The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019781	Bartonella sp. WD16.2, complete genome	1762996	121604	128145	1762996		Mannheimia_phage(66.67%)	11	NA	NA
WP_010703127.1|121604_121886_+	protein killer suppression protein	NA	A0A0M3LQB1	Mannheimia_phage	47.3	6.5e-16
WP_078704974.1|121903_122203_+	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	46.6	1.4e-16
WP_078704975.1|123308_123521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078704976.1|123639_124260_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	47.5	2.1e-46
WP_078704977.1|124261_125047_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	39.1	1.6e-40
WP_078704978.1|125187_125865_-	hypothetical protein	NA	A0A0M3LPL3	Mannheimia_phage	61.1	2.6e-10
WP_078704979.1|125901_126213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078704980.1|126212_126626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010702522.1|126817_127129_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_078704981.1|127223_127565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078706098.1|127575_128145_+	hypothetical protein	NA	K4Q356	Edwardsiella_phage	56.9	2.0e-11
>prophage 2
NZ_CP019781	Bartonella sp. WD16.2, complete genome	1762996	434188	443745	1762996		Bacillus_phage(33.33%)	8	NA	NA
WP_078705152.1|434188_436075_+	ABC transporter ATP-binding protein/permease	NA	W8CYL7	Bacillus_phage	27.0	1.4e-37
WP_078705153.1|436189_436888_+	phosphatidylserine decarboxylase	NA	A0A1V0SDU9	Indivirus	29.3	4.9e-12
WP_078705154.1|436896_437736_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_078705155.1|437801_438551_-	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	28.7	5.5e-09
WP_078705156.1|438553_440047_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	2.6e-47
WP_078705157.1|440164_440707_-	CvpA family protein	NA	NA	NA	NA	NA
WP_078705158.1|440859_442236_-	DNA repair protein RadA	NA	W5QUL4	Bacillus_phage	43.1	5.1e-05
WP_078705159.1|442242_443745_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	37.0	3.8e-78
>prophage 3
NZ_CP019781	Bartonella sp. WD16.2, complete genome	1762996	562886	685303	1762996	tail,integrase,capsid,tRNA,plate,portal,terminase,head	Acidithiobacillus_phage(14.29%)	109	590510:590528	641844:641862
WP_078705244.1|562886_564314_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_078705245.1|566810_567293_-	bacterioferritin	NA	NA	NA	NA	NA
WP_078705246.1|567810_568515_+	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_078705247.1|568604_569159_+	DUF2059 domain-containing protein	NA	NA	NA	NA	NA
WP_078705248.1|569357_570746_+	glutathione-disulfide reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	28.5	9.7e-44
WP_078705249.1|570822_572202_+	3-deoxy-7-phosphoheptulonate synthase class II	NA	NA	NA	NA	NA
WP_078705250.1|572324_574001_+	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	38.4	6.5e-95
WP_078705251.1|574011_575394_+|tRNA	glutamate--tRNA ligase	tRNA	A0A2K9L594	Tupanvirus	32.2	2.8e-11
WP_078705252.1|575470_576874_-	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.4	5.2e-53
WP_078705253.1|577016_577790_-	NAD kinase	NA	NA	NA	NA	NA
WP_078705254.1|580777_582169_+	amino acid permease	NA	NA	NA	NA	NA
WP_078705255.1|583615_583978_-	response regulator	NA	NA	NA	NA	NA
WP_078705256.1|584788_585289_+	Hsp20 family protein	NA	M1IPB7	Pelagibacter_phage	39.4	4.3e-18
WP_078705257.1|586064_586439_+	iron-sulfur cluster assembly accessory protein	NA	A0A0P0CQC4	Ostreococcus_lucimarinus_virus	41.3	3.3e-15
WP_078705258.1|587330_588260_-	lipid A biosynthesis lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_078705259.1|588266_589295_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_078705260.1|589355_590633_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
590510:590528	attL	TACCACTAATGCCATTGAT	NA	NA	NA	NA
WP_078706118.1|590644_591820_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_078705261.1|591831_592116_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_078705262.1|592311_594645_-	NADP-dependent malic enzyme	NA	NA	NA	NA	NA
WP_078705263.1|595700_600398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_007477688.1|601565_601805_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_078705264.1|601861_603214_+	GTPase HflX	NA	NA	NA	NA	NA
WP_078705265.1|603345_605109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705266.1|605258_606335_+	heme A synthase	NA	NA	NA	NA	NA
