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	65.7	7.7e-29
WP_000543726.1|3499341_3499602_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	66.3	1.3e-23
>prophage 1
NZ_CP018994	Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence	154853	6101	22452	154853	integrase,transposase	Salmonella_phage(30.0%)	17	NA	NA
WP_000844627.1|6101_6344_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_001138014.1|6401_9368_-|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001161490.1|9371_9932_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001323888.1|9920_10088_+	hypothetical protein	NA	A0A1B0V7I9	Salmonella_phage	98.2	2.3e-24
WP_000454193.1|10107_10458_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|10660_11674_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001317507.1|11829_12303_+	trimethoprim-resistant dihydrofolate reductase DfrA5	NA	G3MBI7	Bacillus_virus	27.7	1.0e-13
WP_001067855.1|12454_13159_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|13743_14604_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001387387.1|14753_15155_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067855.1|15201_15906_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001518958.1|16661_17564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001043265.1|17820_18636_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	3.5e-09
WP_001082319.1|18696_19500_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|19499_20336_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|20396_21101_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000935452.1|21147_22452_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018994	Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_1, complete sequence	154853	76867	126230	154853	integrase,transposase,protease	Macacine_betaherpesvirus(25.0%)	31	83598:83612	116619:116633
WP_000082154.1|76867_77839_+|transposase	IS110-like element ISEc32 family transposase	transposase	Q75QL1	Wolbachia_phage	32.1	1.1e-25
WP_000092896.1|78099_78312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000343071.1|78324_78900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000817028.1|79946_80918_-	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	96.6	8.8e-169
WP_001238646.1|80917_82084_-	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	99.7	1.6e-228
83598:83612	attL	AATACCGGTCAGAAC	NA	NA	NA	NA
WP_000973517.1|83605_85807_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|85888_87166_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015721.1|87162_88905_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_000011907.1|88904_89852_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_000602863.1|89852_91577_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000095526.1|91712_92906_+	MFS transporter	NA	NA	NA	NA	NA
WP_001318207.1|93285_93666_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	55.0	1.9e-26
WP_000968139.1|94908_95766_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000992806.1|95762_96620_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983710.1|96616_97444_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A1M7XV31	Cedratvirus	27.0	3.6e-14
WP_001514243.1|97443_98358_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_000361611.1|101339_102317_+	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	63.9	4.6e-101
WP_001514245.1|102601_103342_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.2e-24
WP_001332052.1|103462_103651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000175738.1|104024_104933_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|104995_106105_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_000280980.1|106537_107491_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|108763_108922_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_085949156.1|109105_110318_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_001189123.1|110890_112399_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_000928804.1|114042_115230_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733252.1|115226_117167_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	3.0e-35
116619:116633	attR	GTTCTGACCGGTATT	NA	NA	NA	NA
WP_001312828.1|117170_118541_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|119337_120279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|122539_123733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085974881.1|124956_126230_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.7	1.1e-174
>prophage 1
NZ_CP018993	Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_2, complete sequence	116562	7875	64741	116562	transposase,integrase	Escherichia_phage(28.57%)	47	16109:16168	60672:61492
WP_001164198.1|7875_8655_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_000465035.1|8656_9037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261276.1|9610_9841_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000754566.1|9837_10254_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_000480968.1|11371_12208_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|12207_13011_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_085959879.1|13117_14247_-|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_000904906.1|14311_14926_-	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
16109:16168	attL	GGGCACTGTTGCAAAGTTAGCGATGAGGCAGCCTTTTGTCTTATTCAAAGGCCTTACGTT	NA	NA	NA	NA
WP_001067856.1|16161_16866_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_001199192.1|16979_17756_+	aminoglycoside N-acetyltransferase AAC(3)-IV	NA	NA	NA	NA	NA
WP_000742814.1|17984_19010_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|19431_20184_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_001067858.1|24719_25424_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_011058339.1|28653_28740_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_000691727.1|28755_30675_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_077248882.1|30772_30880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063096336.1|31328_32189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063101691.1|32287_32800_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_063101692.1|32826_33495_-	recombinase family protein	NA	NA	NA	NA	NA
