The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	26874	104430	12012215	integrase,transposase	Streptomyces_phage(40.0%)	55	25343:25359	69991:70007
25343:25359	attL	CCAGGCCGAGGCCGAGC	NA	NA	NA	NA
WP_078637918.1|26874_27465_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_159037621.1|27461_27977_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078637920.1|28212_30279_+	Helicase associated domain protein	NA	NA	NA	NA	NA
WP_078637922.1|33954_34719_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	31.8	7.5e-30
WP_159037622.1|36061_36337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637923.1|38198_38771_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078637924.1|38854_39805_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159037623.1|40807_42190_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_159037624.1|42392_43172_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078637927.1|43193_46316_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	39.5	1.0e-189
WP_078637928.1|46682_47807_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_078637929.1|47803_48139_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078637930.1|48135_49671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637931.1|50543_50810_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159037625.1|53219_53771_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078637933.1|53824_54298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637934.1|54459_55275_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_078646978.1|55295_56231_-	helix-turn-helix domain-containing protein	NA	A0A1J0MBX1	Streptomyces_phage	27.2	1.2e-13
WP_078637935.1|56326_56563_-	DUF397 domain-containing protein	NA	NA	NA	NA	NA
WP_159037626.1|56794_57301_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_078646979.1|58014_58704_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_078637937.1|59064_59799_-	DUF4232 domain-containing protein	NA	NA	NA	NA	NA
WP_078637938.1|59732_60242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637939.1|60672_61140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637940.1|61195_62020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637941.1|62016_62265_-	peptidase inhibitor family I36 protein	NA	NA	NA	NA	NA
WP_078637942.1|62416_62599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637943.1|62695_63370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078646980.1|63366_63966_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_078637944.1|64434_64956_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637945.1|65089_65854_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078637946.1|66418_68800_+	SpoIIE family protein phosphatase	NA	NA	NA	NA	NA
WP_078637947.1|69100_70333_-	aminopeptidase P family protein	NA	NA	NA	NA	NA
69991:70007	attR	GCTCGGCCTCGGCCTGG	NA	NA	NA	NA
WP_159037627.1|70393_71509_-	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_159037628.1|71670_72468_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078637950.1|72803_74120_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_078637951.1|74670_75447_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078637952.1|75785_76286_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_078637953.1|76421_78785_+	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_078637954.1|79232_79586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637955.1|80346_81840_-	MFS transporter	NA	NA	NA	NA	NA
WP_078637956.1|81893_82439_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159037629.1|82854_83622_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_159037630.1|83618_84260_+	PAS domain-containing protein	NA	A0A1V0E640	Streptomyces_phage	38.8	7.0e-05
WP_078637958.1|84336_84912_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159037631.1|84908_85463_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159037632.1|85874_88709_-	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_159037633.1|89291_92315_-	PD40 domain-containing protein	NA	NA	NA	NA	NA
WP_078637961.1|92311_93196_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_078637963.1|93600_94269_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_078637964.1|94344_94980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637965.1|95261_96554_-|transposase	IS256 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	26.5	1.6e-32
WP_159037634.1|97764_99450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037635.1|99875_101153_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_078637968.1|103227_104430_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	110450	172082	12012215	transposase	Staphylococcus_phage(75.0%)	47	NA	NA
WP_078637975.1|110450_111596_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_078637976.1|112273_113140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637977.1|113732_114677_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078637978.1|114859_115657_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_078637979.1|115699_117340_+	acyl-CoA synthetase	NA	A0A2H4PQU7	Staphylococcus_phage	35.4	4.3e-67
WP_078637980.1|117336_118698_+	MFS transporter	NA	NA	NA	NA	NA
WP_078646984.1|119474_119981_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_159037636.1|120739_120904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162501070.1|121347_122337_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_078637983.1|122477_122840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037637.1|123010_123670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078637985.1|123819_124119_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637986.1|126218_127175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646986.1|127451_128552_-	methyltransferase domain-containing protein	NA	A0A1J0MC37	Streptomyces_phage	38.4	1.4e-45
WP_107438914.1|128914_129394_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_078637987.1|129552_132591_+|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_078637988.1|132700_133117_-	ester cyclase	NA	NA	NA	NA	NA
WP_078637989.1|133251_134043_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_078637990.1|134136_134745_+	ABATE domain-containing protein	NA	NA	NA	NA	NA
WP_078637991.1|136578_137475_-	aminoglycoside phosphotransferase family protein	NA	NA	NA	NA	NA
WP_078646987.1|138166_138877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107439258.1|140335_141379_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	32.0	1.4e-31
WP_078637993.1|141800_142793_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	23.6	1.2e-06
WP_078637994.1|144100_144613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078637995.1|144902_145280_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_078637996.1|145335_146139_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_078637997.1|146311_147205_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_107438915.1|147336_148154_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_078638000.1|149639_150632_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_078638001.1|150754_151384_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078638002.1|151639_153265_-	pRL2-11	NA	NA	NA	NA	NA
WP_078638003.1|153439_154027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078638004.1|154133_154529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646989.1|154599_156576_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_159037638.1|156812_157319_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_078638006.1|157441_158716_+	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_078638007.1|158766_160827_+	hydantoinase/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_078638008.1|160855_163012_+	hydantoinase B/oxoprolinase family protein	NA	NA	NA	NA	NA