WP_078705267.1|606355_607291_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_078705268.1|607610_608924_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	51.9	6.9e-100
WP_078705269.1|608936_609419_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_078705270.1|609411_610536_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	33.4	1.9e-34
WP_078706119.1|610517_611135_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.9	2.9e-24
WP_078705271.1|611199_611658_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	37.0	8.8e-10
WP_078705272.1|611660_612137_+	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_078705273.1|612201_612675_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_078705274.1|612890_613448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705275.1|613583_614612_+	phosphate acyltransferase PlsX	NA	NA	NA	NA	NA
WP_078705276.1|614705_615680_+	ketoacyl-ACP synthase III	NA	NA	NA	NA	NA
WP_078705277.1|615755_616067_+	integration host factor subunit alpha	NA	Q2A099	Sodalis_phage	34.8	1.1e-08
WP_078705278.1|616272_616791_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_078705279.1|616828_618808_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.7	7.6e-127
WP_078705280.1|618928_619273_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	47.1	1.1e-09
WP_078705281.1|619265_619703_-	iron-sulfur cluster assembly scaffold protein	NA	NA	NA	NA	NA
WP_078705282.1|619827_620448_+	GTP cyclohydrolase I FolE	NA	A0A088F7Y4	Vibrio_phage	43.6	1.5e-41
WP_078705283.1|621494_622367_-	DNA methyltransferase	NA	M4SNK2	Cyanophage	28.1	2.7e-15
WP_078705284.1|622397_623768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078706120.1|625504_626683_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_078705285.1|626833_627322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705286.1|627767_628967_+	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_078705287.1|632904_634062_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1X9HVL9	Ruegeria_phage	39.1	1.3e-73
WP_078705288.1|634338_634857_+	Rha family transcriptional regulator	NA	B5AX29	Iodobacteriophage	54.0	3.6e-20
WP_078663281.1|635080_635296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705290.1|635328_636516_-	DUF3380 domain-containing protein	NA	A0A0A8IK88	Aurantimonas_phage	34.2	2.9e-28
WP_078705291.1|636512_637829_-	late control protein	NA	K4HZC6	Acidithiobacillus_phage	37.9	4.1e-68
WP_078705292.1|637825_638050_-|tail	phage tail protein	tail	A0A088FVH7	Escherichia_phage	47.0	3.6e-09
WP_078705293.1|638046_638436_-|tail	phage tail protein	tail	A0A1W6JT48	Escherichia_phage	46.3	1.8e-24
WP_078705294.1|638441_640484_-|tail	phage tail tape measure protein	tail	A0A2P9HXI8	Yersinia_phage	27.4	1.8e-14
WP_078663274.1|640480_640594_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_078663273.1|640617_640878_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_078663272.1|640879_641386_-|tail	phage major tail tube protein	tail	A0A1B2LRS4	Wolbachia_phage	43.1	1.5e-34
WP_078705295.1|641385_642777_-|tail	phage tail protein	tail	A0A088FVH5	Escherichia_phage	53.6	8.6e-133
641844:641862	attR	TACCACTAATGCCATTGAT	NA	NA	NA	NA
WP_078705296.1|642892_643117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705297.1|643148_644498_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705298.1|644551_645985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705299.1|645998_649157_-	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	33.7	1.1e-148
WP_078705300.1|649158_650262_-|tail	phage tail protein	tail	K4I1F8	Acidithiobacillus_phage	33.2	2.8e-17
WP_078705301.1|650264_651089_-|plate	baseplate assembly protein	plate	Q9JML6	Wolbachia_phage	37.6	2.1e-38
WP_078705302.1|651085_651427_-|plate	baseplate assembly protein W	plate	Q75QM0	Wolbachia_phage	57.0	1.3e-29
WP_078705303.1|651423_652161_-|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	31.3	5.9e-16
WP_078663264.1|652676_653021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705304.1|653022_654099_-|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	37.7	2.2e-59
WP_078705305.1|654112_654478_-|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	38.7	8.8e-13
WP_078706121.1|654474_654741_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705306.1|654941_655802_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	48.9	9.8e-63
