The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	616636	623776	4913259		Escherichia_phage(83.33%)	6	NA	NA
WP_001279004.1|616636_617275_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
WP_000590411.1|617271_618534_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847996.1|618530_619439_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.2	1.9e-117
WP_001296319.1|619634_620402_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_001141293.1|620452_621109_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.1	3.3e-50
WP_000103863.1|621214_623776_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	1.6e-31
>prophage 2
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	1200324	1209769	4913259		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569347.1|1200324_1201251_+	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	2.6e-08
WP_000783109.1|1201255_1201987_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1201967_1202075_-	protein YohO	NA	NA	NA	NA	NA
WP_001240408.1|1202134_1202866_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	6.3e-111
WP_001295431.1|1203087_1204773_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1204769_1205489_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1205535_1206006_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001296231.1|1206046_1206508_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001296230.1|1206632_1208636_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001292786.1|1208632_1209769_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	96.7	6.1e-161
>prophage 3
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	1304932	1311235	4913259		Enterobacteria_phage(50.0%)	6	NA	NA
WP_061157920.1|1304932_1306327_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183032.1|1306501_1307395_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	3.9e-46
WP_061157919.1|1307766_1308852_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.9	6.7e-101
WP_001023616.1|1308851_1309751_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	34.5	8.2e-28
WP_000857508.1|1309809_1310688_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	8.7e-107
WP_001100793.1|1310692_1311235_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	61.8	6.0e-50
>prophage 4
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	1429653	1506975	4913259	integrase,capsid,head,terminase,tail,portal,holin,protease,transposase	Escherichia_phage(38.0%)	92	1400824:1400839	1444067:1444082
1400824:1400839	attL	CGCAACTGGTTGTCGC	NA	NA	NA	NA
WP_000060157.1|1429653_1430916_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.5	2.6e-72
WP_001311896.1|1431253_1432051_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533615.1|1432286_1433312_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	3.4e-102
WP_000096344.1|1433311_1433515_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_078235022.1|1433573_1436006_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.0	4.5e-113
WP_001070253.1|1436099_1436288_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_153302705.1|1436284_1436329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235023.1|1436338_1436473_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1436875_1437040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171946.1|1437043_1437262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_040235278.1|1437421_1437577_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	2.3e-07
WP_001397087.1|1437869_1438208_-	peptidase S24-like family protein	NA	H9C160	Pectobacterium_phage	30.7	2.5e-06
WP_000693883.1|1438826_1439252_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_078235024.1|1439323_1440394_+	phage replisome organizer	NA	A0A088CD36	Shigella_phage	64.6	1.6e-62
WP_001151221.1|1440434_1440857_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.2	9.7e-64
WP_000161640.1|1441003_1441813_-	hypothetical protein	NA	A0A0F7L9X0	Escherichia_phage	94.8	2.1e-155
WP_001557860.1|1442228_1442336_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813254.1|1442437_1442593_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000737636.1|1442736_1443129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175747.1|1443425_1443704_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.0	1.1e-12
WP_024195967.1|1443705_1444755_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.4e-108
1444067:1444082	attR	GCGACAACCAGTTGCG	NA	NA	NA	NA
WP_001217424.1|1444767_1445127_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	8.3e-40
WP_016240600.1|1445123_1445813_+	antitermination protein Q	NA	I6PDF8	Cronobacter_phage	50.2	2.6e-58
WP_000839572.1|1446609_1446825_+|holin	class II holin family protein	holin	M1FN85	Enterobacteria_phage	98.6	5.3e-34
WP_000193292.1|1446829_1447144_+	DUF1327 domain-containing protein	NA	K7PGU6	Enterobacteria_phage	98.1	4.1e-51
WP_001274714.1|1447199_1447733_+	lysozyme	NA	K7PLY1	Enterobacteria_phage	99.4	5.1e-102
WP_001228685.1|1447949_1448135_+	hypothetical protein	NA	A0A0P0ZE50	Stx2-converting_phage	80.3	6.4e-20
WP_001114684.1|1448375_1448861_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016240599.1|1449105_1449306_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001140099.1|1449313_1449664_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	98.3	1.2e-64
WP_001317918.1|1449812_1450295_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B5FPA0	Escherichia_phage	97.5	5.7e-84
WP_001140902.1|1450294_1452052_+|terminase	terminase large subunit	terminase	A0A1B5FP96	Escherichia_phage	99.5	0.0e+00
WP_000478567.1|1452063_1452246_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	96.7	1.1e-24
WP_000466247.1|1452245_1453487_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.5	5.9e-242
WP_001193631.1|1453464_1454115_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000257489.1|1454129_1455335_+|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.0	1.3e-222
WP_000601355.1|1455386_1455575_+	hypothetical protein	NA	A0A1B5FP98	Escherichia_phage	100.0	7.2e-27
WP_000983037.1|1455586_1455892_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B5FP86	Escherichia_phage	100.0	9.2e-40
WP_001147820.1|1455900_1456239_+|head	phage head closure protein	head	A0A1B5FP90	Escherichia_phage	99.1	1.6e-56
WP_000347790.1|1456238_1456685_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	80.4	2.3e-63
WP_001209399.1|1456681_1457026_+	DUF3168 domain-containing protein	NA	A0A1B5FP84	Escherichia_phage	100.0	4.2e-57
WP_000097533.1|1457085_1457790_+	hypothetical protein	NA	A0A1B5FP82	Escherichia_phage	96.2	1.5e-117