WP_078646990.1|163087_164311_+	CoA transferase	NA	NA	NA	NA	NA
WP_078638009.1|164312_165110_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_078638010.1|165224_166208_+	hydroxymethylglutaryl-CoA lyase	NA	NA	NA	NA	NA
WP_078638011.1|166285_166504_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078638012.1|166628_167294_-	nitroreductase	NA	NA	NA	NA	NA
WP_078638013.1|167388_168291_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_078638014.1|168756_169842_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078638016.1|170740_171121_+	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_078638017.1|171095_172082_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	2248642	2347959	12012215	transposase	Paenibacillus_phage(22.22%)	68	NA	NA
WP_078639329.1|2248642_2249875_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_078639330.1|2250063_2251503_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639332.1|2251842_2252241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639333.1|2252237_2253086_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_159037685.1|2253220_2253619_+|transposase	transposase domain-containing protein	transposase	NA	NA	NA	NA
WP_078639334.1|2253662_2254265_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	49.7	2.7e-35
WP_159037686.1|2254601_2256149_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_078639336.1|2256403_2259388_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_159037687.1|2259534_2260146_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639337.1|2260685_2261411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107438963.1|2261620_2262483_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.2	3.8e-22
WP_078639338.1|2265210_2266431_-	MFS transporter	NA	NA	NA	NA	NA
WP_078647152.1|2266478_2267474_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078639339.1|2268124_2268430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037688.1|2268443_2269103_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639341.1|2269145_2270048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639342.1|2272779_2273115_-	Lsr2 family protein	NA	A0A1B3B136	Gordonia_phage	34.7	6.4e-10
WP_078639344.1|2274640_2275099_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159037689.1|2275095_2275830_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639346.1|2276169_2277102_-	glutaminase	NA	NA	NA	NA	NA
WP_078639347.1|2278940_2279198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639348.1|2279995_2280328_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159037690.1|2281709_2282573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107438964.1|2282797_2283985_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_078639351.1|2284208_2285393_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_107439294.1|2285509_2285656_-	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_078639352.1|2285866_2286358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639353.1|2287434_2287701_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_078639355.1|2288335_2289538_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_159037691.1|2289937_2290381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639359.1|2291391_2292027_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639360.1|2292125_2293640_-|transposase	ISL3 family transposase	transposase	A9YX10	Burkholderia_phage	27.7	4.5e-10
WP_159037692.1|2294123_2294504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078647153.1|2295323_2296163_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107438966.1|2297405_2298971_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	33.6	5.6e-40
WP_159037693.1|2299887_2300265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639363.1|2300550_2301138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639365.1|2302591_2303032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078647154.1|2303511_2304276_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_078639366.1|2304964_2307721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078647155.1|2308142_2309603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107438967.1|2309723_2311667_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_078639367.1|2311965_2313192_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_078639368.1|2314392_2315430_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159037694.1|2316955_2317369_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_078639371.1|2317314_2317746_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078639372.1|2317829_2318579_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_107439295.1|2318640_2319741_-	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_078639374.1|2319752_2320172_-	RidA family protein	NA	NA	NA	NA	NA
WP_159037695.1|2320186_2320546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639376.1|2320593_2322060_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	31.0	2.4e-48
WP_078639377.1|2322162_2323368_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_078639378.1|2323409_2324399_-	acetoin dehydrogenase	NA	NA	NA	NA	NA
WP_107439296.1|2324391_2325309_-	thiamine pyrophosphate-dependent dehydrogenase E1 component subunit alpha	NA	NA	NA	NA	NA
WP_078639380.1|2325966_2326200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037696.1|2327231_2327828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037697.1|2328501_2328924_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_078639385.1|2330214_2332704_+	SpoIIE family protein phosphatase	NA	A0A1J0MCT1	Streptomyces_phage	47.0	4.8e-09
WP_078639387.1|2334120_2335341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639388.1|2335518_2335746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162501053.1|2337670_2337940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037698.1|2337970_2338399_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	31.2	4.2e-06
WP_159037699.1|2339292_2340240_-	WD40 repeat domain-containing protein	NA	NA	NA	NA	NA
WP_078647157.1|2340618_2340933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037700.1|2341684_2341945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162501080.1|2342023_2342823_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_078639396.1|2343447_2344812_+	amino acid permease	NA	NA	NA	NA	NA
WP_107439297.1|2347096_2347959_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.2	1.4e-21
>prophage 4
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	2355673	2505463	12012215	integrase,transposase	Enterobacteria_phage(23.08%)	116	2378480:2378539	2407620:2408949
WP_159037701.1|2355673_2355892_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	48.5	1.8e-13
WP_107438971.1|2355963_2356278_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639403.1|2359272_2360334_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_107438973.1|2361252_2362362_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639406.1|2362528_2363107_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_107438974.1|2364100_2364964_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	48.5	3.2e-13
WP_159037702.1|2365732_2366044_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639409.1|2368754_2369159_+	RidA family protein	NA	NA	NA	NA	NA
