The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019008	Escherichia coli strain Ecol_AZ159 chromosome, complete genome	4926149	1343600	1350740	4926149		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|1343600_1344239_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|1344235_1345498_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|1345494_1346403_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|1346598_1347366_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|1347416_1348073_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|1348178_1350740_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 2
NZ_CP019008	Escherichia coli strain Ecol_AZ159 chromosome, complete genome	4926149	1927273	1936718	4926149		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|1927273_1928200_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|1928204_1928936_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1928916_1929024_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1929083_1929815_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1930036_1931722_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1931718_1932438_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1932484_1932955_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1932995_1933457_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|1933581_1935585_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|1935581_1936718_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 3
NZ_CP019008	Escherichia coli strain Ecol_AZ159 chromosome, complete genome	4926149	1952524	2016162	4926149	integrase,head,capsid,terminase,tRNA,tail,lysis,portal,holin,plate	Escherichia_phage(37.21%)	69	1979863:1979890	2011848:2011875
WP_001296226.1|1952524_1954558_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	2.3e-54
WP_001005448.1|1954689_1955799_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001046487.1|1956061_1956343_+	YehE family protein	NA	NA	NA	NA	NA
WP_000830464.1|1956635_1957178_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677331.1|1957258_1957933_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945369.1|1957948_1960429_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000405718.1|1960444_1961479_+	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_000153067.1|1961560_1961899_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134616.1|1962117_1962942_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1963062_1963335_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_001195621.1|1963557_1964346_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822280.1|1964342_1965143_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001296225.1|1965207_1966026_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
WP_000434047.1|1966077_1966824_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011972.1|1966797_1967763_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846228.1|1967759_1968764_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858523.1|1968760_1970038_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129562.1|1970294_1971347_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289802.1|1971573_1972428_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853832.1|1972456_1973719_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182880.1|1973728_1974181_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823284.1|1974211_1974496_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_061157925.1|1974499_1975855_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844234.1|1975902_1976943_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178556.1|1977042_1977822_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807341.1|1977903_1978803_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_001441996.1|1979217_1979535_+	hypothetical protein	NA	NA	NA	NA	NA
1979863:1979890	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985256.1|1979969_1980983_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	1.4e-193
WP_001306384.1|1981098_1981398_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1981512_1981788_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_000217670.1|1981965_1982466_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557703.1|1982529_1982754_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277961.1|1982753_1983056_+	DUF5405 family protein	NA	Q7Y4C1	Escherichia_virus	99.0	3.8e-46
WP_001534949.1|1983055_1983280_+	TraR family phage/conjugal plasmid C-4 type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	8.5e-35
WP_001565038.1|1983276_1983552_+	hypothetical protein	NA	Q858T5	Yersinia_virus	98.9	6.6e-45
WP_078232983.1|1983541_1985818_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.4	0.0e+00
WP_000038201.1|1986993_1988028_-|portal	phage portal protein	portal	U5N087	Enterobacteria_phage	99.7	8.4e-202
WP_000156861.1|1988027_1989800_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_078232984.1|1989973_1990828_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MB7	Escherichia_virus	96.8	3.5e-153
WP_078232985.1|1990886_1991960_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	1.3e-200
WP_000203418.1|1991963_1992707_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1992806_1993316_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1993315_1993519_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123124.1|1993522_1993804_+|holin	holin	holin	A0A0F7LDF8	Escherichia_phage	100.0	3.7e-43
WP_001144101.1|1993803_1994301_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_078232986.1|1994315_1994741_+	protein lysA	NA	U5N096	Enterobacteria_phage	97.2	2.1e-58
WP_078232987.1|1994728_1995154_+|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	93.6	7.5e-64
WP_078232988.1|1995261_1995729_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	97.4	4.8e-80
WP_078232989.1|1995721_1996174_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	3.4e-75
WP_078232990.1|1996240_1996882_+|plate	phage baseplate assembly protein V	plate	A0A0F7LBP2	Escherichia_phage	90.2	1.8e-98
WP_000127163.1|1996878_1997226_+|plate	baseplate assembly protein	plate	A0A0F7L9X3	Escherichia_phage	100.0	1.7e-58
WP_001121474.1|1997230_1998139_+|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_001285334.1|1998131_1998662_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	100.0	1.0e-102
