The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	0	39722	5099988	tRNA,terminase,tail,plate,capsid,head,protease,holin	Enterobacteria_phage(68.57%)	40	NA	NA
WP_001055083.1|0_1053_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	94.3	1.4e-188
WP_000632309.1|1098_1899_+|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	89.1	6.9e-127
WP_078234351.1|2000_2495_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	96.3	1.2e-86
WP_000864901.1|2494_2695_+|tail	tail protein	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_001342221.1|2697_3021_+|holin	holin	holin	A0A0A7NRY9	Enterobacteria_phage	93.5	1.7e-47
WP_000072341.1|3017_3410_+	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	96.9	1.9e-69
WP_000780577.1|3406_3802_+	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	93.3	1.0e-59
WP_000202148.1|3940_5818_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	80.2	2.7e-299
WP_000921127.1|5841_6309_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	95.5	3.5e-83
WP_000356366.1|6301_6937_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_001271941.1|6933_7515_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	3.3e-102
WP_000213444.1|7511_7862_+|plate	baseplate assembly protein	plate	A0A0A7NQ90	Enterobacteria_phage	99.1	3.5e-59
WP_001111954.1|7865_8762_+|plate	baseplate assembly protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	3.3e-154
WP_000071703.1|8754_9285_+|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	3.6e-92
WP_032140708.1|9287_11510_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	65.0	3.8e-183
WP_001554335.1|11511_12039_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	93.7	2.6e-90
WP_000972134.1|12067_12601_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	98.9	4.2e-96
WP_032142265.1|12603_13161_-	hypothetical protein	NA	A0A0A7NPY7	Enterobacteria_phage	88.5	5.0e-84
WP_000905061.1|13379_13979_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000979945.1|14007_14496_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000853410.1|14508_17316_-|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.1	0.0e+00
WP_000333503.1|17302_17458_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000651577.1|17466_17841_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	71.5	9.9e-36
WP_000290462.1|17896_18409_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	97.1	1.5e-90
WP_000005447.1|18408_19593_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.5	8.4e-222
WP_000132830.1|19750_20860_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.9	1.3e-195
WP_000488106.1|20900_21161_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000078916.1|21352_21493_+	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000886683.1|21798_23091_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067797.1|23181_24525_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|24535_25147_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000077041.1|25305_29412_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|29546_30041_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001385255.1|30584_31550_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.9e-62
WP_001043561.1|31672_33439_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	4.1e-23
WP_001202204.1|33439_35161_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.8	1.2e-14
WP_001241674.1|35202_35907_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|36191_36410_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|37094_39371_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|39401_39722_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 2
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	2734145	2778959	5099988	transposase,protease	Stx2-converting_phage(27.27%)	32	NA	NA
WP_000997995.1|2734145_2735684_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	1.2e-281
WP_000624646.1|2736811_2737162_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	62.1	5.4e-36
WP_000435655.1|2737158_2737584_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	74.2	3.6e-34
WP_085949591.1|2737955_2738093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001149834.1|2738244_2739162_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|2739195_2740071_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000376547.1|2740119_2741592_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	22.7	2.2e-06
WP_000948500.1|2741595_2742426_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|2742471_2743182_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_000865295.1|2743194_2744304_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001030790.1|2744365_2745289_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|2745324_2746059_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000274668.1|2746158_2747145_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	57.7	4.0e-108
WP_096928816.1|2747296_2748524_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.4	7.2e-168
WP_001223344.1|2749024_2751115_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001305021.1|2751946_2752219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296382.1|2752509_2752869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|2752872_2753088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032212789.1|2756965_2757820_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.4	1.2e-68
WP_001254932.1|2757868_2759020_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|2759616_2763504_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
WP_078234355.1|2764447_2766649_-	ferric aerobactin receptor IutA	NA	NA	NA	NA	NA
WP_000750130.1|2766730_2768008_-	NADPH-dependent L-lysine N(6)-monooxygenase	NA	NA	NA	NA	NA
WP_001015715.1|2768004_2769747_-	aerobactin synthase IucC	NA	NA	NA	NA	NA
WP_001287500.1|2769746_2770694_-	N(6)-hydroxylysine O-acetyltransferase	NA	NA	NA	NA	NA
WP_001296374.1|2770694_2772419_-	aerobactin synthase IucA	NA	NA	NA	NA	NA
WP_000074472.1|2772554_2773748_+	MFS transporter	NA	NA	NA	NA	NA
WP_001296373.1|2774465_2774894_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109147.1|2774933_2775494_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|2775535_2775796_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|2777629_2777743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099156432.1|2777833_2778959_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	96.6	2.5e-146
>prophage 3
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	3069117	3076257	5099988		Escherichia_phage(83.33%)	6	NA	NA
WP_022645096.1|3069117_3069756_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	2.4e-82
WP_000590411.1|3069752_3071015_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|3071011_3071920_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001272542.1|3072085_3072883_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.0	2.2e-69
WP_001141293.1|3072933_3073590_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|3073695_3076257_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 4
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	3272175	3317043	5099988	integrase,terminase,holin	Escherichia_phage(58.0%)	54	3275274:3275290	3315200:3315216
WP_001296289.1|3272175_3273642_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.9	8.8e-88
WP_000138282.1|3273710_3275288_+	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
3275274:3275290	attL	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_000954554.1|3275480_3276731_+|integrase	site-specific integrase	integrase	A0A0F6TJM5	Escherichia_coli_O157_typing_phage	98.8	8.8e-238
WP_001077943.1|3276734_3276929_-	DUF1382 family protein	NA	G9L698	Escherichia_phage	96.9	2.8e-26
WP_000163459.1|3276925_3277576_-	adenine methylase	NA	G9L699	Escherichia_phage	99.1	2.5e-127
WP_000675390.1|3277976_3278225_-	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_000063820.1|3278274_3279156_-	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.6	5.7e-159
WP_022645091.1|3279152_3279974_-	hypothetical protein	NA	G9L6A3	Escherichia_phage	98.2	4.0e-162
WP_001102251.1|3279970_3280270_-	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	97.0	4.9e-46
WP_000836290.1|3280578_3281163_-	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_001282459.1|3281317_3281548_+	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_022645090.1|3281889_3282720_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	96.7	8.9e-154
WP_000843279.1|3282691_3283468_+	hypothetical protein	NA	G9L6A9	Escherichia_phage	100.0	4.6e-152