WP_000164661.1|1457804_1458176_+|tail	tail assembly protein	tail	A0A1B5FP91	Escherichia_phage	100.0	6.5e-64
WP_000978931.1|1458199_1458478_+	DUF4035 domain-containing protein	NA	A0A1B5FP87	Escherichia_phage	98.9	1.6e-43
WP_016240598.1|1458523_1461751_+|tail	phage tail tape measure protein	tail	A0A1B5FPE2	Escherichia_phage	95.0	0.0e+00
WP_040079256.1|1461728_1462085_+|tail	phage tail protein	tail	A0A0P0ZDL9	Stx2-converting_phage	65.8	1.4e-39
WP_001152456.1|1462084_1462783_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	96.6	4.4e-130
WP_064732677.1|1462787_1463531_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	92.3	4.1e-142
WP_012311734.1|1463428_1464076_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	96.3	2.8e-110
WP_078235025.1|1464136_1467616_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.2	0.0e+00
WP_001233121.1|1467683_1468283_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	7.2e-105
WP_016240595.1|1468347_1471746_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	37.3	2.4e-11
WP_016240594.1|1471745_1472330_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.2	1.6e-101
WP_001007778.1|1473407_1474058_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_099156434.1|1474318_1475666_+|transposase	IS3-like element IS1397 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.3e-74
WP_001240063.1|1475750_1476386_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740067.1|1476386_1477391_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|1477499_1477913_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001347103.1|1478045_1478717_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826711.1|1478716_1480075_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218217.1|1480182_1481034_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824383.1|1481626_1482742_-	porin	NA	Q1MVN1	Enterobacteria_phage	47.4	2.9e-91
WP_001330593.1|1483307_1483673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296176.1|1483712_1484408_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001157265.1|1484474_1485893_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228686.1|1485873_1486344_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001212226.1|1486332_1487253_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|1487425_1488343_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|1488421_1488604_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001531784.1|1488774_1490469_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491527.1|1490465_1491281_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_078235026.1|1491576_1491804_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|1491966_1492155_+	protein DsrB	NA	NA	NA	NA	NA
WP_000103992.1|1492198_1492822_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000983988.1|1493111_1493897_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|1493905_1494175_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253318.1|1494184_1494922_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001313947.1|1494921_1495287_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282103.1|1495289_1495703_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|1495699_1496704_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|1496708_1497173_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620069.1|1497277_1498405_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|1498401_1498845_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213308.1|1498863_1500237_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282677.1|1500236_1500923_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|1500915_1501911_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994425.1|1501903_1503562_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274299.1|1503776_1504091_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_001070440.1|1504434_1504767_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001310919.1|1504935_1505487_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000879824.1|1505496_1506294_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001347174.1|1506450_1506975_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.0	2.2e-33
>prophage 5
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	1525219	1613467	4913259	tRNA,integrase,capsid,plate,terminase,tail,portal,holin,transposase	Escherichia_phage(22.22%)	105	1525034:1525093	1567646:1567770
1525034:1525093	attL	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGG	NA	NA	NA	NA
WP_001531780.1|1525219_1526236_-|integrase	tyrosine-type recombinase/integrase	integrase	H9C152	Pectobacterium_phage	63.6	1.1e-126
WP_000833838.1|1526204_1526468_-	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	38.0	1.2e-06
WP_000916334.1|1526677_1526860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000100753.1|1526859_1527429_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	49.2	6.1e-37
WP_000151806.1|1527425_1529642_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	35.6	4.7e-101
WP_000388260.1|1529672_1529993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001296165.1|1531003_1531417_-	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	49.1	8.7e-09
WP_000360804.1|1531515_1531746_+	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	63.2	1.5e-21
WP_000431205.1|1531804_1532281_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	48.6	1.9e-23
WP_000943914.1|1532320_1532545_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	54.1	6.1e-17
WP_001023813.1|1532541_1533297_+	hypothetical protein	NA	H9C164	Pectobacterium_phage	68.5	2.4e-41
WP_000609322.1|1533286_1534702_+	AAA family ATPase	NA	H9C165	Pectobacterium_phage	66.7	6.6e-173
WP_000214056.1|1534740_1535151_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000918616.1|1535152_1535389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000875806.1|1535385_1535697_+	hypothetical protein	NA	A0A222YXX1	Escherichia_phage	65.7	1.2e-34
WP_000661082.1|1535693_1535918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000466605.1|1536105_1536327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531776.1|1536599_1537388_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	69.8	1.1e-39
WP_001237642.1|1537562_1538486_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_000536231.1|1539674_1540373_+	hypothetical protein	NA	Q858R8	Enterobacteria_phage	91.4	1.5e-117
WP_001138663.1|1540835_1541441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224749.1|1541450_1541939_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A142KB62	Gordonia_phage	42.7	6.4e-27
