The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	254566	297169	5076615	integrase,plate,transposase	Streptococcus_phage(28.57%)	39	295066:295125	305700:305778
WP_000224516.1|254566_255913_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001013423.1|255915_256440_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000433564.1|256436_257729_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000896714.1|257733_258783_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_000863402.1|258746_260588_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000946068.1|260593_261019_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000111582.1|261023_262508_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000041480.1|262530_263034_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142963.1|263739_264258_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000053636.1|264478_266461_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.2	2.6e-26
WP_000571853.1|266567_267614_+	DUF2169 domain-containing protein	NA	NA	NA	NA	NA
WP_000528852.1|267606_269046_+	DUF4150 domain-containing protein	NA	NA	NA	NA	NA
WP_000513317.1|269020_269311_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000227712.1|270561_271065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001298174.1|271158_271647_+	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_001118042.1|271917_272688_-	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000532690.1|272841_273315_+	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_000973137.1|273357_275802_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284050.1|276041_276620_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_001331866.1|276824_277592_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|277562_278303_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000093936.1|278614_279364_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.5e-19
WP_000006241.1|279539_280037_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_014639450.1|280119_280278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001555810.1|280356_282096_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207544.1|282040_282826_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226168.1|282896_283952_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000554758.1|284003_284297_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263500.1|284299_284698_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059895.1|284707_285160_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001331869.1|285337_286489_+	RNA ligase RtcB family protein	NA	A0A222ZMP7	Mycobacterium_phage	31.8	3.5e-31
WP_000602123.1|286485_287100_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001291988.1|288875_289334_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189577.1|289425_290670_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174703.1|290727_291129_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749902.1|291238_292294_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.3	2.2e-117
WP_001285288.1|292582_293686_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893305.1|293697_294951_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.5	2.6e-96
295066:295125	attL	GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACT	NA	NA	NA	NA
WP_000068782.1|295228_297169_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000068782.1|295228_297169_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
305700:305778	attR	GCCGATATAGCTCAGTTGGTAGAGCAGCGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTC	NA	NA	NA	NA
>prophage 2
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	882424	953053	5076615	portal,protease,tail,capsid,head,integrase,plate,tRNA,holin,terminase	Enterobacteria_phage(66.67%)	75	912471:912490	949765:949784
WP_000188147.1|882424_884371_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|884443_884668_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|884990_885311_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|885341_887618_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000097881.1|888510_889494_+	type I-F CRISPR-associated endonuclease Cas1	NA	A0A2D0YFC9	Vibrio_phage	35.5	3.4e-43
WP_001101565.1|889490_892724_+	type I-F CRISPR-associated helicase Cas3	NA	A0A2I7RCU8	Vibrio_phage	28.0	1.0e-83
WP_000415806.1|893053_894361_+	type I-F CRISPR-associated protein Csy1	NA	NA	NA	NA	NA
WP_001029748.1|895291_896293_+	type I-F CRISPR-associated protein Csy3	NA	A0A2D0YRR8	Vibrio_phage	40.2	7.2e-49
WP_000350182.1|896303_896858_+	type I-F CRISPR-associated endoribonuclease Cas6/Csy4	NA	NA	NA	NA	NA
WP_001040187.1|897899_898118_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241673.1|898402_899107_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001202197.1|899148_900870_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	30.3	7.6e-14
WP_001043637.1|900870_902637_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.0	9.2e-23