WP_078705307.1|655791_657306_-|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	41.2	1.0e-94
WP_078663260.1|657305_657554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705308.1|657557_659453_-|terminase	phage terminase large subunit family protein	terminase	K4I3Y9	Acidithiobacillus_phage	53.6	1.2e-169
WP_078663258.1|659445_660015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705309.1|660275_660863_-	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	31.8	2.8e-08
WP_078705310.1|661826_662297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705311.1|662628_662907_+	plasmid maintenance system killer	NA	NA	NA	NA	NA
WP_078705312.1|662917_663226_+	HigA family addiction module antidote protein	NA	NA	NA	NA	NA
WP_078705313.1|663248_663794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078706122.1|664111_664561_-	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	59.0	8.0e-32
WP_078705315.1|664835_665744_+	DUF488 domain-containing protein	NA	A0A1B3AYW8	Gordonia_phage	32.3	5.1e-09
WP_078706123.1|665820_666123_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	47.9	2.2e-17
WP_078705316.1|666109_666421_+	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	40.4	3.4e-13
WP_078705317.1|666468_666744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705318.1|666740_667481_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	43.1	2.0e-43
WP_078705320.1|668510_668834_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705321.1|668892_669768_-	DNA adenine methylase	NA	M4SNK2	Cyanophage	27.2	5.9e-15
WP_153300984.1|669990_670392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705323.1|670330_670885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705324.1|670938_671490_-	YdaU family protein	NA	A0A076GD06	Sinorhizobium_phage	37.1	2.1e-18
WP_078663288.1|671479_671827_-	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_078705325.1|671816_672299_-	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	61.3	2.6e-44
WP_078705326.1|672304_673177_-	hypothetical protein	NA	F8TV45	EBPR_siphovirus	51.1	2.1e-20
WP_078705327.1|673331_673838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705328.1|673834_674224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010704151.1|674307_674925_+	XRE family transcriptional regulator	NA	A0A1X9HW95	Ruegeria_phage	31.4	9.0e-10
WP_078705329.1|675198_675606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705330.1|675605_675902_+	hypothetical protein	NA	A0A1I9LJV2	Stx_converting_phage	36.2	3.2e-05
WP_078705331.1|675966_676707_+	phage antirepressor Ant	NA	A0A139ZPI9	Marinitoga_camini_virus	41.1	3.2e-38
WP_078705332.1|676718_677510_+	hypothetical protein	NA	A0A0M3LR26	Mannheimia_phage	34.4	2.2e-32
WP_078705333.1|677511_678132_+	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	49.7	8.7e-45
WP_078663298.1|678217_678409_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_078705334.1|678801_680148_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_078705335.1|680162_680648_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_078705336.1|680872_681730_-	DsbA family protein	NA	NA	NA	NA	NA
WP_078705337.1|682403_683921_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_078705338.1|684322_685303_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
>prophage 5
NZ_CP019781	Bartonella sp. WD16.2, complete genome	1762996	885511	894463	1762996		Moraxella_phage(20.0%)	12	NA	NA
WP_010704151.1|885511_886129_-	XRE family transcriptional regulator	NA	A0A1X9HW95	Ruegeria_phage	31.4	9.0e-10
WP_078705497.1|886598_887102_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705498.1|888442_889069_+	hypothetical protein	NA	A0A0P0ZDY7	Stx2-converting_phage	60.4	8.8e-29
WP_078705499.1|889106_889847_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	43.1	3.9e-44
WP_078705500.1|890166_890595_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJC0	Moraxella_phage	38.3	4.6e-13
WP_078705501.1|890966_891260_-	HigA family addiction module antidote protein	NA	A0A0M3LPV0	Mannheimia_phage	43.7	1.6e-12
WP_078705502.1|891276_891558_-	Killer protein	NA	A0A0M3LQB1	Mannheimia_phage	46.2	4.1e-18
WP_078705503.1|891626_892535_-	DUF488 domain-containing protein	NA	A0A1B3AYW8	Gordonia_phage	29.6	3.9e-09