WP_000536919.1|1542337_1542571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000847617.1|1542814_1543456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001025459.1|1543607_1543787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000057010.1|1543864_1544461_+	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	64.1	1.5e-70
WP_000717783.1|1544457_1544751_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	70.5	3.3e-34
WP_000064384.1|1544750_1545422_+	antitermination protein	NA	Q7Y3X2	Yersinia_phage	33.5	1.9e-16
WP_001294589.1|1545534_1545918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000172496.1|1545917_1546190_+|holin	phage holin family protein	holin	A0A0A0YPY6	Escherichia_phage	42.9	9.8e-09
WP_000131873.1|1546189_1546669_+	TIGR02594 family protein	NA	A0A222YWL8	Escherichia_phage	68.8	4.6e-62
WP_000734931.1|1546676_1546871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001531775.1|1546930_1547176_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000168117.1|1547544_1548111_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	46.2	2.9e-31
WP_000148195.1|1548097_1549960_+|terminase	phage terminase large subunit family protein	terminase	A0A1I9KF19	Aeromonas_phage	53.2	1.1e-191
WP_000203897.1|1549959_1550193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126513.1|1550189_1551764_+|portal	phage portal protein	portal	E4WL21	Enterobacteria_phage	64.0	8.6e-190
WP_001145892.1|1551763_1553071_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	4.9e-106
WP_000206292.1|1553070_1553400_+	hypothetical protein	NA	A0A2R9YJN3	Escherichia_phage	39.5	2.0e-08
WP_001283997.1|1553458_1554493_+|capsid	major capsid protein	capsid	A0A2I6TCE5	Escherichia_phage	56.5	6.6e-106
WP_000105179.1|1554527_1554947_+	DNA-packaging protein	NA	NA	NA	NA	NA
WP_001531773.1|1554943_1555324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000774516.1|1555355_1556036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015612.1|1556032_1556569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079174.1|1556549_1557452_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_000901289.1|1557454_1557796_+	GPW/gp25 family protein	NA	D4HTV2	Vibrio_phage	51.6	1.1e-20
WP_000633314.1|1557792_1558713_+|plate	baseplate J/gp47 family protein	plate	D5LGZ3	Escherichia_phage	47.8	6.4e-68
WP_000203868.1|1558715_1559342_+|tail	phage tail protein I	tail	A0A193GYD1	Enterobacter_phage	38.8	2.0e-25
WP_001531771.1|1559334_1560519_+|tail	phage tail protein	tail	J9QDX3	Clostridium_phage	35.2	2.5e-16
WP_000626358.1|1560518_1560908_+	hypothetical protein	NA	A0A2H4EXG4	Aeromonas_phage	30.8	9.4e-05
WP_000117510.1|1560904_1562407_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	R9TMQ0	Vibrio_phage	33.5	5.5e-69
WP_000785563.1|1562424_1562937_+|tail	phage major tail tube protein	tail	NA	NA	NA	NA
WP_000444667.1|1562949_1563231_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001018353.1|1563339_1564980_+	hypothetical protein	NA	A0A2I7R3J9	Vibrio_phage	29.3	1.2e-19
WP_001531768.1|1565015_1565405_+|tail	phage tail protein	tail	E5FFG4	Burkholderia_phage	37.9	1.0e-14
WP_001531767.1|1565567_1565792_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_001531766.1|1565795_1566839_+	hypothetical protein	NA	R9TNM7	Vibrio_phage	28.5	2.0e-33
WP_001296152.1|1567005_1567425_+	hypothetical protein	NA	G8C7Q7	Escherichia_phage	68.8	1.8e-49
WP_000847882.1|1567896_1568562_+	UPF0149 family protein YecA	NA	NA	NA	NA	NA
1567646:1567770	attR	ATTTAAAATCCCTCGGCGTTCGCGCTGTGCGGGTTCAAGTCCCGCTCCGGGTACCATGGGAAAGATAAGAATAAAATCAAAGCAATAAGCAGTGTCGTGAAACCACCTTCGGGTGGTTTTTTTGT	NA	NA	NA	NA
WP_000797555.1|1568612_1569824_-	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000377224.1|1570014_1570254_+	YecH family protein	NA	NA	NA	NA	NA
WP_000917208.1|1570291_1570789_-	non-heme ferritin	NA	NA	NA	NA	NA
WP_001237881.1|1570960_1571284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723106.1|1571547_1571634_+	stress response protein AzuC	NA	NA	NA	NA	NA
WP_000082127.1|1571748_1572000_+	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_000179469.1|1572077_1572581_-	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_078235028.1|1573377_1574367_+	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_001187827.1|1574436_1575951_+	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
WP_000100203.1|1575965_1576952_+	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001296149.1|1577118_1577919_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001296148.1|1577893_1579318_+	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_000122413.1|1579324_1579753_-	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295647.1|1580532_1580883_+	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_001291603.1|1580885_1581464_+	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_000906342.1|1581590_1582478_+	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_000795641.1|1582474_1583401_+	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_001531763.1|1583405_1585370_+	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000147302.1|1585390_1585894_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001296146.1|1586038_1587700_+	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
WP_000204320.1|1587990_1588851_+	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000036371.1|1588853_1589903_+	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000763867.1|1589917_1590307_+	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_001576788.1|1590317_1590962_+	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_001278946.1|1591150_1592299_+	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000066973.1|1592291_1594370_+	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001202076.1|1594369_1594762_+	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_001025326.1|1594814_1596548_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	8.8e-87
WP_001490174.1|1596763_1597330_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185734.1|1597343_1598090_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001214293.1|1598477_1599578_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_000176764.1|1599602_1602032_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_001576787.1|1602067_1603039_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019588.1|1603035_1603779_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|1603819_1604215_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_000639277.1|1604267_1605086_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000891625.1|1605082_1605649_-	hydrolase	NA	NA	NA	NA	NA
