The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019977	Campylobacter coli strain aerotolerant OR12 chromosome, complete genome	2033919	641113	651284	2033919		uncultured_virus(14.29%)	11	NA	NA
WP_072219014.1|641113_643474_+	heavy metal translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	29.4	1.4e-74
WP_002777240.1|643470_643671_+	cbb3-type cytochrome oxidase assembly protein	NA	NA	NA	NA	NA
WP_002777238.1|643700_644000_-	cytochrome c	NA	NA	NA	NA	NA
WP_002790119.1|644118_644640_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_002796064.1|644636_645590_+	ADP-glyceromanno-heptose 6-epimerase	NA	A0A2K9L4U8	Tupanvirus	31.0	2.0e-24
WP_058914606.1|645582_646968_+	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A0K0KVL9	Prochlorococcus_phage	45.4	2.5e-23
WP_002794353.1|646964_647525_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	36.7	5.3e-17
WP_002794354.1|647500_648466_-	lipopolysaccharide heptosyltransferase II	NA	NA	NA	NA	NA
WP_002799677.1|648524_649361_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	37.6	5.5e-10
WP_002782985.1|649370_650249_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	62.8	4.9e-102
WP_002794358.1|650252_651284_+	dTDP-glucose 4,6-dehydratase	NA	H9NC62	Sphingomonas_phage	45.5	1.1e-73
>prophage 2
NZ_CP019977	Campylobacter coli strain aerotolerant OR12 chromosome, complete genome	2033919	1751470	1800037	2033919	transposase,protease,terminase,integrase,plate,capsid,tail	Campylobacter_phage(54.55%)	68	1755477:1755493	1768685:1768701
WP_002778039.1|1751470_1752694_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	53.8	4.0e-118
WP_002778038.1|1752686_1753478_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_002782472.1|1753488_1753929_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002778036.1|1754043_1755135_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_002778035.1|1755134_1755593_-	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
1755477:1755493	attL	AGGATAAAAATATAAAA	NA	NA	NA	NA
WP_002778034.1|1755589_1755796_-	4-oxalocrotonate tautomerase family protein	NA	NA	NA	NA	NA
WP_002782466.1|1756122_1757037_+	branched-chain-amino-acid transaminase	NA	NA	NA	NA	NA
WP_002778030.1|1757052_1758135_+	membrane protein	NA	NA	NA	NA	NA
WP_002782463.1|1758145_1758676_+	DUF2393 family protein	NA	NA	NA	NA	NA
WP_002778025.1|1758675_1759185_+	DUF2393 family protein	NA	NA	NA	NA	NA
WP_058914722.1|1759297_1761415_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	78.2	6.7e-12
WP_032595779.1|1761613_1762129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793922.1|1762292_1762916_-	LexA family transcriptional regulator	NA	A5X9F5	Aeromonas_virus	33.1	4.7e-06
WP_002793921.1|1763058_1763259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058914723.1|1763255_1765331_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M4U788	Ralstonia_phage	24.7	8.6e-12
WP_058914724.1|1765401_1766325_+	AAA family ATPase	NA	A0A0N7ACA6	Bacillus_phage	26.5	7.4e-16
WP_002795448.1|1766327_1766519_+	DNA-directed RNA polymerase sigma-70 factor	NA	NA	NA	NA	NA
WP_002824157.1|1766515_1766701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791419.1|1766757_1767099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002806832.1|1767205_1767691_+	host-nuclease inhibitor Gam family protein	NA	A0A2H4JE65	uncultured_Caudovirales_phage	36.4	2.9e-19
WP_002791416.1|1767687_1767867_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791414.1|1767930_1768203_+	hypothetical protein	NA	A0A1D8EXF2	Campylobacter_phage	45.2	3.6e-11
WP_002834952.1|1768199_1768595_+	hypothetical protein	NA	X2KXC8	Campylobacter_phage	86.7	3.4e-34
WP_002804623.1|1768599_1769142_+	SAM-dependent DNA methyltransferase	NA	A0A1B0XVK2	Campylobacter_phage	79.1	9.8e-77
1768685:1768701	attR	AGGATAAAAATATAAAA	NA	NA	NA	NA
WP_002843357.1|1769166_1769553_+	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	55.7	6.0e-36
WP_002791411.1|1769662_1770625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|1770621_1770891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052783591.1|1770890_1771583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_052774912.1|1771579_1772029_+	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_002834645.1|1772180_1772351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791403.1|1772805_1773090_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_002793902.1|1773086_1774064_-|tail	tail protein	tail	NA	NA	NA	NA