WP_078705504.1|892807_893257_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	57.3	3.0e-31
WP_078705505.1|893271_893802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010703152.1|893870_894071_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0R6PJD4	Moraxella_phage	51.7	5.1e-07
WP_078705506.1|894067_894463_+	CopG family transcriptional regulator	NA	A0A0U4ISP5	Pseudomonas_phage	31.1	1.6e-07
>prophage 6
NZ_CP019781	Bartonella sp. WD16.2, complete genome	1762996	1194789	1201761	1762996		Brucella_phage(28.57%)	12	NA	NA
WP_078705699.1|1194789_1195530_+	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	45.1	1.3e-47
WP_078705700.1|1195526_1195802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705701.1|1195861_1196161_-	putative addiction module antidote protein	NA	A0A141GEX5	Brucella_phage	42.6	7.7e-15
WP_078705702.1|1196141_1196450_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	49.0	9.0e-19
WP_078705704.1|1197334_1197871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010703919.1|1197976_1198204_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_078663354.1|1198187_1198457_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SB46	Streptococcus_phage	45.1	2.2e-13
WP_078705705.1|1198763_1199264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153300992.1|1199267_1200116_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_078705706.1|1200304_1200892_+	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	31.8	3.6e-08
WP_010704172.1|1201133_1201430_-	HigA family addiction module antidote protein	NA	M9MUN2	Rhodococcus_phage	47.1	1.2e-12
WP_078705707.1|1201446_1201761_-	Killer protein	NA	A0A222YWE2	Escherichia_phage	38.7	6.6e-09
>prophage 7
NZ_CP019781	Bartonella sp. WD16.2, complete genome	1762996	1240076	1293659	1762996	integrase,tail,capsid,tRNA,plate,portal,head	Acidithiobacillus_phage(20.51%)	70	1229528:1229547	1250479:1250498
1229528:1229547	attL	TCTTTAAGCTCTTCTTCAAC	NA	NA	NA	NA
WP_078705724.1|1240076_1241033_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	42.1	8.9e-65
WP_078705725.1|1241025_1241976_+	iron chelate uptake ABC transporter family permease subunit	NA	NA	NA	NA	NA
WP_078705726.1|1241972_1242731_+	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	25.2	1.0e-15
WP_078705727.1|1242948_1243992_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A291AUF0	Sinorhizobium_phage	31.9	8.9e-34
WP_078705492.1|1243994_1244246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705728.1|1244374_1244995_-	YqaJ viral recombinase family protein	NA	A0A0U2BXF3	Paracoccus_phage	47.5	2.4e-47
WP_078705729.1|1244996_1245773_-	phage recombination protein Bet	NA	A0A0M3LR26	Mannheimia_phage	40.4	2.1e-40
WP_078705730.1|1245784_1246525_-	phage antirepressor Ant	NA	Q7Y5W2	Haemophilus_phage	41.7	4.5e-40
WP_078705731.1|1246577_1246934_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705732.1|1247098_1247719_-	helix-turn-helix transcriptional regulator	NA	A0A1X9HW95	Ruegeria_phage	41.5	3.4e-17
WP_078705733.1|1247829_1248099_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_078705734.1|1248095_1248422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153300995.1|1249429_1249939_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	60.6	4.6e-44
WP_153300996.1|1249964_1250228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705736.1|1250217_1250541_+	DUF1376 domain-containing protein	NA	A0A076GD06	Sinorhizobium_phage	36.4	1.3e-07
1250479:1250498	attR	GTTGAAGAAGAGCTTAAAGA	NA	NA	NA	NA
WP_078705738.1|1250843_1251167_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_078705739.1|1251156_1252281_+	DUF1376 domain-containing protein	NA	NA	NA	NA	NA
WP_078705740.1|1252264_1252618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705741.1|1252812_1253307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705742.1|1253878_1254511_+	hypothetical protein	NA	A0A139ZPI9	Marinitoga_camini_virus	48.3	8.9e-29
WP_078705743.1|1254541_1255177_+	hypothetical protein	NA	Q7Y5W2	Haemophilus_phage	54.0	8.4e-27
WP_078705744.1|1255204_1255936_+	phage antirepressor Ant	NA	A0A0R6PHG7	Moraxella_phage	62.5	5.0e-23
WP_078705745.1|1255932_1256208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705746.1|1256311_1257721_+|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.9	6.4e-35