WP_001258676.1|1605958_1607731_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_077249130.1|1607723_1608176_+	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000907234.1|1608204_1608945_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001295503.1|1608979_1609501_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_001024911.1|1609502_1610105_-	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_072093883.1|1610175_1610241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000580323.1|1610379_1610991_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_000568520.1|1610999_1612010_+	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_099156422.1|1612119_1613467_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	8.7e-74
>prophage 6
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	2026900	2059337	4913259	tRNA,lysis,tail,capsid	Salmonella_phage(46.43%)	41	NA	NA
WP_001157412.1|2026900_2027836_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	2.2e-145
WP_000123789.1|2027963_2029337_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	1.5e-52
WP_001296046.1|2029366_2029540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2029814_2030798_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_078235035.1|2031266_2031533_-	hypothetical protein	NA	A0A023MI10	Escherichia_phage	62.5	9.2e-28
WP_078235036.1|2031543_2033334_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	45.9	3.3e-97
WP_078235164.1|2033493_2033733_+	hypothetical protein	NA	C0LP45	Escherichia_virus	66.7	3.8e-17
WP_078235037.1|2033729_2034329_-	hypothetical protein	NA	K7PJV8	Enterobacteria_phage	50.7	1.1e-44
WP_078235038.1|2034329_2034641_-	hypothetical protein	NA	K7PJS1	Enterobacterial_phage	54.0	2.6e-21
WP_078235039.1|2034691_2038744_-	DUF1983 domain-containing protein	NA	I6R9B3	Salmonella_phage	41.2	4.2e-23
WP_078235040.1|2038756_2039287_-|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	51.2	2.2e-36
WP_042018374.1|2039229_2039961_-	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	65.2	1.5e-88
WP_078235041.1|2039963_2040668_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	71.7	3.8e-97
WP_153302702.1|2040809_2040968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078235042.1|2040990_2041344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078235043.1|2041353_2041602_+	phage antirepressor KilAC domain-containing protein	NA	NA	NA	NA	NA
WP_078235044.1|2041644_2041830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235045.1|2041843_2042197_-|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	67.8	1.6e-40
WP_172801711.1|2042367_2042523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078235046.1|2042820_2043006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078235047.1|2043008_2043296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078235048.1|2043325_2045665_-	tape measure protein	NA	A0A1V0E5N4	Salmonella_phage	31.2	7.3e-52
WP_078235049.1|2045967_2046381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106378885.1|2046396_2047074_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	41.0	4.1e-40
WP_078235050.1|2047128_2047605_-	hypothetical protein	NA	H6WRU1	Salmonella_phage	63.6	2.3e-53
WP_078235051.1|2047618_2048005_-	hypothetical protein	NA	Q5G8X4	Enterobacteria_phage	64.1	2.5e-42
WP_078235052.1|2048001_2048466_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	48.1	8.2e-32
WP_078235053.1|2048468_2048837_-	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	50.0	1.8e-29
WP_021524125.1|2048829_2049015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235054.1|2049017_2049404_-	hypothetical protein	NA	I6S619	Salmonella_phage	64.8	1.6e-41
WP_078235055.1|2049470_2050523_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	65.5	1.3e-133
WP_078235056.1|2050538_2050952_-	hypothetical protein	NA	G0ZND8	Cronobacter_phage	40.1	2.1e-18
WP_078235057.1|2050968_2052261_-	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	54.4	1.0e-116
WP_078235166.1|2052241_2053138_-|capsid	minor capsid protein	capsid	H6WRT1	Salmonella_phage	48.8	3.2e-72
WP_078235058.1|2053127_2054501_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	59.4	1.9e-148
WP_078235059.1|2054579_2056058_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	69.4	1.2e-201
WP_078235060.1|2056060_2056546_-	DNA-binding protein	NA	Q716H4	Shigella_phage	41.1	1.4e-21
WP_078235061.1|2056987_2057182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235062.1|2057510_2058053_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	43.2	1.6e-18
WP_078235063.1|2058390_2058861_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_170983039.1|2058848_2059337_-	glycoside hydrolase family protein	NA	A0A1V0E5Q7	Salmonella_phage	62.8	1.9e-55
>prophage 7
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	2065271	2072009	4913259		Salmonella_phage(50.0%)	16	NA	NA
WP_078235080.1|2065271_2065493_-	hypothetical protein	NA	A0A1P8DTX0	Salmonella_phage	47.8	2.0e-07
WP_078235081.1|2065497_2065704_-	hypothetical protein	NA	A0A1P8DTK9	Salmonella_phage	56.7	6.5e-13
WP_078235082.1|2065700_2066009_-	RNA-binding protein	NA	I6S5Y4	Salmonella_phage	61.3	1.4e-24
WP_137485917.1|2065998_2066274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235084.1|2066260_2066608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235085.1|2066594_2066795_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235086.1|2066794_2067517_-	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	36.6	1.7e-39
WP_078235087.1|2067516_2067699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235088.1|2067695_2068103_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0M4REJ2	Salmonella_phage	57.1	9.7e-37
WP_015675187.1|2068099_2068705_-	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	53.1	4.2e-44
WP_078235090.1|2069054_2069819_-	DNA cytosine methyltransferase	NA	S4TQH6	Salmonella_virus	60.7	1.5e-78
WP_078235091.1|2069815_2070319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078235092.1|2070783_2071323_-	phage N-6-adenine-methyltransferase	NA	H6WCM2	Enterobacteria_phage	92.2	2.8e-100
WP_078235093.1|2071332_2071566_-	hypothetical protein	NA	H6WCM1	Enterobacteria_phage	93.5	6.8e-35
WP_078235094.1|2071568_2071805_-	cell division protein FtsK	NA	NA	NA	NA	NA
WP_078235095.1|2071805_2072009_-	hypothetical protein	NA	H6WCL9	Enterobacteria_phage	79.1	4.1e-28
>prophage 8
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	2312510	2361008	4913259	tRNA,integrase,capsid,head,terminase,tail,portal,lysis	Enterobacteria_phage(57.69%)	62	2305861:2305876	2368358:2368373
2305861:2305876	attL	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