WP_078639410.1|2369155_2370238_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_078639411.1|2374373_2375702_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_078639412.1|2375803_2376622_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_078639413.1|2376627_2377395_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_078639414.1|2377549_2378329_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
2378480:2378539	attL	TGAACCGCCCCGGGTTCGGTAGAGATCTCAGATTGTGGTGATGACCTGGGGTTTCGTGAG	NA	NA	NA	NA
WP_078639415.1|2380079_2381525_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_078639400.1|2381588_2382779_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_078647158.1|2383465_2384224_-	DUF1963 domain-containing protein	NA	NA	NA	NA	NA
WP_078639416.1|2385411_2386194_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_159037703.1|2386247_2387237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639418.1|2388892_2389684_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639420.1|2390512_2391214_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_078639422.1|2392213_2393416_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_078639423.1|2393648_2395238_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_078639424.1|2395237_2396011_+	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	35.0	3.4e-30
WP_078647159.1|2396460_2398515_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_078639425.1|2398833_2399775_-	alpha/beta hydrolase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	34.9	7.8e-37
WP_078639426.1|2399886_2400522_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078639427.1|2400658_2401351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639428.1|2401429_2401807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639429.1|2401872_2402097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037704.1|2402130_2402439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639430.1|2402465_2402843_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078639431.1|2402839_2403181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639432.1|2403570_2404566_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_107438975.1|2404604_2405418_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_078639435.1|2405588_2406833_+|transposase	IS256 family transposase	transposase	A0A2P1JQX9	Mycobacterium_phage	66.4	1.4e-150
WP_078639436.1|2406829_2407348_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078639438.1|2410845_2412015_+	sensor histidine kinase	NA	NA	NA	NA	NA
2407620:2408949	attR	TGAACCGCCCCGGGTTCGGTAGAGATCTCAGATTGTGGTGATGACCTGGGGTTTCGTGAGTTCGGTGTAGTAGTTGGCTTCGTATTCGACGGGCGGGATGTGGCCTATCTCGCCGTGGAGTCTGCGGTGGTTGTACCAGTCGGCCCACTCGGCGGTGGCCAGCTCGACCTGGGAGAGCGTCTTCCAGGGCCGCCGGGGCTTGATCAACTCGGTTTTGAACAGGCCGATCGTGGACTCCATCAGGGCGTTGTCGTACGCGTCACCGACGGATCCGATGCTCGCCGCGATGCCGGCGGCATCCAGGTGCTCGGCGAGTTTGAACGATGTGTATTGCGACCCGGCGTCCGAGTGATGGATCAAGTCTCCTGGCCGCACGGGCTGTTGGTCGCGGTCGCGTTGCCAGATGGCCATCTCCAGGGCGTCCAGGACGAAGACGGTCTCCTTCACGGTGGCCGCGGACCAGCCGACGATCCGGCGGGAGAAGGTGTCCACGACGAACGCGACGTAGACGGTCGCGGACCAGGTCTTCACGTGGGTGAAGTCCGCCACCCAGCACCGGTTCGGAGCGATGGCCACGAAGTCGCGGTCGACCAGATCGGGGGCCCGCTGGACCTGTCCGCCGGGGATCGTGGTGATGACGCTTCTGCCGCGCACCGCGCCCTGGATGCCGAGCTCGCGCATCAGGCGCTCGACGGTGCAGCGGGCCACCGCATGTCCCTGCCGGTTCAGCTCGCGCCAGATCTTCCGGGCTCCGTAGACACGGTAGTTGGACGCGTAGACGTACTGGATCCTCTCCTTGAGCTCCGTGTCACGCATGCGGCGGGCGGAGGGCGTCTGGAGGCGTTTCTTGTGGGCGTAGTACGTGGAAGGGGCGATCTTGCAGTCGTGCCCGGTGAGCGTCCTGCAGATCGGCTCGACGCCGCCGAAGCGGTCCCGGTGCTCGTCGATGAACGTTACGAGCGCGTTTGTGGCCGGTCGAGCTCGGCCGCGAAGAAACTCGCCGCGGCCTTCAGGATCTCGTTCGCCCGCTTCAGCTCGGCGTTCTCCTTCTTCAACGCCTTGAGCTGGGCGGACTCCTCCGTCGTCGTCCCCGGACGCTGCCCCGCGTCGATCTCCTGCTGCTTCACCCAGTTCCGCAGTGTCTCGCGGGAACCGATGCCGAGCTTGTCGGCGACCGCCTGCAGGGCGGTCGTCTCGTTCGGGTAATCGTCGCGCACCTCGGCGACCATGCGCACCGCACGACGGCGGAGCTCAAGCGGGTAACGGGAGGGTCGTGCCATGACTCAATCCTTACATGGAATCGAGCCTCCACCTGACCCGGGGCGGTTCA	NA	NA	NA	NA
WP_107438976.1|2412007_2412442_+	roadblock/LC7 domain-containing protein	NA	NA	NA	NA	NA
WP_078639440.1|2412438_2412798_+	DUF742 domain-containing protein	NA	NA	NA	NA	NA
WP_078639441.1|2412778_2413372_+	ATP/GTP-binding protein	NA	NA	NA	NA	NA
WP_078639442.1|2413368_2414604_+	cytochrome P450	NA	NA	NA	NA	NA
WP_078647161.1|2414606_2415842_+	cytochrome P450	NA	NA	NA	NA	NA
WP_107438977.1|2416141_2417239_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_159037705.1|2417308_2417446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037706.1|2418492_2418936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639444.1|2418976_2419879_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_078639445.1|2419875_2420130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639446.1|2420234_2420978_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_159037707.1|2421535_2421820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639447.1|2422130_2422775_-	LysE family translocator	NA	NA	NA	NA	NA
WP_078639448.1|2423220_2423565_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639449.1|2423607_2423757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037708.1|2427260_2428664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037709.1|2428810_2429005_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037710.1|2429752_2430055_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639453.1|2430051_2430546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037711.1|2430837_2431449_-	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_107439298.1|2431725_2432587_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	44.2	3.8e-22
WP_078639455.1|2434132_2434324_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	54.2	6.2e-10
WP_159037712.1|2434460_2434781_-	hypothetical protein	NA	A0A1B3AZF8	Gordonia_phage	48.5	7.4e-16
WP_078639457.1|2434974_2435310_+	Lsr2 family protein	NA	S5W0B7	Mycobacterium_phage	35.8	4.9e-10
WP_078639458.1|2435831_2436407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639460.1|2437749_2438574_+|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_078639461.1|2439460_2439736_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_162501054.1|2439616_2440216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639462.1|2440219_2440822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639463.1|2443145_2443724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639464.1|2443737_2444001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639465.1|2444005_2444875_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078639332.1|2446308_2446707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639333.1|2446703_2447552_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_107438978.1|2448288_2449269_-	leucine-rich repeat domain-containing protein	NA	NA	NA	NA	NA
WP_078639468.1|2449555_2449765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107439299.1|2453688_2454744_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_078647162.1|2454862_2455627_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_078639472.1|2455644_2456595_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_107438980.1|2458499_2459672_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_159037713.1|2460024_2460732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078647164.1|2461237_2461453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162501081.1|2461496_2462295_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_078639474.1|2462418_2463075_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078647165.1|2463098_2464193_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159037714.1|2464745_2465111_-	SUKH-4 family immunity protein	NA	NA	NA	NA	NA
WP_078639476.1|2467524_2468538_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_078639477.1|2468534_2469467_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	36.8	1.0e-12