WP_002793900.1|1774057_1774249_-|tail	tail protein X	tail	NA	NA	NA	NA
WP_002793898.1|1774241_1774616_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002793896.1|1774741_1775977_-	hypothetical protein	NA	A0A0M4UTA3	Ralstonia_phage	33.0	1.4e-25
WP_002827126.1|1775979_1777350_-	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.3	1.0e-16
WP_002794188.1|1777359_1779030_-|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	41.2	1.1e-91
WP_002784511.1|1779029_1779512_-	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002784509.1|1779504_1779963_-	DUF1320 family protein	NA	NA	NA	NA	NA
WP_002794190.1|1780078_1781056_-|capsid	major capsid protein	capsid	R9TRN2	Rhizobium_phage	23.7	3.9e-07
WP_002791394.1|1781058_1781586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827123.1|1781588_1782404_-	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002784501.1|1782405_1782840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827121.1|1782987_1783377_+	DUF882 domain-containing protein	NA	A0A2I7R2R3	Vibrio_phage	43.3	6.5e-22
WP_002827119.1|1783387_1783729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002841920.1|1783725_1783974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784492.1|1784085_1784400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002827116.1|1784399_1785032_+|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_002784486.1|1785040_1785232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002789997.1|1785228_1785519_+	GPW/gp25 family protein	NA	Q75QM0	Wolbachia_phage	48.7	7.7e-12
WP_002827114.1|1785515_1786682_+|plate	baseplate J/gp47 family protein	plate	A0A1B2LRR9	Wolbachia_phage	50.0	4.5e-10
WP_002827112.1|1786678_1787299_+|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	94.0	2.2e-56
WP_058914725.1|1787298_1788333_+|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	88.8	2.6e-78
WP_002784668.1|1788342_1788978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002784666.1|1788977_1790735_+	radical SAM protein	NA	NA	NA	NA	NA
WP_002789987.1|1790727_1791114_+	DUF1353 domain-containing protein	NA	A7YGM3	Campylobacter_phage	88.4	9.2e-61
WP_002794203.1|1791110_1792124_+	hypothetical protein	NA	A7YGY4	Campylobacter_phage	95.8	1.2e-184
WP_002794204.1|1792134_1793328_+|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	98.7	1.4e-200
WP_002794205.1|1793351_1793861_+|tail	phage major tail tube protein	tail	A7YGZ4	Campylobacter_phage	99.4	5.6e-90
WP_002791367.1|1793964_1794204_+|tail	phage tail assembly protein	tail	A7YG75	Campylobacter_phage	89.9	1.5e-08
WP_002791365.1|1794315_1794621_-	hypothetical protein	NA	A7YG88	Campylobacter_phage	90.1	1.9e-32
WP_002791362.1|1794662_1796996_+|tail	phage tail tape measure protein	tail	A7YGE8	Campylobacter_phage	89.8	0.0e+00
WP_002791360.1|1796999_1797488_+	phage virion morphogenesis protein	NA	A7YGZ0	Campylobacter_phage	90.7	8.6e-80
WP_002794206.1|1797592_1798408_+	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	94.5	2.2e-144
WP_002784651.1|1798435_1798723_-	hypothetical protein	NA	A7YGG4	Campylobacter_phage	97.9	1.6e-46
WP_002784648.1|1798802_1798997_-	hypothetical protein	NA	A7YG72	Campylobacter_phage	96.9	1.1e-27
WP_002784647.1|1799006_1799327_-	hypothetical protein	NA	A7YG71	Campylobacter_phage	97.2	1.6e-50
WP_002784646.1|1799407_1800037_-	S24 family peptidase	NA	A7YG70	Campylobacter_phage	98.2	4.8e-59
>prophage 3
NZ_CP019977	Campylobacter coli strain aerotolerant OR12 chromosome, complete genome	2033919	1830063	1919975	2033919	protease,transposase,terminase,integrase,plate,tRNA,capsid,tail	Campylobacter_phage(48.72%)	99	1913619:1913639	1923638:1923658
WP_002777939.1|1830063_1831872_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.7	1.3e-112
WP_002781863.1|1832003_1832807_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_002790232.1|1837416_1842669_-	alpha-2-macroglobulin	NA	NA	NA	NA	NA
WP_002777931.1|1842852_1843206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002787562.1|1843308_1844457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002781850.1|1844456_1845638_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	33.2	7.0e-51