WP_001231262.1|3283585_3283930_+	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	99.1	1.3e-61
WP_022645089.1|3283991_3284639_+	hypothetical protein	NA	A0A0F6TJR7	Escherichia_coli_O157_typing_phage	67.0	2.6e-60
WP_022645088.1|3284635_3284869_+	hypothetical protein	NA	E9NIE8	Enterobacter_phage	41.0	3.0e-06
WP_022645087.1|3284865_3285522_+	ead/Ea22-like family protein	NA	K7P6J7	Enterobacteria_phage	72.8	9.7e-79
WP_000582229.1|3285523_3286279_+	hypothetical protein	NA	A0A1R3Y5Q7	Salmonella_virus	92.4	5.5e-142
WP_022645086.1|3286289_3287105_+	DUF551 domain-containing protein	NA	A0A0N7C063	Escherichia_phage	72.8	3.1e-50
WP_000253289.1|3287104_3287389_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_021573221.1|3287381_3287663_+	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	97.8	4.5e-49
WP_021515113.1|3287655_3287994_+	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	99.1	2.2e-58
WP_024181939.1|3288034_3288709_+|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.1	1.3e-118
WP_000132533.1|3288705_3290181_+|terminase	terminase	terminase	G9L6B8	Escherichia_phage	99.8	1.2e-297
WP_000999689.1|3290271_3290628_-	hypothetical protein	NA	Q716B1	Shigella_phage	75.4	2.7e-43
WP_000335900.1|3291330_3291537_+	hypothetical protein	NA	G9L6C1	Escherichia_phage	80.9	1.0e-10
WP_021515109.1|3291551_3293231_+	hypothetical protein	NA	A0A0F6TJD8	Escherichia_coli_O157_typing_phage	98.7	5.2e-302
WP_000133160.1|3293227_3293524_+	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_001580872.1|3293526_3294222_+	hypothetical protein	NA	G9L6C4	Escherichia_phage	99.1	1.8e-94
WP_022645085.1|3294236_3295223_+	hypothetical protein	NA	G9L6C5	Escherichia_phage	99.7	1.2e-186
WP_000627074.1|3295274_3295712_+	hypothetical protein	NA	G9L6C6	Escherichia_phage	100.0	2.2e-74
WP_000012377.1|3295722_3296058_+	hypothetical protein	NA	G9L6C7	Escherichia_phage	100.0	7.7e-56
WP_000179259.1|3296114_3296720_+	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.5	1.1e-111
WP_022645084.1|3296719_3299191_+	hypothetical protein	NA	G9L6D0	Escherichia_phage	99.3	0.0e+00
WP_022645083.1|3299190_3299655_+	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	99.4	2.4e-84
WP_022644860.1|3299654_3300200_+	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	99.4	2.9e-92
WP_001145657.1|3300199_3302821_+	transglycosylase SLT domain-containing protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	39.3	9.9e-74
WP_022644859.1|3302822_3304520_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644858.1|3304519_3307069_+	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	45.5	3.1e-205
WP_000643933.1|3307071_3307632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|3307668_3307830_-	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001555612.1|3307922_3308468_-	hypothetical protein	NA	G9L6E0	Escherichia_phage	99.4	5.2e-102
WP_001244090.1|3308769_3309489_-	ORF6N domain-containing protein	NA	G9L6E2	Escherichia_phage	86.4	4.2e-43
WP_001119419.1|3309481_3309988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001188252.1|3310302_3310560_-	hypothetical protein	NA	G9L6E3	Escherichia_phage	100.0	1.3e-42
WP_022645082.1|3310756_3313219_+	hypothetical protein	NA	O09496	Escherichia_virus	50.7	3.0e-173
WP_000009883.1|3313291_3313696_+	hypothetical protein	NA	G9L6E6	Escherichia_phage	95.5	3.9e-62
WP_000256104.1|3313682_3313991_+|holin	phage holin family protein	holin	G9L6E7	Escherichia_phage	94.1	1.6e-47
WP_022645081.1|3313980_3314610_+	glycoside hydrolase family 19 protein	NA	G9L6E8	Escherichia_phage	97.1	5.8e-113
WP_022645080.1|3314606_3315089_+	DUF2514 domain-containing protein	NA	A0A0F6TK39	Escherichia_coli_O157_typing_phage	86.9	1.5e-68
WP_000755178.1|3315306_3315846_-	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	98.9	1.4e-43
3315200:3315216	attR	ATTGAGTGGGAATGATT	NA	NA	NA	NA
WP_001311989.1|3315861_3316380_-	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	99.4	2.9e-62
WP_000076001.1|3316681_3316873_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_000017548.1|3316890_3317043_+	hypothetical protein	NA	G9L6F3	Escherichia_phage	90.0	7.1e-17
>prophage 5
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	3692555	3700867	5099988		Enterobacteria_phage(83.33%)	9	NA	NA
WP_000569347.1|3692555_3693482_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|3693486_3694218_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|3694198_3694306_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|3694365_3695097_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|3695318_3697004_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|3697000_3697720_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|3697766_3698237_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|3698277_3698739_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|3698863_3700867_-	hypothetical protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
>prophage 6
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	3796176	3802479	5099988		Enterobacteria_phage(66.67%)	6	NA	NA
WP_001116066.1|3796176_3797571_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	6.3e-19
WP_000183040.1|3797745_3798639_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.0e-46
WP_022645070.1|3799011_3800097_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	1.1e-100
WP_001023641.1|3800096_3800996_+	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000857525.1|3801053_3801932_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001100793.1|3801936_3802479_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 7
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	3825626	3861927	5099988	transposase	Stx2-converting_phage(21.43%)	40	NA	NA
WP_001531805.1|3825626_3826085_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	31.5	1.2e-11
WP_000980556.1|3826195_3827623_-	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_001296209.1|3827831_3828998_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.5	5.9e-228
WP_001105368.1|3829116_3829590_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200889.1|3829787_3830846_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|3831017_3831347_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_000080195.1|3831519_3833133_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624722.1|3833163_3833514_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	66.4	4.7e-40
WP_000422741.1|3833510_3833936_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	1.5e-48
WP_050482493.1|3834017_3834170_-	ethanolamine utilization protein	NA	NA	NA	NA	NA
WP_001161660.1|3834658_3834772_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|3834784_3834979_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854815.1|3834975_3835350_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001280918.1|3835438_3835807_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000086752.1|3835822_3836467_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	32.9	1.8e-24
WP_000692345.1|3836485_3836707_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186775.1|3836769_3837246_-	RadC family protein	NA	NA	NA	NA	NA
WP_001350782.1|3837261_3837735_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	30.3	8.7e-13
WP_022645069.1|3838076_3838895_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	3.9e-45
WP_000846703.1|3839115_3839526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|3839974_3840721_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|3840735_3842277_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_001542273.1|3842391_3842805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102633.1|3842940_3844011_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203551.1|3844007_3844913_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_001531797.1|3844909_3847294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001069649.1|3847511_3847946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000856948.1|3848374_3850540_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000778018.1|3850550_3851540_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000217077.1|3851558_3852617_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000016207.1|3852613_3853381_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	27.9	7.5e-14