WP_107438982.1|2469463_2470351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639479.1|2470471_2471296_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078639480.1|2472422_2472902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639481.1|2473857_2475201_-	recombinase	NA	NA	NA	NA	NA
WP_078639482.1|2475449_2475944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639484.1|2476156_2476558_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639485.1|2476583_2477054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639486.1|2477156_2477876_-	DUF317 domain-containing protein	NA	NA	NA	NA	NA
WP_107439300.1|2478584_2480348_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_162501082.1|2480462_2481485_-	AAA family ATPase	NA	A0A0K0N7E9	Gordonia_phage	38.3	5.3e-39
WP_078639488.1|2482722_2485527_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_078639489.1|2485564_2485984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078647167.1|2485980_2486361_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_107439302.1|2486411_2486816_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_078639491.1|2486832_2487033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639492.1|2487079_2487979_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_078639493.1|2487975_2488890_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_107439303.1|2488886_2490224_-	CpaF family protein	NA	NA	NA	NA	NA
WP_078639495.1|2490229_2491075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078647168.1|2491071_2491761_-	flagellar biosynthesis protein FlgA	NA	NA	NA	NA	NA
WP_078639497.1|2492690_2493047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107438983.1|2493582_2494026_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_159037715.1|2494214_2494709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639499.1|2494715_2495354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639500.1|2495434_2495749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639501.1|2495826_2496834_-	recombinase family protein	NA	I1ZBD6	Salisaeta_icosahedral_phage	33.0	1.2e-11
WP_078639502.1|2497322_2498393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037716.1|2498437_2498803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639504.1|2498927_2502062_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	40.0	1.8e-194
WP_159037717.1|2502991_2503348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639506.1|2503819_2505463_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	2508514	2555471	12012215	transposase	Acinetobacter_phage(66.67%)	37	NA	NA
WP_107438984.1|2508514_2509702_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_078639507.1|2509831_2510407_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_159037718.1|2510429_2511428_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_159037719.1|2513034_2513610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037720.1|2514253_2515039_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078639512.1|2515167_2515611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639513.1|2515763_2516789_+	hypothetical protein	NA	E5E461	Acinetobacter_phage	21.7	4.5e-06
WP_078639514.1|2516785_2517826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639515.1|2517852_2519037_+	radical SAM protein	NA	NA	NA	NA	NA
WP_078639516.1|2519033_2519636_+	3'-5' exonuclease	NA	NA	NA	NA	NA
WP_078639517.1|2519629_2520229_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_078639518.1|2520225_2521008_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_078639519.1|2521995_2524134_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_078647172.1|2524552_2525806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639521.1|2526087_2529216_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_078639522.1|2529623_2530046_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639523.1|2530175_2531255_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639333.1|2531994_2532843_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_078639332.1|2532839_2533238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639524.1|2534360_2535428_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078639525.1|2535502_2535976_+	TetR/AcrR family transcriptional regulator C-terminal ligand-binding domain-containing protein	NA	NA	NA	NA	NA
WP_078639526.1|2539049_2539721_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_159037721.1|2540058_2540433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037722.1|2541041_2541191_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639527.1|2542996_2543404_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_078639528.1|2543680_2543932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078639529.1|2544482_2544701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078639530.1|2544766_2545225_-	recombinase family protein	NA	NA	NA	NA	NA
WP_078639531.1|2545369_2546551_+	helix-turn-helix transcriptional regulator	NA	A0A1J0MCE6	Streptomyces_phage	39.2	6.1e-55
WP_078639532.1|2547283_2547859_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078647174.1|2547994_2548588_+	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	36.1	1.4e-20
WP_078639533.1|2548592_2549567_+	xanthine dehydrogenase family protein subunit M	NA	NA	NA	NA	NA
WP_078639534.1|2549566_2551714_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_078639535.1|2551945_2552509_-	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_078647175.1|2552560_2553133_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078647176.1|2553240_2554107_+	DMT family transporter	NA	NA	NA	NA	NA
WP_078639536.1|2554268_2555471_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	3685656	3759524	12012215	integrase,transposase	Staphylococcus_phage(25.0%)	54	3748712:3748729	3759032:3759049
WP_078640430.1|3685656_3687381_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_078640431.1|3687982_3694072_-	sugar-binding protein	NA	NA	NA	NA	NA
WP_078640432.1|3694088_3695177_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078640433.1|3696256_3698128_+	AfsR/SARP family transcriptional regulator	NA	NA	NA	NA	NA
WP_078640434.1|3698877_3700707_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	27.8	8.3e-11
WP_078640435.1|3700703_3702608_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.4	6.9e-08
WP_159037756.1|3702759_3704700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107439324.1|3705022_3706201_-	acyl-CoA/acyl-ACP dehydrogenase	NA	NA	NA	NA	NA
WP_078640437.1|3706217_3707480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078640438.1|3707476_3708985_-	AMP-binding protein	NA	A0A2K9KZV5	Tupanvirus	23.7	5.8e-26
WP_125756106.1|3708984_3709458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059148728.1|3710318_3710570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078640440.1|3710562_3710934_+	inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_159037757.1|3710949_3711960_-	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_078640442.1|3711956_3712463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078640443.1|3712459_3713455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059148733.1|3713451_3714849_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_063805024.1|3714929_3716264_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_159037758.1|3716254_3716980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078640445.1|3716976_3718098_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_063805025.1|3718091_3718901_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_059148738.1|3718897_3719380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059148739.1|3719366_3720383_-	thymidylate synthase	NA	A0A0K0N6Z8	Gordonia_phage	39.0	8.2e-16