WP_002785406.1|1845707_1846436_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_002777919.1|1846437_1847775_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.4	2.5e-57
WP_002790228.1|1847778_1848426_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002777913.1|1848922_1849495_+	cytochrome c3 family protein	NA	NA	NA	NA	NA
WP_002777910.1|1852191_1852539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002791262.1|1854226_1856008_+	PhoX family phosphatase	NA	NA	NA	NA	NA
WP_058914727.1|1856132_1857071_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	42.2	5.5e-59
WP_002778629.1|1857206_1857521_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	48.9	1.5e-21
WP_002778626.1|1857575_1857914_-	YraN family protein	NA	NA	NA	NA	NA
WP_002778624.1|1857913_1859164_-	homoserine dehydrogenase	NA	NA	NA	NA	NA
WP_002778622.1|1859165_1860371_-	LL-diaminopimelate aminotransferase	NA	NA	NA	NA	NA
WP_002778620.1|1860383_1861190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058914728.1|1861183_1862131_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778617.1|1862123_1862807_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_002778615.1|1862819_1863644_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	39.0	1.3e-35
WP_002778612.1|1863646_1863847_-	50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_002781505.1|1863925_1864579_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_002778609.1|1864579_1864987_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778601.1|1864987_1865410_-	cytochrome c	NA	NA	NA	NA	NA
WP_002778599.1|1865409_1865991_-	6-carboxytetrahydropterin synthase	NA	NA	NA	NA	NA
WP_002781502.1|1865987_1866731_-	7-carboxy-7-deazaguanine synthase QueE	NA	H6SUE5	Campylobacter_virus	34.5	1.2e-32
WP_002778595.1|1866733_1867696_-	GTP 3',8-cyclase MoaA	NA	NA	NA	NA	NA
WP_002778593.1|1867711_1868230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778591.1|1868222_1868723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002778589.1|1868713_1869598_-	4-hydroxybenzoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_002781500.1|1869669_1870539_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002778585.1|1870524_1871088_-	manganese efflux pump	NA	NA	NA	NA	NA
WP_100219680.1|1872015_1872327_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_002778576.1|1872432_1873095_+	superoxide dismutase [Fe]	NA	NA	NA	NA	NA
WP_002778575.1|1873121_1874327_-	saccharopine dehydrogenase family protein	NA	NA	NA	NA	NA
WP_072212050.1|1874362_1875271_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	8.3e-20
WP_002790598.1|1875254_1876871_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_002778568.1|1876870_1877875_-	Fe(3+) ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002778566.1|1877875_1877998_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002826909.1|1878241_1879084_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_058914729.1|1879093_1881370_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_002784646.1|1881942_1882572_+	S24 family peptidase	NA	A7YG70	Campylobacter_phage	98.2	4.8e-59
WP_002784647.1|1882652_1882973_+	hypothetical protein	NA	A7YG71	Campylobacter_phage	97.2	1.6e-50
WP_002784648.1|1882982_1883177_+	hypothetical protein	NA	A7YG72	Campylobacter_phage	96.9	1.1e-27
WP_002784651.1|1883256_1883544_+	hypothetical protein	NA	A7YGG4	Campylobacter_phage	97.9	1.6e-46
WP_002794206.1|1883571_1884387_-	DNA adenine methylase	NA	A7YGG5	Campylobacter_phage	94.5	2.2e-144
WP_002791360.1|1884491_1884980_-	phage virion morphogenesis protein	NA	A7YGZ0	Campylobacter_phage	90.7	8.6e-80
WP_002791362.1|1884983_1887317_-|tail	phage tail tape measure protein	tail	A7YGE8	Campylobacter_phage	89.8	0.0e+00
WP_002791365.1|1887358_1887664_+	hypothetical protein	NA	A7YG88	Campylobacter_phage	90.1	1.9e-32
WP_002791367.1|1887775_1888015_-|tail	phage tail assembly protein	tail	A7YG75	Campylobacter_phage	89.9	1.5e-08
WP_002794205.1|1888118_1888628_-|tail	phage major tail tube protein	tail	A7YGZ4	Campylobacter_phage	99.4	5.6e-90
WP_002794204.1|1888651_1889845_-|tail	phage tail sheath family protein	tail	A7YGY2	Campylobacter_phage	98.7	1.4e-200
WP_002794203.1|1889855_1890869_-	hypothetical protein	NA	A7YGY4	Campylobacter_phage	95.8	1.2e-184