WP_078232991.1|1998672_2001291_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	73.2	9.0e-285
WP_078232992.1|2001290_2001869_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	65.4	3.1e-68
WP_078232993.1|2002434_2003637_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_078232994.1|2003643_2004546_+	DUF4435 domain-containing protein	NA	NA	NA	NA	NA
WP_001517507.1|2005146_2006337_+|tail	phage tail sheath protein	tail	Q858V1	Yersinia_virus	99.5	1.1e-224
WP_001251408.1|2006349_2006868_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|2006924_2007200_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|2007232_2007352_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_078232995.1|2007344_2009792_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	94.6	0.0e+00
WP_000978911.1|2009806_2010286_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_073487971.1|2010285_2011449_+	phage late control D family protein	NA	Q7Y4C6	Escherichia_virus	97.7	5.4e-205
WP_000468308.1|2011530_2011749_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_078232996.1|2012019_2013381_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	9.3e-217
2011848:2011875	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000929408.1|2013527_2013860_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137877.1|2014039_2014762_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	3.7e-31
WP_000675176.1|2014758_2016162_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.8	7.0e-34
>prophage 4
NZ_CP019008	Escherichia coli strain Ecol_AZ159 chromosome, complete genome	4926149	2062667	2068970	4926149		Enterobacteria_phage(50.0%)	6	NA	NA
WP_061157920.1|2062667_2064062_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183032.1|2064236_2065130_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_061157919.1|2065501_2066587_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	6.7e-101
WP_001023616.1|2066586_2067486_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000857508.1|2067544_2068423_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
WP_001100793.1|2068427_2068970_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 5
NZ_CP019008	Escherichia coli strain Ecol_AZ159 chromosome, complete genome	4926149	2239884	2324970	4926149	integrase,capsid,terminase,tail,tRNA,portal,holin,plate	Escherichia_phage(23.81%)	99	2247901:2247917	2283257:2283273
WP_001531780.1|2239884_2240901_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|2240869_2241133_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|2241342_2241525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|2241524_2242094_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|2242090_2244307_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|2244337_2244658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|2245668_2246082_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|2246180_2246411_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|2246469_2246946_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|2246985_2247210_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|2247206_2247962_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
2247901:2247917	attL	ATTATCTGATTACCGAA	NA	NA	NA	NA
WP_000609322.1|2247951_2249367_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|2249405_2249816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|2249817_2250054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|2250050_2250362_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|2250358_2250583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|2251264_2252053_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|2252227_2253151_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_074159566.1|2253766_2254576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019301.1|2254693_2255431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001305361.1|2255658_2256261_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	33.3	1.8e-07
WP_001313577.1|2256659_2257760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001138663.1|2258075_2258681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|2258690_2259179_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_078233000.1|2259577_2259811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|2260054_2260696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|2260847_2261027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|2261104_2261701_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|2261697_2261991_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|2261990_2262662_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|2262774_2263158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|2263157_2263430_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|2263429_2263909_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|2263916_2264111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|2264170_2264416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|2264784_2265351_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|2265337_2267200_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|2267199_2267433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|2267429_2269004_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|2269003_2270311_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|2270310_2270640_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|2270698_2271733_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|2271767_2272187_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|2272183_2272564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|2272595_2273276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|2273272_2273809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|2273789_2274692_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|2274694_2275036_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|2275032_2275953_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|2275955_2276582_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_001531771.1|2276574_2277759_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|2277758_2278148_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|2278144_2279647_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|2279664_2280177_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|2280189_2280471_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|2280579_2282220_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|2282255_2282645_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|2282806_2283031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531766.1|2283034_2284078_+	hypothetical protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