WP_000537432.1|902759_903725_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|904268_904763_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077108.1|904897_908941_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|909099_909711_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067797.1|909721_911065_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|911155_912448_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
912471:912490	attL	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000078920.1|912750_912891_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	100.0	7.0e-19
WP_000488106.1|913082_913343_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000132812.1|913385_914495_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	94.3	3.1e-194
WP_000005452.1|914652_915837_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.0	1.1e-224
WP_000290450.1|915836_916349_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	100.0	3.2e-93
WP_000651580.1|916404_916779_+	hypothetical protein	NA	A0A0A7NPZ0	Enterobacteria_phage	73.2	4.0e-37
WP_000333503.1|916787_916943_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	96.1	9.7e-22
WP_000853458.1|916929_919737_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.4	0.0e+00
WP_000979945.1|919749_920238_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905061.1|920266_920866_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	98.9	3.8e-98
WP_000972139.1|921644_922178_+|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	8.4e-97
WP_001164120.1|922206_922734_-|tail	tail fiber assembly protein	tail	A0A222YWC2	Escherichia_phage	97.7	7.3e-93
WP_048231037.1|922737_924888_-|tail	phage tail protein	tail	Q7Y4D4	Escherichia_virus	83.1	8.7e-302
WP_000071719.1|924890_925421_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.8	4.3e-93
WP_001111963.1|925413_926310_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	98.3	2.3e-155
WP_001067548.1|926313_926643_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_089622660.1|926660_927227_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	96.3	6.2e-98
WP_000356336.1|927238_927874_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	4.1e-114
WP_000920594.1|927866_928334_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780575.1|928471_928879_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	2.5e-64
WP_000072332.1|928875_929268_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000104352.1|929264_929588_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	98.1	3.6e-50
WP_000864901.1|929590_929791_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|929790_930285_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632354.1|930386_931187_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	91.4	1.1e-129
WP_001055104.1|931232_932285_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262654.1|932308_933145_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.3	7.9e-150
WP_000613782.1|933299_935051_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|935050_936097_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000206716.1|936587_936848_-	hypothetical protein	NA	A5LH60	Enterobacteria_phage	83.3	3.4e-35
WP_000224227.1|936858_937122_-	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_001167297.1|937123_937615_-	hypothetical protein	NA	G9L661	Escherichia_phage	92.6	7.5e-84
WP_001080499.1|937617_937932_-	hypothetical protein	NA	A0A0A7NRY2	Enterobacteria_phage	94.2	1.3e-49
WP_001163786.1|937928_938261_-	carboxylate--amine ligase	NA	A0A0A7NV51	Enterobacteria_phage	96.3	9.3e-54
WP_000211273.1|938324_938636_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	92.2	1.2e-47
WP_000686511.1|938640_939600_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.7	4.2e-179
WP_000123468.1|939676_942499_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.3	0.0e+00
WP_000599371.1|942505_942871_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	8.7e-61
WP_170996103.1|942867_943491_-	ash family protein	NA	NA	NA	NA	NA
WP_000735345.1|943544_944369_-	hypothetical protein	NA	A0A0A7NPW9	Enterobacteria_phage	96.3	8.7e-125
WP_001036814.1|944365_944578_-	hypothetical protein	NA	A0A0A7NQ74	Enterobacteria_phage	86.6	7.6e-25
WP_000104291.1|944589_944889_-	ead/Ea22-like family protein	NA	A0A0A7NRX6	Enterobacteria_phage	90.9	1.6e-41
WP_000153700.1|944885_945152_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|945148_945352_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543035.1|945375_945786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021656.1|945879_945993_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	2.5e-11
WP_000514277.1|945989_946232_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158968.1|946243_946531_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	3.0e-32
WP_000776265.1|946541_946892_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	94.8	2.5e-57