WP_000654168.1|2312510_2312789_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	57.6	7.6e-25
WP_001524535.1|2312785_2314846_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.5	3.3e-125
WP_001576743.1|2314904_2318387_-	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.9	0.0e+00
WP_071589399.1|2318447_2319080_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.0	2.2e-96
WP_000194779.1|2319016_2319760_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001576742.1|2319765_2320464_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	3.6e-132
WP_000847330.1|2320463_2320793_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_001576740.1|2320789_2323357_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.9	0.0e+00
WP_000459452.1|2323349_2323784_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479173.1|2323765_2324188_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.0	2.2e-68
WP_001524522.1|2324203_2324944_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	1.1e-131
WP_001576738.1|2324951_2325347_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	1.3e-70
WP_024188916.1|2325343_2325922_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	95.3	6.8e-76
WP_001576737.1|2325932_2326286_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	96.6	1.9e-60
WP_000158881.1|2326297_2326693_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	90.9	2.6e-55
WP_000118193.1|2326734_2327760_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	96.2	6.4e-186
WP_000201478.1|2327815_2328148_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	90.9	9.7e-51
WP_078233011.1|2328157_2329489_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	96.6	3.3e-227
WP_001337540.1|2329469_2331071_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.4e-309
WP_000198149.1|2331067_2331274_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027282.1|2331270_2333196_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.7	0.0e+00
WP_000453576.1|2333170_2333716_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_000881610.1|2334279_2334462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|2334668_2334995_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001298464.1|2335475_2335769_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_001228695.1|2335859_2336042_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001101164.1|2336258_2336792_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	94.9	5.8e-98
WP_001168526.1|2336926_2337166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193273.1|2337162_2337477_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	99.0	8.3e-52
WP_000839596.1|2337481_2337697_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000737271.1|2338286_2339369_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_001204794.1|2339557_2339941_-	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	82.5	2.0e-55
WP_000971095.1|2340026_2340167_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	72.1	1.7e-09
WP_001099697.1|2340163_2340526_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774475.1|2340522_2340813_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	1.3e-46
WP_000224907.1|2340805_2340976_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053004.1|2340975_2341431_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	1.2e-59
WP_072093903.1|2341427_2341529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000700202.1|2341878_2342922_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_033549856.1|2342958_2346510_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_001576733.1|2346760_2347462_-	replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	97.4	5.1e-126
WP_077459380.1|2347458_2348478_-	replication protein	NA	M1FN81	Enterobacteria_phage	68.0	1.8e-111
WP_001182889.1|2348474_2349014_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	4.0e-62
WP_001576731.1|2349083_2349314_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	66.7	2.1e-20
WP_000858972.1|2349418_2350108_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	4.7e-92
WP_024187901.1|2350213_2351227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023148105.1|2352045_2352336_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_000995439.1|2352411_2352708_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|2352713_2353499_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186848.1|2353495_2354176_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000149537.1|2354172_2354355_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000548516.1|2354327_2354519_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_021533932.1|2354529_2354811_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	95.7	3.0e-45
WP_000763374.1|2354909_2355131_+	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000002139.1|2355130_2355457_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000490213.1|2355440_2355680_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000088653.1|2355819_2356056_+	excisionase	NA	NA	NA	NA	NA
WP_000741335.1|2356045_2357188_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000444487.1|2357301_2358552_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248677.1|2358723_2359377_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|2359386_2359848_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001295972.1|2359901_2361008_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
2368358:2368373	attR	CTGTTTTCCAAAGCTA	NA	NA	NA	NA
>prophage 9
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	3165592	3245021	4913259	transposase,integrase,holin	Staphylococcus_phage(20.0%)	59	3191186:3191202	3256336:3256352
WP_000131040.1|3165592_3167626_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001295807.1|3167754_3168342_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_001295806.1|3168355_3169828_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159129.1|3169841_3171512_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	30.9	8.9e-60
WP_001295805.1|3172596_3173160_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	53.3	6.0e-53
WP_001295804.1|3173489_3174284_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001213045.1|3174437_3175199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072017408.1|3176338_3177532_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001005267.1|3177715_3178384_+	membrane protein	NA	NA	NA	NA	NA