2283257:2283273	attR	TTCGGTAATCAGATAAT	NA	NA	NA	NA
WP_001296152.1|2284244_2284664_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|2285135_2285801_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_078233001.1|2285851_2287063_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|2287253_2287493_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|2287530_2288028_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|2288199_2288523_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|2288786_2288873_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|2288987_2289239_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|2289316_2289820_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|2290616_2291606_+	arabinose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001187827.1|2291675_2293190_+	L-arabinose ABC transporter ATP-binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|2293204_2294191_+	L-arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|2294357_2295158_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|2295132_2296557_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|2296563_2296992_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|2297771_2298122_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|2298124_2298703_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|2298829_2299717_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|2299713_2300640_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|2300644_2302609_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|2302629_2303133_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|2303277_2304939_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|2305229_2306090_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|2306092_2307142_+	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|2307156_2307546_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_001576788.1|2307556_2308201_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|2308389_2309538_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|2309530_2311609_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|2311608_2312001_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|2312053_2313787_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|2314002_2314569_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|2314582_2315329_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|2315716_2316817_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|2316841_2319271_+	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	NA	NA	NA	NA
WP_001576787.1|2319306_2320278_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|2320274_2321018_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2321058_2321454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|2321506_2322325_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|2322321_2322888_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|2323197_2324970_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 6
NZ_CP019008	Escherichia coli strain Ecol_AZ159 chromosome, complete genome	4926149	2970231	3018729	4926149	integrase,head,capsid,terminase,tail,lysis,tRNA,portal	Enterobacteria_phage(57.69%)	62	2963582:2963597	3026079:3026094
2963582:2963597	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
WP_000654168.1|2970231_2970510_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001524535.1|2970506_2972567_-	hypothetical protein	NA	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_001576743.1|2972625_2976108_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_071589399.1|2976168_2976801_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_000194779.1|2976737_2977481_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001576742.1|2977486_2978185_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000847330.1|2978184_2978514_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_001576740.1|2978510_2981078_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.9	0.0e+00
WP_000459452.1|2981070_2981505_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479173.1|2981486_2981909_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.2e-68
WP_001524522.1|2981924_2982665_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.1e-131
WP_001576738.1|2982672_2983068_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.3e-70
WP_024188916.1|2983064_2983643_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	95.3	6.8e-76
WP_001576737.1|2983653_2984007_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	96.6	1.9e-60
WP_000158881.1|2984018_2984414_-	hypothetical protein	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000118193.1|2984455_2985481_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000201478.1|2985536_2985869_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_078233011.1|2985878_2987210_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.6	3.3e-227
WP_001337540.1|2987190_2988792_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000198149.1|2988788_2988995_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027282.1|2988991_2990917_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453576.1|2990891_2991437_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_000881610.1|2992000_2992183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2992389_2992716_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2993196_2993490_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2993580_2993763_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001101164.1|2993979_2994513_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001168526.1|2994647_2994887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193273.1|2994883_2995198_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839596.1|2995202_2995418_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2996007_2997090_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|2997278_2997662_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971095.1|2997747_2997888_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001099697.1|2997884_2998247_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774475.1|2998243_2998534_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_000224907.1|2998526_2998697_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053004.1|2998696_2999152_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_072093903.1|2999148_2999250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2999599_3000643_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033549856.1|3000679_3004231_-	attachment protein	NA	NA	NA	NA	NA