WP_001163787.1|3853434_3853692_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296206.1|3854222_3855368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089438313.1|3856567_3856747_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000255956.1|3856892_3857915_+|transposase	IS21-like element IS100 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	99.1	1.0e-199
WP_000970353.1|3857914_3858607_+	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	88.4	1.7e-118
WP_001327829.1|3858943_3859159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813432.1|3859632_3860235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304240.1|3860328_3860607_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_001296203.1|3860730_3861927_-|transposase	IS110-like element ISEc20 family transposase	transposase	NA	NA	NA	NA
>prophage 8
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	3983878	4074016	5099988	tRNA,transposase,portal,terminase,plate,tail,holin,integrase	Pectobacterium_phage(20.93%)	104	3979252:3979266	3986004:3986018
3979252:3979266	attL	TGACGCCAGAGATGA	NA	NA	NA	NA
WP_001531780.1|3983878_3984895_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|3984863_3985127_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|3985336_3985519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|3985518_3986088_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
3986004:3986018	attR	TCATCTCTGGCGTCA	NA	NA	NA	NA
WP_000151806.1|3986084_3988301_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|3988331_3988652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|3989662_3990076_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|3990174_3990405_+	transcriptional regulator	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|3990463_3990940_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|3990979_3991204_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|3991200_3991956_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|3991945_3993361_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|3993399_3993810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|3993811_3994048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|3994044_3994356_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|3994352_3994577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|3995258_3996047_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|3996221_3997145_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|3998332_3999031_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|3999493_4000099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|4000108_4000597_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|4000995_4001229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|4001472_4002114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022645066.1|4002338_4002857_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000343765.1|4002875_4004096_+|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
WP_001025459.1|4004158_4004338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|4004415_4005012_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|4005008_4005302_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|4005301_4005973_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|4006085_4006469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|4006468_4006741_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|4006740_4007220_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|4007227_4007422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|4007481_4007727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|4008095_4008662_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|4008648_4010511_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|4010510_4010744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|4010740_4012315_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|4012314_4013622_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|4013621_4013951_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_000105179.1|4015078_4015498_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|4015494_4015875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|4015906_4016587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|4016583_4017120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|4017100_4018003_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|4018005_4018347_+|plate	phage baseplate assembly protein	plate	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|4018343_4019264_+|plate	baseplate assembly protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|4019266_4019893_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_000829621.1|4019885_4021070_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|4021069_4021459_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|4021455_4022958_+|tail	tail sheath protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|4022975_4023488_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_000444667.1|4023500_4023782_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|4023890_4025531_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|4025566_4025956_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|4026117_4026342_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296152.1|4027556_4027976_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|4028447_4029113_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_000797555.1|4029163_4030375_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|4030565_4030805_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|4030842_4031340_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|4031511_4031835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|4032098_4032185_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|4032299_4032551_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|4032628_4033132_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000548680.1|4033926_4034916_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187827.1|4034985_4036500_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000987895.1|4036511_4037501_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|4037667_4038468_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|4038442_4039867_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|4039873_4040302_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|4041081_4041432_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|4041434_4042013_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|4042139_4043027_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|4043023_4043950_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|4043954_4045919_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|4045939_4046443_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|4046587_4048249_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|4048539_4049400_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|4049402_4050452_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|4050466_4050856_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000983600.1|4050866_4051511_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|4051699_4052848_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|4052840_4054919_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|4054918_4055311_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|4055363_4057097_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|4057312_4057879_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|4057892_4058639_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|4059026_4060127_+	cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|4060151_4062581_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564759.1|4062616_4063588_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|4063584_4064328_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|4064368_4064764_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639277.1|4064816_4065635_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|4065631_4066198_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|4066507_4068280_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|4068272_4068725_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|4068753_4069494_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|4069528_4070050_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|4070051_4070654_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|4070724_4070790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|4070928_4071540_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|4071548_4072559_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|4072668_4074016_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 9