WP_001295803.1|3178626_3179322_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_001295802.1|3179314_3180742_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102123.1|3180752_3181472_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_001295801.1|3181997_3182852_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046304.1|3183078_3184404_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.8	1.1e-113
WP_000474088.1|3184512_3184749_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001295800.1|3184760_3185354_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_001295799.1|3185513_3186383_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	42.5	1.1e-53
WP_000620995.1|3186630_3187488_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000092553.1|3187612_3191860_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
3191186:3191202	attL	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
WP_001174452.1|3192425_3193277_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	40.7	1.2e-47
WP_001172283.1|3193303_3194293_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_000910713.1|3194323_3195217_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001524125.1|3195416_3196343_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000860035.1|3196499_3197420_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000182343.1|3197592_3198735_+	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_000662258.1|3199207_3199309_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3199673_3199937_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3199936_3200077_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_000389022.1|3201160_3201703_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730982.1|3201777_3202365_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716404.1|3202421_3203090_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131109.1|3203115_3205641_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265646.1|3205630_3207274_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001295798.1|3207242_3207953_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001295797.1|3208259_3208589_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019923.1|3208837_3209452_-	YagU family protein	NA	NA	NA	NA	NA
WP_000146240.1|3209666_3209852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000144688.1|3210284_3211604_+|integrase	site-specific integrase	integrase	A0A2H4J5F8	uncultured_Caudovirales_phage	23.4	1.5e-17
WP_078235133.1|3211696_3212545_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_029396577.1|3212629_3212827_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_039022338.1|3212838_3213327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854808.1|3213323_3213701_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001354276.1|3213789_3214158_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_029396485.1|3214207_3214852_-	hypothetical protein	NA	A0A2I6PI07	Pseudomonas_phage	34.2	9.1e-29
WP_000692353.1|3214866_3215088_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001384029.1|3215156_3215633_-	RadC family protein	NA	NA	NA	NA	NA
WP_000214317.1|3215647_3216133_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	31.0	2.0e-12
WP_001234702.1|3216223_3217042_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.3	8.0e-46
WP_078235134.1|3217369_3220216_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_072652309.1|3220586_3221459_-	GTPase family protein	NA	NA	NA	NA	NA
WP_072650529.1|3221724_3223281_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	43.1	1.7e-105
WP_078235135.1|3223277_3224414_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_078235136.1|3224535_3227652_+	HsdR family type I site-specific deoxyribonuclease	NA	NA	NA	NA	NA
WP_078235137.1|3227799_3228780_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	98.5	7.5e-184
WP_000443937.1|3231283_3232735_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_078235138.1|3232727_3234770_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_078235139.1|3234956_3240692_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_153302706.1|3241451_3242960_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.6	1.4e-43
WP_172801717.1|3244052_3245021_+|transposase	IS5-like element IS903B family transposase	transposase	A0A1B0VFY5	Salmonella_phage	99.4	1.3e-185
3256336:3256352	attR	CGGCGATTTTTTCCAGC	NA	NA	NA	NA
>prophage 10
NZ_CP019020	Escherichia coli strain Ecol_244 chromosome, complete genome	4913259	3369378	3436684	4913259	tRNA,protease,transposase,bacteriocin	uncultured_Mediterranean_phage(10.0%)	60	NA	NA
WP_000753937.1|3369378_3370803_-|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
WP_000057107.1|3370932_3372450_-	dGTPase	NA	NA	NA	NA	NA
WP_000689844.1|3372533_3373232_+	5'-methylthioadenosine/S-adenosylhomocysteine nucleosidase	NA	NA	NA	NA	NA
WP_001129927.1|3373224_3374025_+	vitamin B12 ABC transporter substrate-binding protein BtuF	NA	NA	NA	NA	NA
WP_000964221.1|3374062_3374686_+	TRIC cation channel family protein	NA	NA	NA	NA	NA
WP_001295564.1|3374732_3375077_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
WP_120795373.1|3375069_3375135_-	protein YadW	NA	NA	NA	NA	NA
WP_000845408.1|3375158_3376580_-	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_061157852.1|3376804_3378085_+	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000044116.1|3378119_3380102_-	Fe(3+)-hydroxamate ABC transporter permease FhuB	NA	NA	NA	NA	NA
WP_001295787.1|3380098_3380989_-	Fe(3+)-hydroxamate ABC transporter substrate-binding protein FhuD	NA	NA	NA	NA	NA
WP_001295786.1|3380988_3381786_-	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
WP_000124398.1|3381837_3384087_-	ferrichrome porin FhuA	NA	NA	NA	NA	NA
WP_001295784.1|3384306_3385317_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000926360.1|3385338_3387816_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000110510.1|3387882_3388599_-	molecular chaperone	NA	NA	NA	NA	NA
WP_001035606.1|3388644_3389211_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000918160.1|3389551_3392077_-	bifunctional glycosyl transferase/transpeptidase	NA	NA	NA	NA	NA
WP_001295782.1|3392170_3394600_-	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.6	6.0e-41
WP_001294702.1|3394673_3395204_+	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_000396050.1|3395218_3395923_+	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001155227.1|3396100_3396556_+	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000937399.1|3396592_3397519_+|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_000174644.1|3397557_3398976_+	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000215152.1|3398972_3399452_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_000038431.1|3399799_3400384_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000465941.1|3400480_3401221_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_000153158.1|3401255_3403856_+	Yad fimbria usher protein HtrE	NA	NA	NA	NA	NA