WP_001287827.1|947027_947219_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000856386.1|947225_947648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204238.1|947652_948174_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000247830.1|948277_948619_+	helix-turn-helix transcriptional regulator	NA	Q1JS21	Enterobacteria_phage	47.1	2.5e-17
WP_000023738.1|948688_949681_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	56.5	2.0e-104
WP_000850286.1|949980_952425_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.9	7.8e-222
949765:949784	attR	AAAGCGCCTGCGGGCGCTTT	NA	NA	NA	NA
WP_000213098.1|952435_953053_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
>prophage 3
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	1238939	1284142	5076615	protease,lysis,tail,capsid,head,integrase,tRNA,portal,terminase	Enterobacteria_phage(54.39%)	65	1229459:1229472	1259230:1259243
1229459:1229472	attL	CACCACCACAAATG	NA	NA	NA	NA
WP_001298466.1|1238939_1240046_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1240099_1240561_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248695.1|1240570_1241224_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444487.1|1241395_1242646_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741335.1|1242759_1243902_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z02	Phage_21	100.0	3.6e-206
WP_000088653.1|1243891_1244128_-	excisionase	NA	NA	NA	NA	NA
WP_000490213.1|1244267_1244507_-	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.2	4.7e-39
WP_000002139.1|1244490_1244817_-	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	95.7	9.8e-48
WP_000763374.1|1244816_1245038_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	93.2	2.3e-32
WP_000548516.1|1245424_1245616_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	93.7	1.8e-25
WP_000149537.1|1245588_1245771_-	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	1.8e-27
WP_000186848.1|1245767_1246448_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_000100847.1|1246444_1247230_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995434.1|1247235_1247532_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	1.1e-48
WP_000372923.1|1247607_1247751_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_001198860.1|1247719_1247884_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	100.0	1.4e-26
WP_000065374.1|1247956_1248325_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_000213979.1|1248507_1248708_-	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	7.1e-33
WP_001066170.1|1248921_1249503_+	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.7	1.4e-92
WP_000088199.1|1249519_1249792_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.8e-40
WP_000438342.1|1249769_1249952_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	98.3	1.1e-27
WP_000968518.1|1250228_1250981_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_001062368.1|1250977_1251535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302016.1|1251574_1252270_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1252345_1252561_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442609.1|1252702_1252999_+	hypothetical protein	NA	G9L678	Escherichia_phage	94.9	2.2e-46
WP_000185431.1|1253031_1253931_+	replication protein	NA	K7P7F0	Enterobacteria_phage	99.0	3.5e-172
WP_000788872.1|1253927_1254629_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	2.9e-129
WP_000145927.1|1254625_1254916_+	protein ren	NA	O48423	Enterobacteria_phage	97.9	2.8e-46
WP_000736913.1|1254989_1255430_+	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000153286.1|1255426_1255954_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	4.7e-100
WP_001254243.1|1255950_1256127_+	NinE family protein	NA	A5VW90	Enterobacteria_phage	96.6	3.3e-26
WP_000386643.1|1256129_1256471_+	DUF2591 family protein	NA	Q76H72	Enterobacteria_phage	96.5	1.6e-61
WP_001099712.1|1256677_1257040_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971053.1|1257036_1257177_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	3.6e-07
WP_001204776.1|1257262_1257646_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737271.1|1257834_1258917_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
WP_000839596.1|1259505_1259721_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
1259230:1259243	attR	CATTTGTGGTGGTG	NA	NA	NA	NA
WP_001135277.1|1259720_1260218_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	5.4e-90
WP_001228695.1|1260434_1260617_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001298464.1|1260707_1261001_-	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	92.8	7.0e-45
WP_000830178.1|1261481_1261808_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_000881610.1|1262014_1262197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000867568.1|1262760_1263309_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_001304453.1|1263280_1265209_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	3.3e-260