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	4565207	4634922	5099988	transposase,portal,tail,terminase,head,protease,capsid,holin,integrase	Stx2-converting_phage(25.0%)	78	4594093:4594107	4635886:4635900
WP_000422062.1|4565207_4566257_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559273.1|4566476_4567235_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	4.4e-06
WP_001278898.1|4567231_4567822_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000715.1|4567878_4568187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023141019.1|4568196_4569183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291206.1|4569388_4570264_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001296033.1|4570476_4572372_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|4572399_4573020_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285702.1|4573016_4573898_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|4574035_4574080_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194644.1|4574171_4575734_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763535.1|4575733_4577329_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
WP_001195273.1|4577332_4578691_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.9e-37
WP_000209513.1|4578702_4579896_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443082.1|4579895_4580702_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001296031.1|4581077_4581353_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	52.9	1.1e-10
WP_001348267.1|4581349_4581907_+	Rha family transcriptional regulator	NA	Q8H9L9	Vibrio_phage	63.8	4.2e-30
WP_000937495.1|4582318_4582588_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000240999.1|4582644_4583313_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001421220.1|4583511_4583694_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	95.0	1.4e-24
WP_022645053.1|4583921_4584707_+	hypothetical protein	NA	Q858V4	Yersinia_virus	77.8	1.3e-109
WP_000972097.1|4584708_4585242_+|tail	tail fiber assembly protein	tail	A0A077SL44	Escherichia_phage	70.1	1.8e-67
WP_001164137.1|4585272_4585800_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	77.7	8.4e-73
WP_071550361.1|4585815_4588722_-	hypothetical protein	NA	A0A0F7LDR4	Escherichia_phage	45.9	1.1e-118
WP_001016257.1|4589183_4589930_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001298859.1|4589944_4591486_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	1.7e-129
WP_000514710.1|4592126_4595600_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.7	0.0e+00
4594093:4594107	attL	CGGGTGGCAGCATCA	NA	NA	NA	NA
WP_061089814.1|4595942_4596575_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.6	3.0e-101
WP_000194730.1|4596520_4597264_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	4.3e-147
WP_001296027.1|4597274_4597973_-|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	97.4	5.8e-130
WP_000807937.1|4597972_4598314_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	95.6	9.0e-60
WP_000212991.1|4598306_4601549_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.6	0.0e+00
WP_001513217.1|4601596_4601806_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710949.1|4601901_4602276_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	99.2	1.7e-64
WP_001275441.1|4602290_4603007_-|tail	tail protein	tail	A0A0P0ZDV1	Stx2-converting_phage	99.6	3.6e-127
WP_000133388.1|4603073_4603418_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|4603414_4603861_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|4603857_4604208_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125990.1|4604217_4604544_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_000267294.1|4604540_4607126_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|4607071_4607293_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173031.1|4607337_4609275_-|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	100.0	0.0e+00
WP_001296023.1|4609338_4611000_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.7	0.0e+00
WP_000958366.1|4610996_4611560_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_000829185.1|4611850_4612216_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	93.4	2.5e-60
WP_000095741.1|4612257_4612458_+	YlcI/YnfO family protein	NA	H6WZK6	Escherichia_phage	98.5	4.3e-30
WP_000736382.1|4612656_4612872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012578895.1|4612957_4613143_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	98.4	2.7e-18
WP_032140280.1|4613364_4613451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992071.1|4614005_4614539_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	4.8e-100
WP_000369850.1|4614644_4614917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|4614882_4615227_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|4615231_4615447_-|holin	holin	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_016230612.1|4615597_4617451_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000871291.1|4617711_4618047_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_023142244.1|4618327_4618459_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	1.1e-05
WP_000024331.1|4619260_4620310_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.4	4.4e-198
WP_000917751.1|4620461_4620659_-	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	6.1e-29
WP_001513213.1|4620885_4621707_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	1.7e-80
WP_078234361.1|4621703_4622084_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	3.2e-34
WP_001265085.1|4622084_4623140_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|4623141_4623414_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_000018429.1|4623581_4623794_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|4623974_4624640_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151161.1|4624814_4625240_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	94.0	2.2e-63
WP_000450998.1|4625255_4626026_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_000788950.1|4626047_4626794_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	4.0e-113
WP_000095675.1|4626800_4627763_-	DNA-binding protein	NA	S5FM81	Shigella_phage	56.4	1.4e-70
WP_000693845.1|4627785_4628211_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000471549.1|4628207_4628423_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000103687.1|4628472_4629189_+	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	42.0	1.7e-52
WP_000379589.1|4629461_4629617_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001171951.1|4629776_4629995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000449179.1|4630560_4630749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001090200.1|4630745_4630937_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_016230610.1|4631029_4633501_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.0	5.7e-55
WP_000113189.1|4633565_4633814_+	excisionase	NA	NA	NA	NA	NA
WP_000113700.1|4633791_4634922_+|integrase	tyrosine-type recombinase/integrase	integrase	O21940	Phage_21	51.4	3.4e-103
4635886:4635900	attR	TGATGCTGCCACCCG	NA	NA	NA	NA
>prophage 10
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	4772883	4818592	5099988	tRNA,portal,tail,terminase,capsid,head,holin,integrase,lysis	Enterobacteria_phage(56.0%)	58	4791667:4791681	4820261:4820275
WP_000654172.1|4772883_4773162_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	55.4	9.9e-25
WP_000290538.1|4773158_4775180_-	hypothetical protein	NA	A0A0E3M0V5	Enterobacteria_phage	72.3	7.2e-181
WP_001531667.1|4775238_4778721_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.3	0.0e+00
WP_023149564.1|4778781_4779384_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	2.1e-88
WP_023146277.1|4779320_4780064_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	5.0e-148
WP_001152626.1|4780068_4780767_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.6	5.1e-134
WP_000847375.1|4780766_4781096_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	99.1	2.8e-58
WP_000840216.1|4781092_4783654_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459457.1|4783646_4784081_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479203.1|4784062_4784485_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	94.3	2.2e-68
WP_001295979.1|4784500_4785241_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	98.0	1.6e-130