WP_000598298.1|3403872_3404445_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000143210.1|3404459_3405062_+	fimbrial-like protein YadL	NA	NA	NA	NA	NA
WP_000553751.1|3405088_3405685_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000846606.1|3405736_3406990_+	fimbrial-like adhesin	NA	NA	NA	NA	NA
WP_000805472.1|3407102_3407897_+	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_000905361.1|3407908_3408760_+	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_078235146.1|3408841_3409039_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_000339933.1|3409107_3410028_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	48.8	4.9e-60
WP_000621515.1|3410301_3410682_+	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_000277941.1|3410685_3411915_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000901994.1|3411978_3412419_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_000972203.1|3412523_3413294_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000150638.1|3413290_3414217_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
WP_000651599.1|3414325_3414988_+	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000683335.1|3415028_3415565_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_001295777.1|3415770_3418161_+	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_001189632.1|3418207_3419758_-	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	3.5e-18
WP_001295568.1|3419923_3420271_+	YacC family pilotin-like protein	NA	NA	NA	NA	NA
WP_000818414.1|3420376_3421243_+	polyamine aminopropyltransferase	NA	NA	NA	NA	NA
WP_000734300.1|3421258_3422053_+	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_000384306.1|3422090_3422453_-	YacL family protein	NA	NA	NA	NA	NA
WP_001295775.1|3422627_3425225_-	bifunctional aconitate hydratase 2/2-methylisocitrate dehydratase	NA	NA	NA	NA	NA
WP_000784417.1|3425579_3427343_+	DUF3300 domain-containing protein	NA	NA	NA	NA	NA
WP_000102485.1|3427413_3428838_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
WP_000963539.1|3429045_3430938_-	pyruvate dehydrogenase complex dihydrolipoyllysine-residue acetyltransferase	NA	NA	NA	NA	NA
WP_000003820.1|3430952_3433616_-	pyruvate dehydrogenase (acetyl-transferring), homodimeric type	NA	NA	NA	NA	NA
WP_000331776.1|3433776_3434541_-	pyruvate dehydrogenase complex transcriptional repressor PdhR	NA	NA	NA	NA	NA
WP_000282229.1|3434996_3435287_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_001311382.1|3435287_3435527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000543776.1|3435694_3435985_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_000085117.1|3436038_3436227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000282227.1|3436393_3436684_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 1
NZ_CP019018	Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence	158911	3773	79681	158911	tRNA,transposase,integrase,protease	Enterobacteria_phage(13.64%)	53	778:792	38824:38838
778:792	attL	GCCAGGGGAATATCT	NA	NA	NA	NA
WP_001066942.1|3773_4514_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_032193510.1|4634_4823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001312822.1|5197_6100_-	antimicrobial resistance protein Mig-14	NA	NA	NA	NA	NA
WP_000771475.1|6168_7278_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000280980.1|7710_8664_-|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001312823.1|9936_10095_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_162842477.1|10278_11491_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.0	2.7e-167
WP_078234955.1|12945_14133_+	efflux RND transporter periplasmic adaptor subunit	NA	A0A140XAI1	Dickeya_phage	55.7	1.0e-09
WP_000733250.1|14129_16070_+	MacB family efflux pump subunit	NA	G9BWD6	Planktothrix_phage	39.0	1.8e-35
WP_001312828.1|16073_17444_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_000974762.1|18240_19182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450494.1|21441_22635_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_085959875.1|22990_24218_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	6.3e-172
WP_085947771.1|25399_26561_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_000738422.1|26699_26993_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_001318220.1|30138_31254_+	salmochelin biosynthesis C-glycosyltransferase IroB	NA	NA	NA	NA	NA
WP_001389363.1|31393_35053_+	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	29.8	3.6e-45
WP_001593035.1|35156_36386_+	catecholate siderophore esterase IroD	NA	NA	NA	NA	NA
WP_000271274.1|36470_37427_+	catecholate siderophore esterase IroE	NA	NA	NA	NA	NA
WP_001222186.1|37471_39649_-	siderophore salmochelin receptor IroN	NA	A0A0P0I887	Acinetobacter_phage	31.8	9.6e-06
38824:38838	attR	AGATATTCCCCTGGC	NA	NA	NA	NA
WP_001190234.1|40503_41538_-	3-deoxy-7-phosphoheptulonate synthase	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	44.0	1.9e-73
WP_000377483.1|42097_42406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000969988.1|42504_42687_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001324224.1|42683_42881_-	toxin-antitoxin system protein	NA	NA	NA	NA	NA
WP_000489609.1|43562_44837_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_113987052.1|44811_46926_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	26.5	3.6e-34
WP_001259758.1|47095_47407_-	colicin V	NA	NA	NA	NA	NA
WP_001323890.1|47384_47621_-	colicin V immunity protein	NA	NA	NA	NA	NA
WP_000379710.1|48560_48830_+	SemiSWEET transporter	NA	NA	NA	NA	NA
WP_001017346.1|48826_49807_+	NAD(P)-binding domain-containing protein	NA	A0A2H4J2Q2	uncultured_Caudovirales_phage	41.5	3.3e-06
WP_001282144.1|49873_50263_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	98.4	3.9e-67
WP_000612591.1|50259_50607_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_078234957.1|51235_52813_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	1.2e-95
WP_001161490.1|53122_53683_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|53686_56653_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001553770.1|58132_58585_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.4	9.2e-12
WP_001593039.1|58693_62827_-|protease	hemoglobin-binding protease autotransporter Hbp	protease	Q9LA54	Enterobacteria_phage	41.6	7.3e-297