WP_000258997.1|1265192_1265399_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_000831761.1|1265395_1266988_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253914.1|1266977_1268483_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	3.6e-100
WP_000256840.1|1268519_1268867_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_000522648.1|1268924_1269953_+|capsid	minor capsid protein E	capsid	C6ZCY2	Enterobacteria_phage	61.6	5.9e-115
WP_000201530.1|1270004_1270379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204540.1|1270371_1270725_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	65.0	3.4e-38
WP_000975062.1|1270736_1271315_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	2.9e-79
WP_000683145.1|1271311_1271707_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001351266.1|1271714_1272455_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	3.7e-127
WP_000479129.1|1272470_1272893_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	91.4	2.7e-66
WP_000459474.1|1272874_1273309_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	90.0	9.0e-57
WP_000840269.1|1273301_1275863_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	94.5	0.0e+00
WP_000847405.1|1275859_1276189_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	94.5	5.4e-54
WP_001152660.1|1276188_1276887_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	4.0e-131
WP_000140699.1|1276892_1277636_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.2	1.1e-147
WP_000090917.1|1277572_1278205_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	100.0	5.9e-97
WP_000515324.1|1278265_1281748_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	89.8	0.0e+00
WP_000290543.1|1281806_1283867_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	53.4	2.0e-125
WP_000654167.1|1283863_1284142_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	56.5	7.6e-25
>prophage 4
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	1361996	1452621	5076615	portal,protease,lysis,tail,capsid,head,integrase,holin,terminase,transposase	Escherichia_phage(30.36%)	99	1355391:1355407	1408308:1408324
1355391:1355407	attL	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_001111620.1|1361996_1363196_-|transposase	IS4 family transposase	transposase	S5FM71	Shigella_phage	63.0	1.4e-139
WP_000555849.1|1363988_1364831_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001362934.1|1364880_1365339_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001226476.1|1365451_1366357_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193456.1|1366448_1367462_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_000718995.1|1367663_1368572_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.4e-59
WP_001287378.1|1368715_1369129_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068076.1|1369732_1370350_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	7.8e-54
WP_000301660.1|1371807_1374483_-	bifunctional acetaldehyde-CoA/alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000616773.1|1374959_1375607_+	NAAT family transporter YchE	NA	NA	NA	NA	NA
WP_001297114.1|1376344_1377976_+	oligopeptide ABC transporter substrate-binding protein OppA	NA	NA	NA	NA	NA
WP_000911108.1|1378061_1378982_+	oligopeptide ABC transporter permease OppB	NA	NA	NA	NA	NA
WP_000979659.1|1378996_1379905_+	oligopeptide ABC transporter permease OppC	NA	NA	NA	NA	NA
WP_000110950.1|1379916_1380930_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994894.1|1380926_1381931_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	1.1e-15
WP_000366957.1|1381983_1382313_-	YciU family protein	NA	NA	NA	NA	NA
WP_000214516.1|1382347_1383808_-	cardiolipin synthase	NA	NA	NA	NA	NA
WP_001309467.1|1383950_1384124_+	YciY family protein	NA	NA	NA	NA	NA
WP_024250944.1|1384178_1385432_-	voltage-gated potassium channel protein	NA	NA	NA	NA	NA
WP_000967595.1|1385731_1386028_-	YciI family protein	NA	NA	NA	NA	NA
WP_001357407.1|1386251_1386968_+	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000108160.1|1387007_1387406_-	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_000808672.1|1387511_1388051_-	septation protein A	NA	NA	NA	NA	NA
WP_000028546.1|1388080_1388824_-	UPF0259 family protein	NA	NA	NA	NA	NA
WP_001350853.1|1389179_1389818_+	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000113674.1|1389863_1390994_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|1390971_1391220_-	excisionase	NA	NA	NA	NA	NA
WP_000048435.1|1391284_1393756_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.8	5.0e-59
WP_001090203.1|1393848_1394040_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|1394036_1394225_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|1394625_1394790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171970.1|1394790_1395012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|1395171_1395327_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001362937.1|1395619_1395958_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.7	3.3e-06