WP_000683150.1|4785248_4785644_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	98.5	2.9e-70
WP_000985120.1|4785640_4786219_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	92.7	5.9e-80
WP_000753018.1|4786230_4786584_-|tail	tail attachment protein	tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.2e-61
WP_000158908.1|4786595_4786994_-	DNA packaging protein from bacteriophage origin	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	1.0e-62
WP_000063293.1|4787035_4788061_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	7.8e-192
WP_001295978.1|4788116_4788449_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123268.1|4788458_4789778_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	1.1e-230
WP_001295977.1|4789758_4791360_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.9	1.4e-309
WP_000198149.1|4791356_4791563_-|head,tail	Lambda prophage-derived head-to-tail joining protein W	head,tail	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027261.1|4791559_4793485_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
4791667:4791681	attL	GCTGCCAGCGGGAAA	NA	NA	NA	NA
WP_000453620.1|4793459_4794005_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	6.8e-94
WP_000881610.1|4794568_4794751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|4794957_4795284_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|4795764_4796058_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|4796148_4796331_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180486.1|4796547_4797024_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	94.9	7.3e-84
WP_000544528.1|4797010_4797316_-|holin	holin	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097224.1|4797637_4798327_-	antiterminator Q	NA	I6PDF8	Cronobacter_phage	48.5	4.9e-57
WP_000971096.1|4798323_4798464_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	68.9	8.5e-09
WP_001099488.1|4798460_4798823_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PM48	Enterobacteria_phage	95.7	1.6e-59
WP_000774479.1|4798819_4799110_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	95.8	2.3e-48
WP_000224914.1|4799102_4799273_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001053005.1|4799272_4799728_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.6e-59
WP_072147164.1|4799724_4799826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|4800175_4801219_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_022645049.1|4801255_4805521_-	inverse autotransporter beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000788794.1|4805770_4806472_-	replication protein P of bacteriophage	NA	M1FJ72	Enterobacteria_phage	97.0	1.5e-125
WP_001435464.1|4806468_4807398_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	6.1e-111
WP_001182900.1|4807484_4808024_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_001067458.1|4808093_4808324_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|4808362_4809118_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_000233576.1|4809713_4809920_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995418.1|4809995_4810292_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	8.9e-48
WP_000100847.1|4810297_4811083_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|4811079_4811760_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|4811756_4811939_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|4811911_4812103_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|4812113_4812395_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|4812493_4812715_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|4812714_4813041_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|4813024_4813264_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|4813403_4813640_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|4813629_4814772_+|integrase	tyrosine-type recombinase/integrase	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|4814885_4816136_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|4816307_4816961_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|4816970_4817432_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|4817485_4818592_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
4820261:4820275	attR	TTTCCCGCTGGCAGC	NA	NA	NA	NA
>prophage 11
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	5015700	5069420	5099988	tRNA,transposase,tail,plate,capsid,integrase	Burkholderia_virus(42.86%)	70	5024985:5025000	5044306:5044321
WP_001295930.1|5015700_5016486_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|5016621_5017401_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436917.1|5017377_5018271_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011610.1|5018424_5019171_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350057.1|5019167_5019350_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056492.1|5019401_5020634_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570547.1|5020670_5021657_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551259.1|5021653_5023402_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	3.3e-57
WP_000705731.1|5023438_5025703_-	ComEC family protein	NA	NA	NA	NA	NA
5024985:5025000	attL	GCAGCCAGCAACGCCG	NA	NA	NA	NA
WP_000167336.1|5025908_5026193_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|5026352_5028026_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|5028136_5028820_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_029364556.1|5028992_5029775_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001281701.1|5029918_5030308_-	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	54.2	1.5e-31
WP_001170114.1|5030279_5030729_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.1	6.1e-24
WP_000206212.1|5030730_5030937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631813.1|5030926_5031157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|5031153_5031837_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|5031833_5032049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|5032063_5032360_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000632576.1|5032369_5032642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001140136.1|5032930_5033461_-	host-nuclease inhibitor protein Gam	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|5033488_5033758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960679.1|5033760_5034927_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.4	2.2e-121
WP_000186588.1|5034937_5036707_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A4JWN2	Burkholderia_virus	69.4	1.5e-227
WP_001095645.1|5036722_5037040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000533817.1|5037039_5037960_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	56.2	1.6e-74
WP_000047759.1|5037970_5038279_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	2.7e-23
WP_000123378.1|5038331_5038520_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	3.9e-17
WP_000031013.1|5038613_5038970_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000783854.1|5039086_5039851_-	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	64.4	5.2e-100
WP_001069611.1|5040041_5040257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000972294.1|5040255_5040660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194951.1|5040635_5041364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000793146.1|5041494_5041845_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|5041847_5042588_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_000264665.1|5042571_5043222_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.9	2.8e-09
WP_000175099.1|5043218_5043545_+	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	48.6	1.1e-17
WP_000227701.1|5043544_5043856_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	62.6	9.4e-32
WP_000124060.1|5043855_5044401_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	67.6	9.3e-59
5044306:5044321	attR	GCAGCCAGCAACGCCG	NA	NA	NA	NA
WP_001295924.1|5044460_5045993_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.8	6.2e-185
WP_000090684.1|5045992_5047489_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.0	9.7e-167
WP_000117548.1|5047469_5048291_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.9	1.8e-98
WP_000135514.1|5048293_5048752_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	2.6e-30