WP_001576733.1|3004481_3005183_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.4	5.1e-126
WP_032143200.1|3005179_3006109_-	replication protein	NA	M1FN81	Enterobacteria_phage	68.0	1.6e-111
WP_001182889.1|3006195_3006735_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	4.0e-62
WP_001576731.1|3006804_3007035_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	66.7	2.1e-20
WP_000858972.1|3007139_3007829_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	4.7e-92
WP_024187901.1|3007934_3008948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023148105.1|3009766_3010057_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995439.1|3010132_3010429_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3010434_3011220_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|3011216_3011897_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|3011893_3012076_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|3012048_3012240_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|3012250_3012532_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|3012630_3012852_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|3012851_3013178_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|3013161_3013401_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|3013540_3013777_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|3013766_3014909_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|3015022_3016273_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|3016444_3017098_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3017107_3017569_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|3017622_3018729_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
3026079:3026094	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 7
NZ_CP019008	Escherichia coli strain Ecol_AZ159 chromosome, complete genome	4926149	3452726	3491675	4926149	integrase,head,terminase,lysis,transposase,coat,portal,holin	Enterobacteria_phage(63.16%)	58	3452093:3452107	3491749:3491763
3452093:3452107	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_078233019.1|3452726_3455672_-	peptidase S74	NA	A5VW57	Enterobacteria_phage	98.8	0.0e+00
WP_000532176.1|3455818_3456070_+	Arc family DNA-binding protein	NA	E7C9U8	Salmonella_phage	91.6	6.6e-36
WP_078233020.1|3456086_3456506_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	97.1	5.6e-72
WP_000749287.1|3456640_3457126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021552852.1|3457216_3459214_-	hypothetical protein	NA	Q716G2	Shigella_phage	96.7	0.0e+00
WP_078233021.1|3459213_3460515_-	acyltransferase	NA	Q716G3	Shigella_phage	82.7	1.6e-165
WP_001544386.1|3460524_3461205_-	hypothetical protein	NA	G5DA80	Enterobacteria_phage	73.7	1.5e-53
WP_021571701.1|3461191_3461659_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	2.8e-64
WP_078233022.1|3461658_3462612_-	hypothetical protein	NA	Q716G6	Shigella_phage	83.9	1.7e-92
WP_078233023.1|3462611_3464030_-	hypothetical protein	NA	Q9AYZ4	Salmonella_phage	99.2	4.6e-275
WP_001140510.1|3464039_3464501_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001389518.1|3464481_3464670_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_078233024.1|3464711_3465965_-|coat	coat protein	coat	A0A088CQ56	Enterobacteria_phage	99.5	2.2e-236
WP_021529417.1|3465983_3466877_-	phage scaffold protein	NA	A0A088CPT0	Enterobacteria_phage	98.7	1.7e-129
WP_021538737.1|3466967_3469166_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.6	0.0e+00
WP_057695722.1|3469167_3470583_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	8.9e-279
WP_000113732.1|3470579_3471020_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|3471022_3471265_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|3471492_3472035_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|3472241_3472394_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_097451629.1|3472381_3472819_-|lysis	lysis protein	lysis	Q716B4	Shigella_phage	98.6	3.8e-71
WP_000229407.1|3472815_3473292_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	99.4	8.3e-88
WP_000783734.1|3473275_3473599_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_078233025.1|3474059_3474578_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	98.3	3.2e-93
WP_000994516.1|3474574_3474763_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_078233026.1|3474759_3475122_-	RusA family crossover junction endodeoxyribonuclease	NA	K7P6I9	Enterobacteria_phage	99.2	2.0e-62
WP_000002243.1|3475118_3475409_-	DUF1364 domain-containing protein	NA	K7PKV0	Enterobacteria_phage	100.0	3.4e-52
WP_001286917.1|3475401_3475614_-	hypothetical protein	NA	K7PK10	Enterobacteria_phage	100.0	1.6e-35
WP_016262210.1|3475606_3475783_-	protein ninF	NA	G9L691	Escherichia_phage	98.3	7.4e-26
WP_000386657.1|3475782_3476142_-	DUF2591 domain-containing protein	NA	G8EYI2	Enterobacteria_phage	95.8	1.2e-62
WP_029394717.1|3476144_3476321_-	NinE family protein	NA	K7P7K5	Enterobacteria_phage	98.3	2.7e-28
WP_047671587.1|3476317_3476728_-	recombination protein NinB	NA	K7PJW4	Enterobacteria_phage	97.8	2.3e-70
WP_078233027.1|3476730_3477045_-	hypothetical protein	NA	K7PKU8	Enterobacteria_phage	99.0	1.2e-53
WP_078233028.1|3477062_3477269_-	hypothetical protein	NA	K7P7Y0	Enterobacteria_phage	95.6	1.7e-29
WP_078233029.1|3477346_3479227_-	bifunctional DNA primase/helicase	NA	K7PK08	Enterobacteria_phage	99.7	0.0e+00
WP_000067068.1|3479334_3480195_-	replication protein	NA	K7PL20	Enterobacteria_phage	99.7	4.3e-159
WP_000166207.1|3480187_3480334_-	DUF2740 domain-containing protein	NA	Q687G5	Enterobacteria_phage	100.0	1.1e-19