WP_059148740.1|3720379_3721210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078640447.1|3721206_3722259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078647291.1|3722255_3723095_-	phosphotransferase	NA	NA	NA	NA	NA
WP_059148745.1|3723169_3724426_-	radical SAM protein	NA	NA	NA	NA	NA
WP_078647292.1|3724496_3726062_-	B12-binding domain-containing radical SAM protein	NA	NA	NA	NA	NA
WP_078640407.1|3727291_3728053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078640449.1|3728439_3729537_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078640450.1|3730434_3731226_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_078640451.1|3731398_3732208_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_078640452.1|3732263_3733685_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.3	1.6e-41
WP_078640453.1|3733772_3734570_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078647293.1|3734699_3735266_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_078640454.1|3735283_3735931_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_078647294.1|3736069_3737089_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_078640455.1|3737081_3738077_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	26.6	6.3e-21
WP_078640456.1|3738073_3738646_+	VOC family protein	NA	NA	NA	NA	NA
WP_078640457.1|3738642_3739563_+	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_078640458.1|3739559_3740540_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_078640459.1|3740431_3741283_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_159037759.1|3741320_3742184_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_159037760.1|3743200_3744367_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A160DEQ4	Gordonia_phage	29.4	7.9e-15
WP_159037761.1|3744860_3747965_-	DNRLRE domain-containing protein	NA	NA	NA	NA	NA
3748712:3748729	attL	CGAGCACGGCACCCGGCG	NA	NA	NA	NA
WP_078640462.1|3749042_3750326_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078640463.1|3750339_3751089_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_159037762.1|3751304_3752297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037763.1|3755893_3756034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037764.1|3756061_3757012_+|integrase	site-specific integrase	integrase	A0A220NQQ9	Corynebacterium_phage	26.7	1.6e-05
WP_009719339.1|3757355_3757559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078640465.1|3757555_3757978_+	PIN domain nuclease	NA	NA	NA	NA	NA
WP_078640466.1|3757995_3758304_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078647295.1|3758435_3759524_+|transposase	transposase	transposase	NA	NA	NA	NA
3759032:3759049	attR	CGAGCACGGCACCCGGCG	NA	NA	NA	NA
>prophage 8
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	5059904	5128876	12012215	integrase,tRNA,transposase,protease	Streptococcus_phage(25.0%)	49	5046822:5046839	5122587:5122604
5046822:5046839	attL	GGCCGGATCGTCGCCGAG	NA	NA	NA	NA
WP_078641383.1|5059904_5060879_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_078641384.1|5060962_5062297_+	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_078641385.1|5062430_5065484_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	39.6	2.9e-202
WP_159037787.1|5066823_5068014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037788.1|5068003_5069242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641389.1|5069530_5069950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641390.1|5069946_5072070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641391.1|5072066_5073827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078647415.1|5073823_5075236_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_078647416.1|5077490_5078462_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_014060664.1|5078906_5079752_-	DegV family protein	NA	NA	NA	NA	NA
WP_078641392.1|5079919_5080690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641393.1|5080850_5083727_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	45.6	6.6e-220
WP_030835565.1|5084179_5084413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641394.1|5084655_5084850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641395.1|5085441_5086095_-	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_078641396.1|5086091_5086532_-	ribosome silencing factor	NA	NA	NA	NA	NA
WP_078641397.1|5086709_5088512_-	LCP family protein	NA	NA	NA	NA	NA
WP_060944022.1|5088522_5089134_-	nicotinate-nucleotide adenylyltransferase	NA	NA	NA	NA	NA
WP_156107794.1|5089459_5089612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641398.1|5089717_5090965_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_078641399.1|5091012_5092095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641400.1|5092211_5092868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078641401.1|5092947_5094246_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	51.4	6.4e-98
WP_078641402.1|5094337_5094799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107439349.1|5095082_5096249_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	38.2	3.5e-55
WP_078641404.1|5096593_5098705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078641405.1|5098867_5100301_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_014060683.1|5100440_5100698_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_078641406.1|5100712_5101033_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_107439350.1|5101276_5105284_-	ribonuclease E/G	NA	NA	NA	NA	NA
WP_078641408.1|5105587_5106364_-	DUF2344 domain-containing protein	NA	NA	NA	NA	NA
WP_078641409.1|5106513_5108436_-	TIGR03960 family B12-binding radical SAM protein	NA	NA	NA	NA	NA
WP_078641410.1|5108508_5110146_-	CYTH and CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_078641411.1|5110181_5111384_-	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_078641412.1|5111380_5113525_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_078647417.1|5113600_5114311_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_078641413.1|5114317_5115262_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_014060693.1|5115410_5116430_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_078641414.1|5116751_5117165_-	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	48.5	2.4e-27
WP_078641415.1|5117240_5117594_-	DUF4233 domain-containing protein	NA	NA	NA	NA	NA
WP_078641416.1|5117595_5119101_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_078641417.1|5119292_5120747_-	penicillin-binding protein 2	NA	NA	NA	NA	NA
WP_078641418.1|5120993_5123627_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	39.4	4.9e-145
5122587:5122604	attR	CTCGGCGACGATCCGGCC	NA	NA	NA	NA
WP_078641419.1|5123744_5124698_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078641420.1|5124751_5125741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078641421.1|5125799_5126645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_059145704.1|5126750_5128037_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.5	2.1e-146
WP_037945933.1|5128219_5128876_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	45.5	8.1e-41
>prophage 9
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	9242837	9295934	12012215	transposase	Gordonia_phage(33.33%)	45	NA	NA
WP_078644619.1|9242837_9243884_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_078644620.1|9243958_9244267_+|transposase	transposase	transposase	A0A1B3AZF8	Gordonia_phage	49.5	2.5e-16