WP_078705747.1|1257808_1258114_-	BrnA antitoxin family protein	NA	K4NZP3	Burkholderia_phage	40.0	5.6e-05
WP_078664137.1|1258091_1258391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705748.1|1258436_1259345_-	DUF488 domain-containing protein	NA	A0A1B3AYW8	Gordonia_phage	31.5	4.3e-08
WP_078705504.1|1259617_1260067_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	57.3	3.0e-31
WP_078705749.1|1260081_1260627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705750.1|1260630_1261053_-	type II toxin-antitoxin system HicB family antitoxin	NA	Q7Y3V7	Yersinia_phage	37.9	4.4e-16
WP_078663497.1|1261082_1261265_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_078705705.1|1261756_1262257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153300992.1|1262260_1263109_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_078705706.1|1263297_1263885_+	hypothetical protein	NA	A0A0A8IL87	Aurantimonas_phage	31.8	3.6e-08
WP_078705751.1|1264230_1264503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078663675.1|1264489_1264786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705752.1|1264857_1265427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078663260.1|1267317_1267566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705753.1|1267565_1269080_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	41.2	5.0e-94
WP_153300997.1|1269069_1269930_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	48.9	2.0e-63
WP_078706121.1|1270130_1270397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705754.1|1270393_1270759_+|head	head decoration protein	head	A0A0A8IL52	Aurantimonas_phage	39.5	3.9e-13
WP_078705755.1|1270772_1271849_+|capsid	major capsid protein	capsid	A0A0A8ILA9	Aurantimonas_phage	37.5	2.2e-59
WP_078705756.1|1271850_1272195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705757.1|1272274_1272823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_078705758.1|1272901_1273219_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0K2CZV4	Paenibacillus_phage	32.0	1.1e-06
WP_078705759.1|1273208_1273463_-	toxin HicA	NA	A0A2P1A0R7	Gordonia_phage	62.5	1.1e-06
WP_078705760.1|1273552_1273834_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_078705761.1|1273820_1274084_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_153300998.1|1274219_1274741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705762.1|1274734_1275472_+|plate	phage baseplate assembly protein V	plate	V5YUM9	Pseudomonas_phage	33.3	8.8e-20
WP_078705763.1|1275468_1275810_+|plate	baseplate assembly protein W	plate	Q75QM0	Wolbachia_phage	56.1	1.5e-30
WP_078705764.1|1275806_1276631_+|plate	baseplate assembly protein	plate	K4HZB7	Acidithiobacillus_phage	36.0	1.6e-38
WP_078705765.1|1276633_1277737_+|tail	phage tail protein	tail	K4I1F8	Acidithiobacillus_phage	33.2	2.8e-17
WP_078705766.1|1277738_1280897_+	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	33.9	1.0e-149
WP_078705767.1|1282358_1283666_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705768.1|1283700_1283922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078705769.1|1283945_1284302_-	transcriptional regulator	NA	A0A222YXG1	Escherichia_phage	68.4	2.2e-40
WP_078706150.1|1284304_1284574_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	46.1	3.1e-15
WP_078705770.1|1284748_1286140_+|tail	phage tail protein	tail	A0A088FVH5	Escherichia_phage	54.1	1.3e-133
WP_078705771.1|1286139_1286646_+|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	40.7	1.4e-32
WP_078705772.1|1286647_1286911_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_078705773.1|1286934_1287048_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_078705774.1|1287044_1289075_+|tail	phage tail tape measure protein	tail	A0A2P9HXI8	Yersinia_phage	27.0	6.9e-14
WP_078663277.1|1289080_1289470_+|tail	phage tail protein	tail	A0A1W6JT48	Escherichia_phage	46.3	4.1e-24
WP_078663278.1|1289466_1289691_+|tail	phage tail protein	tail	A0A077K8R0	Ralstonia_phage	46.8	3.7e-06
WP_078705775.1|1289687_1291004_+	late control protein	NA	K4HZC6	Acidithiobacillus_phage	37.9	5.3e-68
WP_078705776.1|1291000_1292188_+	DUF3380 domain-containing protein	NA	A0A0A8IK88	Aurantimonas_phage	34.7	2.9e-28
WP_153300999.1|1292188_1292404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_153301021.1|1293173_1293659_-	phage antirepressor Ant	NA	A0A0P0ZDY7	Stx2-converting_phage	49.3	1.6e-09