WP_000747951.1|1396349_1396592_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693867.1|1396575_1397001_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262357.1|1397072_1398143_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	65.2	4.2e-63
WP_001151216.1|1398183_1398606_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	88.5	8.2e-63
WP_014639476.1|1398797_1399760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000354966.1|1399775_1400777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|1401185_1401293_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_000813256.1|1401394_1401550_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	98.0	5.0e-18
WP_011478175.1|1401717_1401996_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.3e-11
WP_001265108.1|1401997_1403044_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.8	3.8e-109
WP_000904114.1|1403056_1403431_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	1.1e-34
WP_000762880.1|1403427_1404249_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	60.1	8.5e-80
WP_000917749.1|1404473_1404671_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	98.5	3.6e-29
WP_000935515.1|1404821_1405871_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	95.1	3.7e-197
WP_001331709.1|1407145_1407373_+	DUF1737 domain-containing protein	NA	Q20GJ1	Phage_258-320	91.8	1.8e-32
WP_000372595.1|1407641_1407857_+|holin	class II holin family protein	holin	A0A2R2Z340	Escherichia_phage	98.6	3.4e-33
WP_000193259.1|1407861_1408206_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	94.0	8.2e-37
WP_001351274.1|1408171_1408444_-	hypothetical protein	NA	NA	NA	NA	NA
1408308:1408324	attR	GCCAGCGTTGGCAGCAT	NA	NA	NA	NA
WP_000992052.1|1408549_1409083_+	lysozyme	NA	Q08J98	Stx2-converting_phage	96.0	9.0e-99
WP_001082537.1|1409381_1409846_+|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000057035.1|1410153_1410564_-	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	75.6	1.7e-52
WP_001331705.1|1410621_1410855_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000867575.1|1411241_1411790_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	84.2	1.0e-57
WP_000622378.1|1411761_1413690_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.7	2.2e-259
WP_000259002.1|1413673_1413880_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831813.1|1413876_1415469_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	1.4e-184
WP_001253958.1|1415458_1416964_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.5	3.6e-100
WP_000256823.1|1417000_1417348_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_000522591.1|1417405_1418434_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.6e-112
WP_000201495.1|1418485_1418869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204554.1|1418861_1419215_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974980.1|1419230_1419764_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	1.6e-58
WP_000683079.1|1419760_1420156_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235110.1|1420163_1420916_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000479101.1|1420929_1421361_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	3.1e-41
WP_000533402.1|1421387_1421801_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082348.1|1421781_1424355_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847402.1|1424351_1424681_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	2.3e-52
WP_001152522.1|1424680_1425379_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	3.4e-130
WP_000140762.1|1425383_1426127_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.7	6.1e-146
WP_000090879.1|1426063_1426666_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.1	6.2e-88
WP_001332187.1|1426739_1427078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000515773.1|1427144_1430624_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	90.0	0.0e+00
WP_001233195.1|1430691_1431291_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216497.1|1431442_1434550_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	90.5	4.4e-52
WP_000885580.1|1434549_1435134_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.5e-102
WP_000240999.1|1435188_1435857_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937495.1|1435913_1436183_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	79.4	9.3e-20
WP_000251936.1|1436297_1436468_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001079492.1|1436955_1437462_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056507.1|1437507_1438008_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134814.1|1438093_1438273_-	general stress protein	NA	NA	NA	NA	NA
WP_000443098.1|1438653_1439460_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209529.1|1439459_1440653_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_001195306.1|1440664_1442023_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.2	3.0e-37