WP_001254932.1|63792_64944_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000124098.1|65065_65431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001553768.1|66726_67071_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161956652.1|67162_67303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774297.1|68005_68863_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001273588.1|68855_69338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001442103.1|69330_69405_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000083845.1|69636_69894_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001351576.1|70177_70384_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001299730.1|71007_71220_-	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000139315.1|71355_71916_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000704513.1|72018_72879_-	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.5	9.7e-10
WP_000205749.1|72937_73684_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.7	8.7e-07
WP_001611029.1|73703_78974_-	conjugative transfer relaxase/helicase TraI	NA	NA	NA	NA	NA
WP_000450520.1|79055_79283_+	toxin-antitoxin system antitoxin VapB	NA	NA	NA	NA	NA
WP_000911313.1|79282_79681_+|tRNA	tRNA(fMet)-specific endonuclease VapC	tRNA	NA	NA	NA	NA
>prophage 1
NZ_CP019017	Escherichia coli strain Ecol_244 plasmid pEC244_KPC, complete sequence	73464	0	72409	73464	integrase,transposase	Escherichia_phage(30.0%)	60	42794:42853	65223:65350
WP_000368714.1|0_1206_-	AAA family ATPase	NA	A0A077SL49	Escherichia_phage	69.6	2.4e-163
WP_000339857.1|1620_1890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004118283.1|2066_2933_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	31.1	1.5e-23
WP_032409716.1|3462_3567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|4149_4854_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840280.1|5204_5759_-	AAC(6')-Ib family aminoglycoside 6'-N-acetyltransferase	NA	NA	NA	NA	NA
WP_001217881.1|5992_6550_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	98.4	2.0e-93
WP_001143775.1|6711_9717_+|transposase	Tn3-like element Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	99.3	0.0e+00
WP_000015958.1|9988_10765_-|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.9	6.4e-53
WP_000129823.1|10761_11505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000493378.1|11555_11906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072202616.1|12049_12511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261282.1|12467_12698_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001044770.1|12694_13111_+	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_004152334.1|13184_13895_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_072093211.1|14626_14752_+	mercury transporter	NA	NA	NA	NA	NA
WP_001340589.1|14787_15210_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|15261_16956_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|16973_17336_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|17332_17569_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|17604_18273_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|19662_20367_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|22110_22971_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_004152403.1|23564_26462_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.7	2.7e-181
WP_004152402.1|26550_27171_+	recombinase family protein	NA	A0A219Y912	Aeromonas_phage	31.5	2.0e-09
WP_004152400.1|28336_28696_-	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	62.0	3.6e-19
WP_004152398.1|29199_30384_+|transposase	ISAs1-like element ISKpn31 family transposase	transposase	NA	NA	NA	NA
WP_004152397.1|30660_31980_+|transposase	IS1182-like element ISKpn6 family transposase	transposase	Q9MBP7	Staphylococcus_prophage	24.2	1.9e-12
WP_004199234.1|32229_33111_-	carbapenem-hydrolyzing class A beta-lactamase KPC-2	NA	A0A1B0VBP7	Salmonella_phage	52.2	2.2e-73
WP_004152394.1|33398_34178_-	AAA family ATPase	NA	A0A2L1IVB6	Escherichia_phage	61.8	2.5e-89
WP_004199214.1|34174_35200_-|transposase	IS21 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	50.3	1.4e-87
WP_004152392.1|35306_38336_-|transposase	IS3-like element Tn4401 family transposase	transposase	NA	NA	NA	NA
WP_004152391.1|38445_40161_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001404092.1|40455_40611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145103.1|40659_41652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152390.1|41678_41840_+	hypothetical protein	NA	NA	NA	NA	NA
42794:42853	attL	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAG	NA	NA	NA	NA
WP_000602738.1|43897_44650_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|45071_46097_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|46325_47102_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067858.1|47215_47920_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_011264039.1|47992_48232_+	macrolide transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	46.2	9.5e-08
WP_000612791.1|48377_49241_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|49278_49524_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|49992_50784_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_000019473.1|50989_51970_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	99.1	8.9e-185
WP_000800531.1|53163_53496_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|53665_54457_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|54549_55809_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001261740.1|56070_56862_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000050382.1|56919_57528_-	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001456218.1|57623_58466_-	alpha/beta fold putative hydrolase EstX	NA	NA	NA	NA	NA
WP_000845048.1|58632_59646_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|59848_60199_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|60374_60935_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|60938_63905_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_001039464.1|64752_65139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_030005799.1|65278_66247_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	95.7	5.5e-179
65223:65350	attR	GGCTTTGTTGAATAAATCAGATTTCGGGTAAGTCTCCCCCGTAGCGGGTTGTGTTTTCAGGCAATACGCACGCTTTCAGGCATACCTGCTTTCGTCATTTTGTTCAGCGCTCGTACCAGGGCCATAGC	NA	NA	NA	NA
WP_004178082.1|68813_70301_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	1.2e-31
WP_000776034.1|70706_71138_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	53.3	1.6e-29
WP_001754953.1|71137_72409_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	63.7	5.4e-150