WP_001273074.1|5048966_5050082_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|5050096_5051050_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_022645047.1|5051059_5051398_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|5051399_5051846_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|5051845_5052310_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_012602372.1|5052306_5052561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000729834.1|5052550_5053978_+|tail	tail protein	tail	A4JWK5	Burkholderia_virus	76.3	4.5e-214
WP_000034294.1|5053977_5054499_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	67.6	1.8e-67
WP_000110114.1|5054501_5054783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|5054880_5055216_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|5055139_5055298_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000016538.1|5055373_5058325_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.9	9.8e-86
WP_000458387.1|5058324_5059209_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_012602373.1|5059205_5059421_+	membrane protein	NA	Q6QIA3	Burkholderia_phage	57.1	1.2e-17
WP_000808007.1|5059408_5060563_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_000148266.1|5060559_5061156_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	45.2	3.2e-36
WP_000859111.1|5061210_5061558_+|plate	baseplate protein	plate	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_001219098.1|5061548_5062652_+|plate	baseplate protein	plate	Q6QI99	Burkholderia_phage	55.2	1.4e-106
WP_000138756.1|5062644_5063223_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_000527461.1|5063225_5064557_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.4	4.8e-40
WP_000072165.1|5064556_5065171_+|tail	tail assembly protein	tail	Q9MCR5	Enterobacteria_phage	60.5	2.5e-60
WP_023142129.1|5065177_5065639_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	50.0	3.9e-34
WP_064767240.1|5065649_5066090_-|tail	tail fiber protein	tail	K7PH60	Enterobacterial_phage	55.6	7.1e-41
WP_000904922.1|5066149_5066722_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	85.2	4.6e-85
WP_000445240.1|5066977_5068261_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057158.1|5068331_5069420_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	2.7e-81
>prophage 12
NZ_CP019015	Escherichia coli strain Ecol_AZ162 chromosome, complete genome	5099988	5079818	5093451	5099988	integrase	Enterobacteria_phage(75.0%)	20	5074195:5074208	5088612:5088625
5074195:5074208	attL	AACAGCACCGCGCT	NA	NA	NA	NA
WP_000213098.1|5079818_5080436_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850306.1|5080446_5082891_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000023739.1|5083190_5084183_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.2	1.3e-103
WP_001368591.1|5084252_5084594_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	51.2	4.7e-16
WP_001204236.1|5084698_5085220_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000856387.1|5085224_5085647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001287828.1|5085653_5085845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000776267.1|5085982_5086333_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	93.1	8.1e-56
WP_000159455.1|5086343_5086622_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	3.1e-34
WP_000514277.1|5086633_5086876_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000021715.1|5086872_5086986_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	1.8e-09
WP_000543036.1|5087079_5087490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|5087513_5087717_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153700.1|5087713_5087980_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000104290.1|5087976_5088276_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	2.4e-40
WP_023142408.1|5088287_5088905_+	hypothetical protein	NA	S5MQL6	Escherichia_phage	42.0	1.5e-09
5088612:5088625	attR	AACAGCACCGCGCT	NA	NA	NA	NA
WP_022645046.1|5088901_5089267_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	1.5e-60
WP_000123489.1|5089273_5092096_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	98.4	0.0e+00
WP_000686485.1|5092172_5093132_+	recombinase	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	4.2e-179
WP_000211282.1|5093136_5093451_+	plasmid partition protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.3	4.1e-19
>prophage 1
NZ_CP019013	Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence	109057	0	97065	109057	protease,tRNA,tail,terminase,portal	Salmonella_phage(88.57%)	114	NA	NA
WP_000627054.1|1019_1451_+	hypothetical protein	NA	J9Q6I8	Salmonella_phage	86.7	1.5e-64
WP_000047684.1|1568_2597_+	hypothetical protein	NA	J9Q7Z3	Salmonella_phage	86.3	1.4e-143
WP_001108395.1|2657_3602_+	hypothetical protein	NA	J9Q7S6	Salmonella_phage	90.8	2.3e-166
WP_000920224.1|3601_3868_+	hypothetical protein	NA	J9Q7G8	Salmonella_phage	77.3	2.6e-30
WP_160378289.1|3915_4944_+	recombinase	NA	J9Q736	Salmonella_phage	94.7	1.1e-188
WP_021533191.1|5036_5237_+	hypothetical protein	NA	J9Q6J0	Salmonella_phage	59.1	7.2e-09
WP_000715581.1|5240_6071_+	hypothetical protein	NA	J9Q7Z4	Salmonella_phage	94.9	3.1e-122
WP_022644979.1|6162_6588_+	hypothetical protein	NA	J9Q7G9	Salmonella_phage	74.6	5.5e-59
WP_022644978.1|6643_6919_+	hypothetical protein	NA	J9Q738	Salmonella_phage	74.7	2.6e-33
WP_001404454.1|7134_7470_+	hypothetical protein	NA	J9Q7Z5	Salmonella_phage	73.9	8.6e-39
WP_001229345.1|7469_7682_+	hypothetical protein	NA	J9Q7S8	Salmonella_phage	94.3	3.4e-33
WP_001348683.1|8261_9476_-	RepB family plasmid replication initiator protein	NA	J9Q7H0	Salmonella_phage	45.4	8.4e-76
WP_000364573.1|9677_10322_+	hypothetical protein	NA	J9Q739	Salmonella_phage	86.3	2.9e-107
WP_000174804.1|10576_11662_+	exonuclease	NA	J9Q7S9	Salmonella_phage	87.3	6.8e-186
WP_001404451.1|11891_13808_+	AAA family ATPase	NA	J9Q741	Salmonella_phage	73.2	4.5e-249
WP_014962287.1|13797_14541_+	hypothetical protein	NA	J9Q6J5	Salmonella_phage	46.8	7.5e-51
WP_022644977.1|14550_15120_+	hypothetical protein	NA	J9Q7Z7	Salmonella_phage	87.3	6.7e-92
WP_000623685.1|15193_17509_+	ribonucleoside-diphosphate reductase subunit alpha	NA	J9Q7T0	Salmonella_phage	84.4	0.0e+00
WP_000122502.1|17615_18758_+	ribonucleotide-diphosphate reductase subunit beta	NA	J9Q7H3	Salmonella_phage	88.7	2.6e-196
WP_001011859.1|18835_19705_+	hypothetical protein	NA	J9Q742	Salmonella_phage	81.0	3.1e-133
WP_022644976.1|19876_20980_+	thymidylate synthase	NA	J9Q6J6	Salmonella_phage	86.9	3.2e-191
WP_022644975.1|20981_21395_+	hypothetical protein	NA	J9Q7Z8	Salmonella_phage	85.4	3.6e-63
WP_160384356.1|21397_21868_+	dihydrofolate reductase	NA	J9Q7T1	Salmonella_phage	89.7	3.7e-80
WP_000386469.1|21867_22512_+	AAA family ATPase	NA	J9Q7H4	Salmonella_phage	81.3	7.8e-97
WP_001718079.1|22573_22993_+	hypothetical protein	NA	J9Q743	Salmonella_phage	71.9	3.2e-51
WP_016607532.1|23002_23560_+	3'-5' exonuclease	NA	J9Q6J8	Salmonella_phage	83.1	1.7e-87
WP_000099880.1|23718_24528_+	hypothetical protein	NA	J9Q7Z9	Salmonella_phage	53.2	3.4e-65
WP_000559570.1|24711_25305_+	phage N-6-adenine-methyltransferase	NA	J9Q7T2	Salmonella_phage	86.3	3.4e-99
WP_000121543.1|25490_25721_+	hypothetical protein	NA	J9Q7H5	Salmonella_phage	84.2	5.9e-31
WP_022644973.1|26303_26894_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	83.2	6.2e-93
WP_021512350.1|27042_27537_+	hypothetical protein	NA	J9Q6J9	Salmonella_phage	56.2	3.0e-24
WP_001103988.1|27546_27735_+	hypothetical protein	NA	J9Q800	Salmonella_phage	53.2	7.2e-11
WP_000900261.1|27828_28254_+	tellurite/colicin resistance protein	NA	Q71TK7	Escherichia_phage	78.7	5.7e-56
WP_000893470.1|28253_28412_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_022644972.1|28551_29118_+	hypothetical protein	NA	J9Q7H6	Salmonella_phage	64.2	7.7e-56
WP_022644971.1|29259_30945_+	DUF4942 domain-containing protein	NA	J9Q747	Salmonella_phage	92.2	0.0e+00
WP_022644970.1|31005_31710_+	hypothetical protein	NA	J9Q6K2	Salmonella_phage	76.4	2.1e-87
WP_022644969.1|31709_32090_+	hypothetical protein	NA	J9Q801	Salmonella_phage	68.6	1.3e-27
WP_022644968.1|32209_32851_+	HD domain-containing protein	NA	J9Q7H7	Salmonella_phage	86.4	5.4e-98
WP_022644967.1|32847_33390_+	hypothetical protein	NA	J9Q748	Salmonella_phage	87.4	1.4e-86
WP_022644966.1|33389_33896_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	54.7	2.4e-16
WP_022644965.1|33892_34192_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	97.0	4.8e-57
WP_022644964.1|34193_34916_+	ead/Ea22-like family protein	NA	A0A077SLK5	Escherichia_phage	78.7	1.8e-89
WP_022644963.1|34917_35241_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	A0A222YZB4	Escherichia_phage	89.2	1.9e-43