WP_000763524.1|1442026_1443622_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_001194639.1|1443621_1445184_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|1445275_1445320_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285667.1|1445457_1446339_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|1446335_1446956_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001350892.1|1446983_1448879_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291206.1|1449091_1449967_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278741.1|1450006_1450597_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559260.1|1450593_1451352_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	7.5e-06
WP_000422062.1|1451571_1452621_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 5
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	2255029	2262269	5076615		Enterobacteria_phage(66.67%)	7	NA	NA
WP_105453002.1|2255029_2256175_-	O18ab/O18ac family O-antigen polymerase	NA	Q9AYY5	Salmonella_phage	42.9	5.3e-80
WP_000052607.1|2256276_2257524_-	O18 family O-antigen flippase	NA	NA	NA	NA	NA
WP_001100795.1|2257520_2258078_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	55.6	1.6e-50
WP_000857501.1|2258085_2258961_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001023638.1|2259018_2259918_-	dTDP-4-dehydrorhamnose reductase	NA	I7HXC9	Enterobacteria_phage	34.8	1.7e-28
WP_000699397.1|2259917_2261003_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.5	3.6e-102
WP_000183053.1|2261375_2262269_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.3e-46
>prophage 6
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	2360059	2369504	5076615		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001292784.1|2360059_2361196_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.2e-161
WP_001332210.1|2361192_2363196_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.4	0.0e+00
WP_001296231.1|2363320_2363782_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_001295430.1|2363822_2364293_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2364339_2365059_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2365055_2366741_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001240394.1|2366962_2367694_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	98.5	3.1e-110
WP_001216963.1|2367753_2367861_+	protein YohO	NA	NA	NA	NA	NA
WP_000783132.1|2367841_2368573_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569345.1|2368577_2369504_-	glycine betaine ABC transporter ATP binding protein YehX	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.8	5.7e-08
>prophage 7
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	2578112	2648651	5076615	coat,protease,tail,lysis,holin,head,integrase,tRNA,portal,terminase	Enterobacteria_phage(93.44%)	86	2595070:2595086	2639402:2639418
WP_001283598.1|2578112_2578925_-|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_001289178.1|2578924_2579938_-	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000699136.1|2580003_2581140_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	29.4	3.5e-23
WP_000615815.1|2581238_2582234_+	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_000127769.1|2582230_2583409_-	MFS transporter	NA	NA	NA	NA	NA
WP_000817178.1|2583673_2584894_-	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_000683753.1|2585052_2587059_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_000559761.1|2587179_2587458_-	YfcL family protein	NA	NA	NA	NA	NA
WP_001089236.1|2587491_2588040_-	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_000447368.1|2588039_2588849_-	TSUP family transporter	NA	NA	NA	NA	NA
WP_001043802.1|2588848_2589673_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_001331783.1|2589676_2590762_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	7.0e-90
WP_001298774.1|2590796_2591729_-	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000730806.1|2591894_2592446_+	endonuclease SmrB	NA	NA	NA	NA	NA
WP_001350713.1|2592765_2593608_-	DUF2544 domain-containing protein	NA	NA	NA	NA	NA
WP_001050125.1|2593609_2594137_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000824843.1|2594133_2594613_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000642895.1|2594609_2595113_-	fimbrial protein	NA	NA	NA	NA	NA
2595070:2595086	attL	GCCAGCAATAGCGCGGC	NA	NA	NA	NA
WP_000120670.1|2595129_2595882_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_001447287.1|2595901_2598550_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001195816.1|2599738_2600224_-	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_000425008.1|2600426_2602571_-	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_000531977.1|2602570_2603881_-	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_001296261.1|2604061_2604346_-	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_001350714.1|2604717_2606058_+	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_000776774.1|2606115_2606871_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368123.1|2607164_2608097_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	1.6e-167