WP_078644622.1|9246742_9247546_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078647749.1|9249027_9249891_-	viomycin phosphotransferase	NA	NA	NA	NA	NA
WP_078644623.1|9250743_9251172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078644625.1|9251401_9251707_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078644626.1|9252737_9253028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078644628.1|9253427_9254057_-	type III effector protein	NA	NA	NA	NA	NA
WP_078644629.1|9254185_9254617_+	Hsp20/alpha crystallin family protein	NA	NA	NA	NA	NA
WP_078647750.1|9254717_9255113_+	DUF2267 domain-containing protein	NA	NA	NA	NA	NA
WP_078644631.1|9255171_9255615_+	DUF2267 domain-containing protein	NA	NA	NA	NA	NA
WP_159037875.1|9255893_9256361_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078644634.1|9256470_9256821_-|transposase	IS5/IS1182 family transposase	transposase	NA	NA	NA	NA
WP_078644637.1|9257924_9258209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078644638.1|9259071_9260661_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159037877.1|9260717_9260894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078644640.1|9261082_9261784_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078644641.1|9263436_9263745_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078647751.1|9263893_9264136_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	56.2	1.1e-11
WP_078644643.1|9265149_9265488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078644645.1|9265552_9266458_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078644646.1|9266600_9267470_+	oxidoreductase	NA	NA	NA	NA	NA
WP_078644648.1|9269035_9269800_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_078644649.1|9269796_9271233_-	MFS transporter	NA	NA	NA	NA	NA
WP_078644651.1|9272343_9272883_-	VOC family protein	NA	NA	NA	NA	NA
WP_078644652.1|9272879_9273878_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_078644653.1|9273870_9274866_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_078644655.1|9275034_9275676_+	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_078644656.1|9276913_9277753_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078647752.1|9277846_9278584_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_078647753.1|9278791_9279781_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_078644658.1|9279903_9281001_+	alkene reductase	NA	NA	NA	NA	NA
WP_107439429.1|9283957_9284584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078644661.1|9284671_9285529_-	rod shape-determining protein	NA	NA	NA	NA	NA
WP_078644662.1|9285525_9285894_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_078644664.1|9285945_9286275_-	TraR/DksA C4-type zinc finger protein	NA	NA	NA	NA	NA
WP_078644665.1|9286650_9287613_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_107097172.1|9287681_9288323_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_107439431.1|9289016_9291317_+	protein translocase subunit SecD	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	34.5	2.7e-30
WP_078644667.1|9291446_9291689_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107439432.1|9291960_9292182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078644670.1|9292929_9293802_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078644671.1|9293991_9294753_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_162501062.1|9295002_9295542_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_162501087.1|9295538_9295934_+|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 10
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	10428041	10444301	12012215		Streptomyces_phage(100.0%)	24	NA	NA
WP_159037905.1|10428041_10429634_-	recombinase family protein	NA	K4I054	Streptomyces_phage	42.7	1.7e-100
WP_159037906.1|10429682_10430024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078645938.1|10430783_10431029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645939.1|10431025_10431262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645940.1|10431358_10431712_+	hypothetical protein	NA	A0A0M3UKC5	Streptomyces_phage	71.6	2.7e-35
WP_078647837.1|10431822_10432212_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645941.1|10432339_10432714_+	hypothetical protein	NA	A0A0M5M519	Streptomyces_phage	41.0	1.1e-13
WP_078645942.1|10432710_10433205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645943.1|10433201_10434032_+	hypothetical protein	NA	A0A0M4R1V5	Streptomyces_phage	76.4	4.2e-119
WP_078647838.1|10434052_10435096_+	hypothetical protein	NA	A0A0M4QTT9	Streptomyces_phage	72.6	3.9e-138
WP_078647839.1|10435095_10435884_+	DNA polymerase III subunit epsilon	NA	A0A0M3UK53	Streptomyces_phage	77.0	4.4e-118
WP_078645944.1|10435880_10436363_+	phiSA1p31-related protein	NA	A0A0M4RQ88	Streptomyces_phage	34.9	6.0e-17
WP_078645945.1|10436356_10436587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645946.1|10436583_10437213_+	hypothetical protein	NA	Q6VY77	Streptomyces_phage	69.4	1.5e-68
WP_078647840.1|10437257_10438814_+	DNA cytosine methyltransferase	NA	A0A1J0MCZ4	Streptomyces_phage	38.5	7.2e-88
WP_078645947.1|10438810_10439077_+	hypothetical protein	NA	A0A0M4S2J7	Streptomyces_phage	57.0	1.2e-16
WP_078645948.1|10439082_10439529_+	hypothetical protein	NA	A0A0M3UKC6	Streptomyces_phage	65.0	2.9e-42
WP_078645949.1|10439525_10439885_+	hypothetical protein	NA	A0A0M4QZK4	Streptomyces_phage	61.5	8.9e-26
WP_078645950.1|10439901_10440834_+	hypothetical protein	NA	A0A0M4R9L6	Streptomyces_phage	52.1	6.0e-66
WP_078645951.1|10441447_10441732_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645952.1|10442198_10442435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078647841.1|10442698_10443025_+	hypothetical protein	NA	A0A0M4R1W0	Streptomyces_phage	57.1	3.3e-19
WP_078645953.1|10443021_10443219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645954.1|10443317_10444301_+	hypothetical protein	NA	A0A0M4S2K5	Streptomyces_phage	48.7	8.3e-58
>prophage 11
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	10448875	10477335	12012215	portal,terminase,head,tail,capsid	Streptomyces_phage(100.0%)	37	NA	NA
WP_078645963.1|10448875_10449517_+	hypothetical protein	NA	Q6VY63	Streptomyces_phage	40.8	5.5e-26
WP_159037908.1|10449669_10449834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645964.1|10449925_10450174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645965.1|10450173_10450482_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037909.1|10450469_10450919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645967.1|10451314_10451575_+	hypothetical protein	NA	A0A0M4R1W7	Streptomyces_phage	63.9	1.7e-18
WP_078645968.1|10451571_10451874_+	HNH endonuclease	NA	A0A0M4QTV1	Streptomyces_phage	62.2	9.5e-29
WP_159037910.1|10451960_10452512_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645970.1|10452771_10453365_+	bifunctional DNA primase/polymerase	NA	Q6VY59	Streptomyces_phage	63.9	4.2e-65
WP_078645971.1|10453345_10453858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078645972.1|10453987_10454476_+	hypothetical protein	NA	Q6VY56	Streptomyces_phage	84.6	1.2e-70
WP_078645973.1|10454488_10456153_+|terminase	terminase	terminase	Q6VY57	Streptomyces_phage	83.3	1.4e-267
WP_078647842.1|10456208_10457600_+|portal	phage portal protein	portal	A0A0K1Y587	Streptomyces_phage	79.0	1.1e-217
WP_078645974.1|10457592_10458396_+	hypothetical protein	NA	A0A0K1Y588	Streptomyces_phage	73.5	2.0e-105
WP_078645975.1|10458455_10459205_+	hypothetical protein	NA	Q6VY53	Streptomyces_phage	69.9	1.2e-43
WP_078645976.1|10459223_10459613_+|head	head decoration protein	head	A0A0K1Y5S7	Streptomyces_phage	89.1	6.0e-60