WP_002789987.1|1890865_1891252_-	DUF1353 domain-containing protein	NA	A7YGM3	Campylobacter_phage	88.4	9.2e-61
WP_002784666.1|1891244_1893002_-	radical SAM protein	NA	NA	NA	NA	NA
WP_002784668.1|1893001_1893637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058914725.1|1893646_1894681_-|tail	phage tail protein	tail	A7YGA7	Campylobacter_phage	88.8	2.6e-78
WP_002827112.1|1894680_1895301_-|tail	phage tail protein I	tail	A7YGG0	Campylobacter_phage	94.0	2.2e-56
WP_002827114.1|1895297_1896464_-|plate	baseplate J/gp47 family protein	plate	A0A1B2LRR9	Wolbachia_phage	50.0	4.5e-10
WP_002789997.1|1896460_1896751_-	GPW/gp25 family protein	NA	Q75QM0	Wolbachia_phage	48.7	7.7e-12
WP_002784486.1|1896747_1896939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827116.1|1896947_1897580_-|plate	phage baseplate assembly protein V	plate	NA	NA	NA	NA
WP_002784492.1|1897579_1897894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002841920.1|1898005_1898254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827119.1|1898250_1898592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002827121.1|1898602_1898992_-	DUF882 domain-containing protein	NA	A0A2I7R2R3	Vibrio_phage	43.3	6.5e-22
WP_002784501.1|1899139_1899574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002827123.1|1899575_1900391_+	hypothetical protein	NA	A0A2H4JAW3	uncultured_Caudovirales_phage	48.4	2.9e-24
WP_002791394.1|1900393_1900921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002794190.1|1900923_1901901_+|capsid	major capsid protein	capsid	R9TRN2	Rhizobium_phage	23.7	3.9e-07
WP_002784509.1|1902016_1902475_+	DUF1320 family protein	NA	NA	NA	NA	NA
WP_002784511.1|1902467_1902950_+	DUF1804 family protein	NA	NA	NA	NA	NA
WP_002794188.1|1902949_1904620_+|terminase	phage terminase large subunit	terminase	H1ZZE1	Pseudomonas_virus	41.2	1.1e-91
WP_002827126.1|1904629_1906000_+	DUF935 family protein	NA	A0A2H4JHL1	uncultured_Caudovirales_phage	26.3	1.0e-16
WP_002793896.1|1906002_1907238_+	hypothetical protein	NA	A0A0M4UTA3	Ralstonia_phage	33.0	1.4e-25
WP_002793898.1|1907363_1907738_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_002793900.1|1907730_1907922_+|tail	tail protein X	tail	NA	NA	NA	NA
WP_002793902.1|1907915_1908893_+|tail	tail protein	tail	NA	NA	NA	NA
WP_002791403.1|1908889_1909174_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_002834645.1|1909628_1909799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052774912.1|1909950_1910400_-	DUF1018 domain-containing protein	NA	NA	NA	NA	NA
WP_052783591.1|1910396_1911089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002784531.1|1911088_1911358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002791411.1|1911354_1912317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002843357.1|1912426_1912813_-	hypothetical protein	NA	D5GVQ0	Campylobacter_virus	55.7	6.0e-36
WP_002804623.1|1912837_1913380_-	SAM-dependent DNA methyltransferase	NA	A0A1B0XVK2	Campylobacter_phage	79.1	9.8e-77
WP_002834952.1|1913384_1913780_-	hypothetical protein	NA	X2KXC8	Campylobacter_phage	86.7	3.4e-34
1913619:1913639	attL	AAGTCCTGTAAAAAGCTCTAT	NA	NA	NA	NA
WP_002791414.1|1913776_1914049_-	hypothetical protein	NA	A0A1D8EXF2	Campylobacter_phage	45.2	3.6e-11
WP_002793910.1|1914112_1914292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793911.1|1914288_1914774_-	host-nuclease inhibitor Gam family protein	NA	A0A2H4JE65	uncultured_Caudovirales_phage	34.4	5.4e-18
WP_002793912.1|1914774_1914972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002793915.1|1914968_1915307_-	DUF4406 domain-containing protein	NA	NA	NA	NA	NA
WP_002784541.1|1915508_1915694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052774911.1|1915690_1915882_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_058914724.1|1915884_1916808_-	AAA family ATPase	NA	A0A0N7ACA6	Bacillus_phage	26.5	7.4e-16
WP_058914730.1|1916878_1918954_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A0M4U788	Ralstonia_phage	24.7	8.6e-12
WP_002793921.1|1918950_1919151_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002804144.1|1919300_1919975_+	LexA family transcriptional regulator	NA	X2KRC9	Campylobacter_phage	32.1	9.8e-26
1923638:1923658	attR	ATAGAGCTTTTTACAGGACTT	NA	NA	NA	NA