WP_078232637.1|33643_36622_+|transposase	Tn3-like element TnEc1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.2	9.9e-296
WP_001105066.1|36848_37130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000421259.1|37235_37511_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001178087.1|37510_37795_-	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000907852.1|38698_39730_-	replication initiation protein	NA	NA	NA	NA	NA
WP_001324596.1|40702_40966_+	hypothetical protein	NA	Q7M2A7	Enterobacteria_phage	54.0	6.1e-08
WP_000483804.1|40934_41171_+	conjugal transfer protein TraA	NA	NA	NA	NA	NA
WP_001372168.1|41612_42146_+	transcription termination factor NusG	NA	NA	NA	NA	NA
WP_000213863.1|42399_43083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001136187.1|43254_43509_+	PilI type IV pilus biogenesis protein	NA	NA	NA	NA	NA
WP_001442752.1|44260_45328_+	type IV pilus biogenesis lipoprotein PilL	NA	NA	NA	NA	NA
WP_000539811.1|45327_45765_+	type IV pilus biogenesis protein PilM	NA	NA	NA	NA	NA
WP_000748143.1|45778_47461_+	PilN family type IVB pilus formation outer membrane protein	NA	NA	NA	NA	NA
WP_000752776.1|47453_48749_+	type 4b pilus protein PilO2	NA	NA	NA	NA	NA
WP_001247333.1|48735_49188_+	type IV pilus biogenesis protein PilP	NA	NA	NA	NA	NA
WP_000362204.1|49198_50752_+	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_001208803.1|50764_51850_+	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_000908228.1|51866_52481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000014005.1|52490_53051_+	lytic transglycosylase domain-containing protein	NA	A0A0A8J856	Ralstonia_phage	33.7	6.1e-05
WP_001193551.1|53035_53692_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_039719938.1|53691_54984_+	shufflon system plasmid conjugative transfer pilus tip adhesin PilV	NA	NA	NA	NA	NA
WP_001349157.1|54980_55229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001352368.1|56747_57956_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001139955.1|58086_59241_+|integrase	integrase	integrase	B5WZU7	Pseudomonas_phage	43.0	1.0e-46
WP_001067856.1|59973_60678_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	6.9e-139
WP_023300759.1|60901_62116_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
60672:61492	attR	AACGTAAGGCCTTTGAATAAGACAAAAGGCTGCCTCATCGCTAACTTTGCAACAGTGCCCGACTGGCTGATACCAAGTGCCTTGGCCGCATGCCGAAAATTCAGATGCTCGGCGACGGCGATGAACTGAACAAGGGAAATGAGCGGTATCCTGCCAGACAGGATACCGACATTCACGAGGTTTCGATGGTTAGTGCGCCGCATCGGAGCGGGCCTGCTACCAGTCGTCGGTTAGACGACTGGCGACTTCTCGGTGGCAGCCCCACGGAGCCGAAGGAGCACCAGCCCCAACGAAACCAGTACCGCCATCGCCGTGGCGTAACAGATCACGGGCCACGCTGTGTCACCGTTTAAAAGTGCCACCGCCAATGTCCCGACAATGCTGACTATCAGGCTTTGAACGCAGAAGTAGAACGCGACCGCTGATCCCGCGATGTCGTCGAACTCTGCCAAAGCGCCGTTCGCGGTAACGGACACCGTGAAGACAATACCGACCGCGACAACCCACATCGGTAGGATGAAGGTGAGGAATGACGGCGAGCCGTAAAGTTCGCCGATCCCCAACAGGACCGCTCCGCAAACAAGCAACGCCATCCCACGCGCCACGCATCCTGCGATGCCCCATCTGGCGACAAAGGACTTCGCGAAACGGGTTGTCACGATCATTACAAGCGCGACAGTGGCGAAGGCAAAGCTGAATCCGATCTCGGAATATTCCGCTTGGCCTATGAGCACACGGGGAGCCGTCGAGAAGAAGACGAAGTAGGTGCCCATACCGGCGCTAAAGCCGACAGTGTAAACCCAAAAAGCCGGACTCGCGAA	NA	NA	NA	NA
WP_001447541.1|62332_63217_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|63247_64741_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
>prophage 1
NZ_CP018992	Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence	110226	58528	75125	110226	integrase,transposase	Escherichia_phage(28.57%)	10	58193:58206	60655:60668
58193:58206	attL	GTAGCGTTCATGCT	NA	NA	NA	NA
WP_004152391.1|58528_60244_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_004152392.1|60353_63383_+|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
60655:60668	attR	AGCATGAACGCTAC	NA	NA	NA	NA
WP_004199214.1|63489_64515_+|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152394.1|64511_65291_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004152396.1|65578_66460_+	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152397.1|66709_68029_-|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152398.1|68305_69490_-|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152400.1|69993_70353_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152402.1|71518_72139_-	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152403.1|72227_75125_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
>prophage 2
NZ_CP018992	Escherichia coli strain Ecol_AZ147 plasmid pECAZ147_KPC, complete sequence	110226	96960	109052	110226		Enterobacteria_phage(25.0%)	13	NA	NA
WP_004152345.1|96960_98988_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	26.6	2.1e-26
WP_004227314.1|99099_99315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152347.1|99539_99872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152348.1|100248_101223_-	ParB/RepB/Spo0J family partition protein	NA	Q1MVJ4	Enterobacteria_phage	62.3	1.4e-105
WP_004152349.1|101219_102425_-	ParA family protein	NA	Q1MVJ3	Enterobacteria_phage	89.0	7.3e-205
WP_004152350.1|102746_103643_-	RepB family plasmid replication initiator protein	NA	Q71TL8	Escherichia_phage	53.8	3.3e-69
WP_004152351.1|104043_105315_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	3.6e-154
WP_004152352.1|105314_105746_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.5	1.0e-28
WP_004152353.1|105977_106949_+	mediator of plasmid stability	NA	A0A222YXF2	Escherichia_phage	46.8	1.1e-73
WP_004152354.1|106951_107623_+	mediator of plasmid stability	NA	NA	NA	NA	NA
WP_001568040.1|107683_107914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014343518.1|108032_108149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152355.1|108350_109052_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.7	7.1e-27