WP_078645977.1|10459629_10460676_+|capsid	major capsid protein	capsid	A0A0K1Y5W3	Streptomyces_phage	85.1	3.3e-169
WP_078645978.1|10460672_10460984_+	hypothetical protein	NA	A0A0K1Y591	Streptomyces_phage	47.1	1.5e-16
WP_078645979.1|10460988_10461405_+	hypothetical protein	NA	A0A0K1Y592	Streptomyces_phage	77.1	1.0e-49
WP_078645980.1|10461401_10461761_+	hypothetical protein	NA	A0A0K1Y5A7	Streptomyces_phage	72.3	2.0e-46
WP_078645981.1|10461767_10462046_+	hypothetical protein	NA	A0A0K1Y5T2	Streptomyces_phage	79.3	5.1e-29
WP_078645982.1|10462045_10462450_+	hypothetical protein	NA	A0A0K1Y5W8	Streptomyces_phage	71.2	9.3e-48
WP_078645983.1|10462528_10463182_+|tail	phage tail protein	tail	A0A0K1Y595	Streptomyces_phage	81.9	3.2e-98
WP_078645984.1|10463283_10463607_+	hypothetical protein	NA	A0A0K1Y596	Streptomyces_phage	77.6	5.2e-41
WP_078645985.1|10463648_10464056_+	hypothetical protein	NA	A0A0K1Y5B2	Streptomyces_phage	66.9	3.3e-45
WP_078645986.1|10464058_10468357_+|tail	phage tail tape measure protein	tail	A0A0K1Y5T7	Streptomyces_phage	62.7	9.1e-258
WP_078645987.1|10468370_10469261_+	hypothetical protein	NA	A0A0K1Y5X3	Streptomyces_phage	70.5	5.9e-103
WP_078645988.1|10469260_10470406_+|tail	phage tail protein	tail	A0A0K1Y599	Streptomyces_phage	59.7	6.8e-128
WP_078645989.1|10470410_10471337_+	hypothetical protein	NA	A0A0K1Y5A0	Streptomyces_phage	65.4	9.4e-112
WP_159037911.1|10471346_10471961_+	hypothetical protein	NA	A0A0K1Y5B7	Streptomyces_phage	49.3	1.9e-47
WP_078645991.1|10471971_10474626_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A0K1Y5U2	Streptomyces_phage	47.5	1.7e-166
WP_078645992.1|10474637_10474856_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645993.1|10474930_10475176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645994.1|10475172_10475964_+	CHAP domain-containing protein	NA	K4HYE4	Streptomyces_phage	59.4	2.7e-22
WP_078645995.1|10476008_10476278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078645996.1|10476319_10476652_+	hypothetical protein	NA	A0A0K1Y5A5	Streptomyces_phage	74.6	1.2e-13
WP_078645997.1|10476648_10477335_+	hypothetical protein	NA	A0A0M4QTS6	Streptomyces_phage	72.6	1.4e-19
>prophage 12
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	10608973	10620960	12012215	tail,plate	Bacillus_phage(33.33%)	11	NA	NA
WP_078646077.1|10608973_10611238_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	J9PVC2	Bacillus_phage	30.7	1.5e-46
WP_014057285.1|10611258_10611714_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_078646078.1|10611715_10613209_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	H6WFT7	Cyanophage	30.8	5.8e-18
WP_078646079.1|10613205_10613724_+|tail	phage tail protein	tail	T2KT02	uncultured_phage	38.7	3.8e-09
WP_078646080.1|10613720_10613915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646081.1|10614003_10614675_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_078646082.1|10614685_10615867_+	phage late control D family protein	NA	NA	NA	NA	NA
WP_078646083.1|10615863_10616565_+	type IV secretion protein Rhs	NA	NA	NA	NA	NA
WP_078646084.1|10616561_10616966_+	GPW/gp25 family protein	NA	NA	NA	NA	NA
WP_078646085.1|10616962_10618912_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
WP_078646086.1|10618908_10620960_+|plate	putative baseplate assembly protein	plate	NA	NA	NA	NA
>prophage 13
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	11535952	11648344	12012215	transposase	Paenibacillus_phage(18.18%)	96	NA	NA
WP_107439224.1|11535952_11537165_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	40.9	4.2e-35
WP_078646653.1|11537363_11538185_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_078646654.1|11538184_11539126_-	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.7	7.3e-19
WP_078646655.1|11540222_11540747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078646656.1|11541112_11541937_+	methyltransferase	NA	NA	NA	NA	NA
WP_078646657.1|11542407_11543388_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_078646658.1|11545119_11545752_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078646659.1|11545839_11547432_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159037954.1|11547540_11547774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646660.1|11547783_11548896_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078646661.1|11549259_11550354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646662.1|11550433_11551297_+	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_078646663.1|11551323_11551650_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646664.1|11551960_11552734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037955.1|11553339_11554239_-	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.1	1.7e-17
WP_159037956.1|11554279_11554765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078646667.1|11554967_11555630_-	adenylate kinase	NA	NA	NA	NA	NA
WP_078646668.1|11556257_11558600_-	pyruvate dehydrogenase	NA	NA	NA	NA	NA
WP_159037957.1|11558771_11559182_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_078646670.1|11559490_11561056_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_078646671.1|11561156_11562338_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159037958.1|11562645_11562816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646672.1|11562808_11563309_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_078647913.1|11563420_11563786_+	VOC family protein	NA	NA	NA	NA	NA
WP_078646673.1|11564003_11565107_-	MFS transporter	NA	NA	NA	NA	NA
WP_159037959.1|11565911_11566922_-	AMP-binding protein	NA	NA	NA	NA	NA
WP_078647914.1|11567463_11568009_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107439461.1|11568080_11568785_-	creatininase family protein	NA	NA	NA	NA	NA
WP_078646671.1|11569045_11570227_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078646675.1|11570223_11571042_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_078646676.1|11571056_11571836_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_078646677.1|11571828_11572329_+	flavin reductase family protein	NA	NA	NA	NA	NA
WP_078646678.1|11572375_11574205_+	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	22.7	2.8e-38
WP_107439462.1|11574214_11575074_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	45.0	2.2e-22
WP_078646679.1|11576307_11577000_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_107439463.1|11577053_11578271_+	MFS transporter	NA	NA	NA	NA	NA
WP_078646681.1|11578339_11579176_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.2	4.7e-09
WP_078646682.1|11579502_11579763_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646684.1|11580706_11581048_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078646685.1|11581044_11582001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646686.1|11582095_11583007_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_159037960.1|11583388_11583757_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646689.1|11583937_11584591_-	2-phospho-L-lactate guanylyltransferase	NA	NA	NA	NA	NA
WP_078646690.1|11584593_11587158_-	bifunctional FO biosynthesis protein CofGH	NA	A9ZMK9	Mamastrovirus	37.4	1.6e-20
WP_078646691.1|11587446_11588808_-	MFS transporter	NA	NA	NA	NA	NA
WP_078646692.1|11588854_11589166_-	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_107439225.1|11589338_11590157_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078646694.1|11590153_11591215_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078646695.1|11591262_11592006_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_078646696.1|11592099_11593509_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_078646697.1|11593554_11594283_+	NADPH-dependent F420 reductase	NA	NA	NA	NA	NA