WP_000251072.1|3480366_3480660_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000067728.1|3480779_3480995_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	98.6	8.2e-35
WP_001519589.1|3481070_3481766_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	96.5	1.3e-129
WP_001317717.1|3482258_3482582_+	antitermination protein	NA	K7P718	Enterobacteria_phage	100.0	1.0e-52
WP_085929673.1|3482661_3483830_-|transposase	IS3-like element ISEc52 family transposase	transposase	Q716C2	Shigella_phage	96.1	1.9e-178
WP_078233030.1|3483886_3484321_-	hypothetical protein	NA	K7P861	Enterobacteria_phage	99.3	7.1e-70
WP_001308813.1|3484516_3484792_+	hypothetical protein	NA	K7PGS9	Enterobacteria_phage	100.0	1.6e-46
WP_021499331.1|3485048_3485654_+	ERF family protein	NA	Q9MCQ9	Enterobacteria_phage	99.5	9.2e-108
WP_021516166.1|3485653_3486037_+	hypothetical protein	NA	A0A2I6PID1	Escherichia_phage	98.4	6.5e-67
WP_078233031.1|3486060_3486357_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	96.9	4.3e-50
WP_000855558.1|3486367_3486658_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	100.0	3.7e-46
WP_042108347.1|3486654_3486819_+	DUF2737 family protein	NA	A0A2I6PID4	Escherichia_phage	96.3	1.3e-21
WP_078233032.1|3486815_3487376_+	hypothetical protein	NA	Q76H44	Enterobacteria_phage	68.3	2.1e-58
WP_078233033.1|3487372_3488239_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	87.3	2.5e-154
WP_000212745.1|3488240_3488528_+	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	98.9	3.5e-49
WP_078233034.1|3488531_3489404_+	DUF551 domain-containing protein	NA	A0A077SK54	Escherichia_phage	71.5	1.2e-111
WP_078233035.1|3489396_3489681_+	ASCH domain-containing protein	NA	A0A2D1GLL3	Escherichia_phage	91.5	1.0e-45
WP_000545737.1|3489753_3489921_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001281197.1|3489948_3490293_+	hypothetical protein	NA	K7PJY7	Enterobacterial_phage	99.1	2.0e-59
WP_001303849.1|3490408_3490627_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_001608901.1|3490604_3491675_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3491749:3491763	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 1
NZ_CP019007	Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence	128248	38542	103561	128248	tRNA,transposase,integrase,bacteriocin	Salmonella_phage(20.0%)	48	60111:60134	96425:96448
WP_000911324.1|38542_38941_-|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
WP_077916033.1|38940_39171_-	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_011117356.1|39249_44520_+	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000205777.1|44539_45286_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.2	6.0e-08
WP_000139359.1|45340_45901_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_012311405.1|46038_46251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001233871.1|46493_46955_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.7	5.5e-20
WP_001333231.1|47000_47210_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000083818.1|48059_48320_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|48545_48620_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_031942351.1|48612_49470_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000079942.1|50385_50655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969996.1|50651_50933_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001058007.1|50978_51278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102288.1|51449_52379_-	hypothetical protein	NA	A0A2H4J5U3	uncultured_Caudovirales_phage	27.0	1.2e-05
WP_001323889.1|52917_54495_-	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001161490.1|54804_55365_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_078232964.1|55368_58335_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	99.9	0.0e+00
WP_001697863.1|58460_59648_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000124134.1|59647_60013_-	hypothetical protein	NA	NA	NA	NA	NA
60111:60134	attL	TTGTCAACGACGGATGAAAAGTGG	NA	NA	NA	NA
WP_000678689.1|61995_64677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493379.1|65212_65563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796228.1|65606_66296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016493.1|66292_67084_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	90.2	2.7e-51
WP_000864812.1|67260_67614_+	colicin M immunity protein	NA	NA	NA	NA	NA
WP_001312845.1|67663_68479_-|bacteriocin	lipid II-degrading bacteriocin colicin M	bacteriocin	NA	NA	NA	NA
WP_000203272.1|68722_69250_+	colicin B immunity protein	NA	NA	NA	NA	NA
WP_001105066.1|69607_69889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014640552.1|70352_70589_+	colicin V immunity protein	NA	NA	NA	NA	NA
WP_001259758.1|70566_70878_+	colicin V	NA	NA	NA	NA	NA
WP_109045958.1|71047_73162_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_012006529.1|73136_74378_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000079941.1|76365_76635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000969990.1|76631_76913_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001058005.1|76958_77807_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	38.5	3.8e-27
WP_001311056.1|77923_78406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142437.1|78707_79055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001190234.1|79613_80648_+	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_001222186.1|81502_83680_+	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
WP_000271276.1|83724_84681_-	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_000933675.1|84765_85995_-	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_001312839.1|86098_89884_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	30.0	1.3e-45
WP_001318220.1|89897_91013_-	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_000738422.1|94159_94453_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_000450494.1|97538_98732_+	hypothetical protein	NA	NA	NA	NA	NA
96425:96448	attR	TTGTCAACGACGGATGAAAAGTGG	NA	NA	NA	NA
WP_024133197.1|101893_102040_-	hypothetical protein	NA	A0A0N7BTS3	Escherichia_phage	96.0	7.0e-06
WP_085949156.1|102005_103219_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	98.6	6.0e-167
WP_077248528.1|103378_103561_+|transposase	transposase	transposase	NA	NA	NA	NA