WP_022644962.1|35237_35768_+	hypothetical protein	NA	A0A2I6TCG8	Escherichia_phage	70.9	2.6e-34
WP_001355905.1|35764_35950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644961.1|35949_36603_+	DUF551 domain-containing protein	NA	K7P7E4	Enterobacteria_phage	78.7	1.2e-44
WP_000108704.1|36979_37606_+	hypothetical protein	NA	C6ZR26	Salmonella_phage	68.4	1.2e-06
WP_000506720.1|38407_38797_+	DNA repair protein	NA	A0A077SK24	Escherichia_phage	93.0	8.6e-67
WP_000004356.1|38834_39935_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001755492.1|40092_42126_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SEZ7	Hokovirus	24.1	2.2e-44
WP_001717178.1|42365_42587_+	hypothetical protein	NA	J9Q750	Salmonella_phage	58.2	1.9e-18
WP_000910476.1|42623_42809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644959.1|42970_43531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162535791.1|45115_45331_+	hypothetical protein	NA	J9Q804	Salmonella_phage	88.7	5.5e-31
WP_022644956.1|45469_45799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749407.1|45952_46264_+	hypothetical protein	NA	J9Q7T7	Salmonella_phage	63.1	5.7e-29
WP_000216801.1|46390_46786_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	54.6	3.1e-32
WP_023908299.1|46867_47278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644955.1|47628_48111_+	hypothetical protein	NA	J9Q805	Salmonella_phage	69.8	3.6e-62
WP_000497810.1|48726_48957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022644954.1|48978_49182_-	hypothetical protein	NA	J9Q7I3	Salmonella_phage	82.1	4.0e-23
WP_022644953.1|49230_49881_-	hypothetical protein	NA	J9Q754	Salmonella_phage	85.2	1.3e-99
WP_024181930.1|50164_50344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000208379.1|50476_51001_-	hypothetical protein	NA	J9Q6L0	Salmonella_phage	82.4	2.8e-68
WP_024171469.1|51005_51428_-	hypothetical protein	NA	J9Q806	Salmonella_phage	77.1	4.8e-55
WP_001291060.1|51496_51775_-	hypothetical protein	NA	J9Q7T9	Salmonella_phage	62.6	2.2e-24
WP_000218380.1|51777_53337_-	DEAD/DEAH box helicase	NA	J9Q7I4	Salmonella_phage	93.1	8.9e-280
WP_000382660.1|53419_54100_+	ParB N-terminal domain-containing protein	NA	J9Q756	Salmonella_phage	88.1	2.7e-108
WP_022644991.1|54099_54768_+	ParB N-terminal domain-containing protein	NA	J9Q6L1	Salmonella_phage	89.2	9.5e-106
WP_000049675.1|54764_55403_+	ATP-binding cassette domain-containing protein	NA	J9Q807	Salmonella_phage	98.6	1.2e-110
WP_001113022.1|55395_55650_+	hypothetical protein	NA	J9Q7U0	Salmonella_phage	96.4	5.9e-40
WP_000763393.1|55655_56546_+	hypothetical protein	NA	J9Q7I6	Salmonella_phage	98.3	9.9e-167
WP_000176292.1|56555_56822_+	hypothetical protein	NA	J9Q757	Salmonella_phage	88.6	1.4e-36
WP_000215413.1|57017_57650_+	hypothetical protein	NA	J9Q6D4	Salmonella_phage	83.8	1.8e-90
WP_001007300.1|57649_58906_+|terminase	terminase	terminase	J9Q7Y2	Salmonella_phage	96.9	3.4e-245
WP_001717193.1|58932_60507_+|portal	phage portal protein	portal	J9Q7R1	Salmonella_phage	93.1	2.2e-286
WP_001055286.1|60528_61416_+	hypothetical protein	NA	J9Q7F4	Salmonella_phage	87.9	1.6e-132
WP_001130340.1|61441_62317_+	hypothetical protein	NA	J9Q710	Salmonella_phage	94.5	5.0e-155
WP_022644990.1|62390_63311_+	Ig domain-containing protein	NA	J9Q6D6	Salmonella_phage	84.2	7.4e-133
WP_000801185.1|63355_63790_+	hypothetical protein	NA	J9Q7Y3	Salmonella_phage	82.6	1.1e-59
WP_000057118.1|63789_64623_+	hypothetical protein	NA	J9Q7R2	Salmonella_phage	92.1	1.3e-141
WP_001027663.1|64702_65047_+	hypothetical protein	NA	J9Q7F6	Salmonella_phage	95.6	2.3e-55
WP_000523628.1|65037_65511_+	hypothetical protein	NA	J9Q711	Salmonella_phage	90.4	3.3e-76
WP_000469440.1|65512_65896_+	hypothetical protein	NA	J9Q6D8	Salmonella_phage	82.7	1.2e-57
WP_022644989.1|65970_66717_+	Ig domain-containing protein	NA	J9Q7Y4	Salmonella_phage	93.1	1.8e-121
WP_000163861.1|66772_67090_+	hypothetical protein	NA	J9Q7R3	Salmonella_phage	96.2	8.6e-49
WP_000952686.1|67215_67440_+	hypothetical protein	NA	J9Q7F7	Salmonella_phage	94.6	8.8e-32
WP_022644988.1|67447_71998_+	tape measure protein	NA	J9Q712	Salmonella_phage	85.2	0.0e+00
WP_000442112.1|72040_72376_+|tail	phage tail protein	tail	J9Q6E1	Salmonella_phage	87.3	8.0e-53
WP_000511446.1|72458_73157_+|tail	phage minor tail protein L	tail	J9Q7Y5	Salmonella_phage	97.0	5.1e-134
WP_000526938.1|73149_73947_+	hypothetical protein	NA	J9Q7R4	Salmonella_phage	94.3	5.9e-155
WP_022644987.1|73934_74525_+|tail	tail assembly protein	tail	J9Q7F8	Salmonella_phage	94.9	4.2e-105
WP_022644986.1|74542_79267_+	DUF1983 domain-containing protein	NA	J9Q713	Salmonella_phage	74.7	0.0e+00
WP_032140909.1|81442_83518_+	chaperone of endosialidase	NA	Q71TP5	Escherichia_phage	68.6	1.4e-59
WP_000120169.1|83578_83833_+	hypothetical protein	NA	J9Q7R5	Salmonella_phage	67.9	3.0e-28
WP_000274392.1|83832_84441_+	hypothetical protein	NA	J9Q7G0	Salmonella_phage	74.3	2.6e-78
WP_000064175.1|84763_85087_+	hypothetical protein	NA	J9Q6E7	Salmonella_phage	88.8	2.9e-44
WP_000856757.1|85100_85793_+	hypothetical protein	NA	J9Q7Y7	Salmonella_phage	94.3	6.2e-124
WP_022644984.1|85794_86046_+	hypothetical protein	NA	J9Q7R6	Salmonella_phage	83.1	8.7e-28
WP_000931257.1|86418_86802_+	hypothetical protein	NA	A0A077SLR3	Escherichia_phage	43.3	1.3e-11
WP_000035506.1|86786_87539_+	hypothetical protein	NA	J9Q7Y8	Salmonella_phage	31.1	3.5e-16
WP_000161228.1|87715_88384_+	AAA family ATPase	NA	J9Q7R7	Salmonella_phage	91.4	1.7e-110
WP_160378290.1|88389_88743_+	hypothetical protein	NA	J9Q7G3	Salmonella_phage	97.9	1.4e-44
WP_001404393.1|88803_89862_-	hypothetical protein	NA	A0A2I7RNF6	Vibrio_phage	43.8	5.8e-65
WP_001717320.1|90151_90892_+	hypothetical protein	NA	J9Q7R8	Salmonella_phage	89.6	2.2e-127
WP_000137333.1|90935_92276_+	AAA family ATPase	NA	J9Q7G4	Salmonella_phage	93.5	3.4e-235
WP_001404467.1|92423_93539_+	hypothetical protein	NA	J9Q720	Salmonella_phage	93.8	2.6e-209
WP_021520122.1|93614_94397_+	hypothetical protein	NA	J9Q7Z0	Salmonella_phage	41.1	3.4e-54
WP_106361768.1|94452_94935_+	hypothetical protein	NA	J9Q7R9	Salmonella_phage	70.6	1.1e-50
WP_022644983.1|94931_96254_+	hypothetical protein	NA	J9Q7G5	Salmonella_phage	90.7	1.3e-239
WP_000979130.1|96250_96430_+	hypothetical protein	NA	J9Q729	Salmonella_phage	72.4	1.4e-16
WP_000636536.1|96413_96629_+	hypothetical protein	NA	J9Q6I3	Salmonella_phage	72.1	9.7e-20
WP_000067985.1|96774_97065_+	hypothetical protein	NA	J9Q7S1	Salmonella_phage	79.2	2.4e-37
>prophage 2
NZ_CP019013	Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence	109057	100310	106252	109057	integrase	Salmonella_phage(50.0%)	6	96625:96644	106679:106698
96625:96644	attL	AATGATTCCATACATCTCAT	NA	NA	NA	NA
WP_000869625.1|100310_100556_+	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	46.2	7.7e-13
WP_000797846.1|100766_101870_+|integrase	site-specific integrase	integrase	A0A1P8DTG6	Proteus_phage	33.8	1.3e-27
WP_001282577.1|101864_102251_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_001098352.1|102501_102714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022644981.1|102812_104921_+	hypothetical protein	NA	J9Q7G6	Salmonella_phage	66.5	6.3e-228
WP_000213833.1|105016_106252_+	AAA domain-containing protein	NA	J9Q733	Salmonella_phage	81.3	6.7e-198
106679:106698	attR	ATGAGATGTATGGAATCATT	NA	NA	NA	NA
>prophage 1
NZ_CP019014	Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_KPC, complete sequence	142829	2031	56539	142829	integrase,protease,transposase	Escherichia_phage(36.84%)	53	NA	NA
WP_001067855.1|2031_2736_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004196359.1|3153_3525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152397.1|4436_5756_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004152396.1|6005_6887_-	carbapenem-hydrolyzing class A beta-lactamase KPC-3	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.8e-73
WP_004152394.1|7205_7985_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|7981_9007_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|9113_12143_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|12252_13968_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001067855.1|14454_15159_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_127524347.1|15211_17920_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000205725.1|17939_18686_+	type-F conjugative transfer system pilin acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	2.4e-09
WP_000704528.1|18744_19605_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.8	6.7e-11