WP_078646698.1|11595739_11596489_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_107439226.1|11598295_11598580_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078646699.1|11598521_11598758_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078646700.1|11599071_11599836_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_078646701.1|11599860_11600703_-|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	56.7	2.5e-79
WP_078647918.1|11600994_11601363_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159037631.1|11601533_11602088_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078637958.1|11602084_11602660_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078646702.1|11602901_11604086_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_078646703.1|11604530_11604971_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078646704.1|11605052_11606459_+	MFS transporter	NA	NA	NA	NA	NA
WP_078646705.1|11606494_11607049_+	isochorismatase family protein	NA	NA	NA	NA	NA
WP_159037961.1|11609633_11609885_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_078646708.1|11609936_11610938_-	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078646709.1|11610943_11611570_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078646710.1|11611814_11612825_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_078647919.1|11613148_11614285_+	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_159037962.1|11614350_11615712_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_078647920.1|11615831_11616647_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_078646712.1|11616643_11617549_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_078646713.1|11617716_11617902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037963.1|11619435_11619915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_107439227.1|11622872_11623211_+|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_159037964.1|11623349_11624090_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078646715.1|11624122_11624518_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_078647921.1|11624707_11625274_-|transposase	transposase	transposase	S5VXX4	Leptospira_phage	30.1	1.1e-06
WP_078646716.1|11625454_11626684_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_078646718.1|11630803_11632063_-	YncE family protein	NA	NA	NA	NA	NA
WP_107439464.1|11632423_11633548_-	right-handed parallel beta-helix repeat-containing protein	NA	NA	NA	NA	NA
WP_107439229.1|11633866_11634169_-	IPT/TIG domain-containing protein	NA	NA	NA	NA	NA
WP_078646721.1|11635127_11635409_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078646722.1|11635405_11635993_+	DUF2493 domain-containing protein	NA	NA	NA	NA	NA
WP_078646723.1|11636131_11636245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646724.1|11636371_11637901_+	AAA family ATPase	NA	A0A1P8DII4	Virus_Rctr197k	30.1	7.2e-40
WP_159037965.1|11638087_11638459_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078646726.1|11638455_11639046_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159037966.1|11639267_11639624_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078646728.1|11639620_11640196_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078646729.1|11640401_11640776_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_078646730.1|11640831_11641836_-	DUF1684 domain-containing protein	NA	NA	NA	NA	NA
WP_078646731.1|11641814_11642690_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_078646732.1|11642820_11643435_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078646733.1|11643517_11644525_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078646734.1|11644659_11646258_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	27.4	4.5e-29
WP_078646736.1|11647003_11648344_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP018627	Streptomyces hygroscopicus strain XM201 chromosome, complete genome	12012215	11877935	11934039	12012215	transposase	Streptococcus_phage(100.0%)	41	NA	NA
WP_107439177.1|11877935_11879123_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_078646898.1|11880667_11881687_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_078646899.1|11881683_11885709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078646900.1|11887399_11888908_+	L-fucose/L-arabinose isomerase family protein	NA	NA	NA	NA	NA
WP_159037989.1|11889126_11890569_+	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_162501077.1|11890630_11890741_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_159037990.1|11890767_11890926_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_107439249.1|11890922_11891348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159037991.1|11891427_11891565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078646903.1|11891853_11893017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159037992.1|11893497_11895237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078647939.1|11895775_11896315_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078642610.1|11896239_11896860_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_078642611.1|11896944_11897397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646904.1|11897812_11899774_-	DUF2264 domain-containing protein	NA	NA	NA	NA	NA
WP_078646905.1|11899770_11900754_-	hydroxyacid dehydrogenase	NA	M1NSB9	Streptococcus_phage	27.8	1.0e-10
WP_159037993.1|11901126_11902005_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_078647940.1|11903928_11904771_+	maleylpyruvate isomerase family mycothiol-dependent enzyme	NA	NA	NA	NA	NA
WP_078647941.1|11905323_11906178_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_078646907.1|11906240_11907104_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_078646908.1|11907305_11908967_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_078646909.1|11909013_11911647_+	glycoside hydrolase family 78 protein	NA	NA	NA	NA	NA
WP_159037994.1|11911874_11913008_+	glycoside hydrolase family 99-like domain-containing protein	NA	NA	NA	NA	NA
WP_078646911.1|11913386_11914103_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_078646912.1|11914099_11914246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078646913.1|11914758_11916099_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_078646914.1|11916157_11916994_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_078646915.1|11916990_11917878_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_159037995.1|11917874_11919053_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_159037996.1|11920030_11920201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078646918.1|11920337_11921666_+	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_159037997.1|11922284_11922434_+	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_078646919.1|11922789_11923230_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078646920.1|11923606_11924275_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078646921.1|11924469_11925681_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_107439251.1|11925902_11926781_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078647942.1|11926852_11927404_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_159037998.1|11927400_11928195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078646924.1|11929722_11931489_+	DUF2156 domain-containing protein	NA	NA	NA	NA	NA
WP_078646925.1|11931485_11931680_+	hypothetical protein	NA	NA	NA	NA	NA
WP_107439253.1|11933838_11934039_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