WP_000139321.1|19707_20268_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001309245.1|20396_20609_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233838.1|20853_21315_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	4.2e-20
WP_001298565.1|21360_21570_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766805.1|21607_22198_+	DUF2726 domain-containing protein	NA	NA	NA	NA	NA
WP_000083819.1|22437_22698_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001365705.1|22922_22997_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130647.1|22989_23847_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_000616807.1|24785_25439_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000557619.1|25531_25789_+	type II toxin-antitoxin system antitoxin PemI	NA	NA	NA	NA	NA
WP_001398199.1|25721_26123_+	type II toxin-antitoxin system toxin endoribonuclease PemK	NA	NA	NA	NA	NA
WP_001553819.1|26259_29157_-|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
WP_000509965.1|29251_29857_+	recombinase family protein	NA	A0A1S5Y2X8	uncultured_archaeal_virus	35.3	9.4e-20
WP_001351729.1|30633_31026_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_000058717.1|31163_32048_+	EamA family transporter	NA	NA	NA	NA	NA
WP_000804064.1|32079_33279_-	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000164043.1|33384_34035_+	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_032140899.1|34066_34309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|35930_36635_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000130000.1|36824_37130_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000184001.1|37140_38346_-	chromate efflux transporter	NA	NA	NA	NA	NA
WP_000427619.1|38573_39578_+|transposase	IS110-like element IS5075 family transposase	transposase	NA	NA	NA	NA
WP_004883563.1|39759_40032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000259031.1|40159_40999_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|40992_41340_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|41545_42334_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|42464_42938_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000845048.1|43095_44109_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|44311_44662_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001553864.1|44787_45117_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	55.6	6.9e-09
WP_001067855.1|45007_45712_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_012372823.1|45937_46753_+	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_000118029.1|47099_48986_+	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_000178050.1|49026_49554_+	iron transporter	NA	NA	NA	NA	NA
WP_000119836.1|49657_51037_+	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000964653.1|51039_52323_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000729220.1|52312_53443_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000117262.1|53447_54143_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_001267177.1|54129_54615_+	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000874189.1|54639_55125_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|55834_56539_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
>prophage 2
NZ_CP019014	Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_KPC, complete sequence	142829	87623	138771	142829	integrase,transposase	Macacine_betaherpesvirus(31.25%)	58	80860:80873	111188:111201
80860:80873	attL	AACCGGAACGGGAG	NA	NA	NA	NA
WP_000016982.1|87623_88430_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
WP_000852146.1|89203_89959_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	100.0	3.8e-143
WP_000772446.1|90546_91713_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817036.1|91712_92684_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	99.4	7.0e-174
WP_001348615.1|93550_94453_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_000086185.1|94837_95521_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	36.9	5.1e-30
WP_001104873.1|95521_95743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274437.1|95756_96191_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001671341.1|97557_97860_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271753.1|97906_98329_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027516.1|98325_98517_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|99551_99782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000170728.1|99833_101195_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_012783964.1|101241_101805_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	4.7e-21
WP_032140903.1|102249_102441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290793.1|102668_103196_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	54.3	6.7e-46
WP_000006004.1|103251_103485_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	3.9e-06
WP_001145469.1|103543_105502_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	4.7e-20
WP_000845901.1|105556_105991_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276234.1|105987_106707_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001299721.1|106718_106907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312861.1|106986_107145_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_032140903.1|107645_107837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000107537.1|108063_108351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001234469.1|108471_109293_+	DUF945 domain-containing protein	NA	A0A2C9CYF8	Yersinia_phage	38.2	4.4e-44
WP_000614282.1|109589_110237_-	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_001151564.1|110522_110906_+	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_000332487.1|111099_111786_+	PAS domain-containing protein	NA	NA	NA	NA	NA
111188:111201	attR	CTCCCGTTCCGGTT	NA	NA	NA	NA
WP_001254388.1|111879_112107_+	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_001098998.1|112140_112503_+	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_000012106.1|112507_112819_+	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000399804.1|112840_113407_+	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_072095570.1|113417_114122_+	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_000146638.1|114121_115549_+	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_000002795.1|115538_116123_+	conjugal transfer protein TraP	NA	NA	NA	NA	NA
WP_071528018.1|116076_116430_+	conjugal transfer protein TrbD	NA	NA	NA	NA	NA
WP_001038341.1|116422_116674_+	conjugal transfer protein TrbG	NA	NA	NA	NA	NA
WP_000809893.1|116670_117186_+	type IV conjugative transfer system lipoprotein TraV	NA	NA	NA	NA	NA
WP_001278978.1|117320_117542_+	conjugal transfer protein TraR	NA	A0A218M4I6	Erwinia_phage	41.7	7.4e-07
WP_001064239.1|117701_120329_+	type IV secretion system protein TraC	NA	NA	NA	NA	NA
WP_000214082.1|120325_120712_+	type-F conjugative transfer system protein TrbI	NA	NA	NA	NA	NA
WP_001203720.1|120708_121341_+	type-F conjugative transfer system protein TraW	NA	NA	NA	NA	NA
WP_000830838.1|121337_122330_+	conjugal transfer pilus assembly protein TraU	NA	NA	NA	NA	NA
WP_000224411.1|122359_122665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001080257.1|122673_123312_+	type-F conjugative transfer system pilin assembly protein TrbC	NA	NA	NA	NA	NA
WP_001067855.1|123489_124194_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_050482503.1|124184_124883_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_004196325.1|124936_125695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004196314.1|125928_127227_+	MFS transporter	NA	NA	NA	NA	NA
WP_004196355.1|127332_127602_+	nickel-sensing transcriptional repressor NcrB	NA	NA	NA	NA	NA
WP_004196366.1|127614_128745_+	Ni(II)/Co(II) efflux transporter permease subunit NcrC	NA	NA	NA	NA	NA
WP_032072095.1|128906_129329_+	nickel resistance OB fold protein NcrY	NA	NA	NA	NA	NA
WP_004196353.1|129584_130925_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_015065592.1|131013_132546_+|transposase	IS3-like element ISKpn38 family transposase	transposase	A0A1B1P773	Bacillus_phage	39.8	3.1e-51
WP_077253291.1|132979_135103_-	S8 family peptidase	NA	NA	NA	NA	NA
WP_022644891.1|135467_136508_-	ATP-binding protein	NA	M4QMW8	Micromonas_pusilla_virus	35.2	9.5e-20
WP_113705801.1|136677_138008_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	74.1	1.4e-79
WP_001067855.1|138066_138771_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