WP_000958671.1|2608408_2609566_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000129909.1|2610749_2613695_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	100.0	0.0e+00
WP_000835351.1|2613795_2614719_-	phage antirepressor Ant	NA	A5VW58	Enterobacteria_phage	100.0	1.7e-177
WP_000865489.1|2614982_2615123_-	Arc family DNA-binding protein	NA	A0A0M4S6R9	Salmonella_phage	56.8	7.5e-05
WP_001283825.1|2615228_2615486_+	Arc family DNA-binding protein	NA	A5VW59	Enterobacteria_phage	100.0	4.5e-40
WP_001555939.1|2615509_2615758_+	Arc family DNA-binding protein	NA	A5VW60	Enterobacteria_phage	100.0	3.1e-38
WP_001555940.1|2615818_2616400_+	hypothetical protein	NA	A5VW61	Enterobacteria_phage	100.0	1.7e-103
WP_000431541.1|2616384_2616804_+	type II toxin-antitoxin system YafO family toxin	NA	A5VW62	Enterobacteria_phage	100.0	1.6e-74
WP_000288815.1|2616826_2617150_+	hypothetical protein	NA	A5VW63	Enterobacteria_phage	100.0	4.9e-23
WP_001029855.1|2617150_2619310_-	hypothetical protein	NA	A5VW64	Enterobacteria_phage	100.0	0.0e+00
WP_000246973.1|2619309_2620659_-	DNA transfer protein	NA	A5VW65	Enterobacteria_phage	100.0	4.5e-248
WP_000964906.1|2620669_2621362_-	hypothetical protein	NA	A5VW66	Enterobacteria_phage	100.0	6.6e-118
WP_000627629.1|2621364_2621820_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	100.0	1.4e-87
WP_000785531.1|2621819_2622521_-	hypothetical protein	NA	A5VW68	Enterobacteria_phage	100.0	3.2e-120
WP_001122367.1|2622520_2623939_-	packaged DNA stabilization protein gp10	NA	A5VW69	Enterobacteria_phage	100.0	4.2e-276
WP_001140510.1|2623948_2624410_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	100.0	7.1e-84
WP_001362792.1|2624390_2624579_-	hypothetical protein	NA	A5VW71	Enterobacteria_phage	100.0	2.9e-28
WP_000013270.1|2624620_2625874_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	100.0	3.4e-237
WP_000372589.1|2625892_2626786_-	hypothetical protein	NA	A5VW73	Enterobacteria_phage	100.0	3.8e-134
WP_000818371.1|2626876_2629075_-|portal	portal protein	portal	A5VW74	Enterobacteria_phage	100.0	0.0e+00
WP_000200779.1|2629076_2630492_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	100.0	3.1e-279
WP_000113731.1|2630488_2630929_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	100.0	5.9e-80
WP_000807788.1|2630931_2631174_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001109020.1|2631401_2631944_-	Rha family transcriptional regulator	NA	A5VW78	Enterobacteria_phage	100.0	1.4e-99
WP_001139680.1|2632149_2632302_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_001350934.1|2632289_2632727_-|lysis	lysis protein	lysis	A5VW79	Enterobacteria_phage	100.0	2.0e-72
WP_000229389.1|2632723_2633200_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|2633183_2633507_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027549.1|2634103_2634622_-	DUF1133 family protein	NA	A5VW83	Enterobacteria_phage	100.0	9.0e-96
WP_000994516.1|2634618_2634807_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001008199.1|2634803_2635166_-	RusA family crossover junction endodeoxyribonuclease	NA	A5VW85	Enterobacteria_phage	100.0	9.2e-63
WP_000002245.1|2635162_2635453_-	DUF1364 domain-containing protein	NA	A5VW86	Enterobacteria_phage	100.0	1.0e-51
WP_001004257.1|2635452_2636175_-	phage antirepressor KilAC domain-containing protein	NA	A5VW87	Enterobacteria_phage	100.0	5.4e-131
WP_000950950.1|2636167_2636344_-	protein ninF	NA	A5VW88	Enterobacteria_phage	100.0	1.5e-26
WP_000386637.1|2636336_2636684_-	DUF2591 domain-containing protein	NA	A5VW89	Enterobacteria_phage	100.0	1.8e-63
WP_001254255.1|2636686_2636863_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000736904.1|2636859_2637300_-	recombination protein NinB	NA	A5VW91	Enterobacteria_phage	100.0	7.0e-81
WP_001248381.1|2637574_2638951_-	AAA family ATPase	NA	A5VW94	Enterobacteria_phage	100.0	5.7e-254
WP_000431320.1|2638947_2639835_-	replication protein	NA	A5VW95	Enterobacteria_phage	100.0	1.3e-145
2639402:2639418	attR	GCCGCGCTATTGCTGGC	NA	NA	NA	NA
WP_001244621.1|2639897_2640170_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2640192_2640486_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_000276886.1|2640594_2640780_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|2640860_2641511_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_011478232.1|2641631_2642021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000219338.1|2642032_2642332_+	hypothetical protein	NA	A5VW99	Enterobacteria_phage	100.0	9.0e-32
WP_000213976.1|2642410_2642611_+	Restriction inhibitor protein ral	NA	A5VWA0	Enterobacteria_phage	100.0	3.2e-33
WP_000392426.1|2642669_2643092_+	hypothetical protein	NA	A5VWA1	Enterobacteria_phage	100.0	3.3e-72
WP_000638547.1|2644275_2644407_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A5VWA4	Enterobacteria_phage	100.0	1.4e-16
WP_001243355.1|2644391_2644544_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000031365.1|2644800_2645406_+	ERF family protein	NA	A5VWA8	Enterobacteria_phage	100.0	3.2e-108
WP_000951332.1|2645405_2645789_+	hypothetical protein	NA	A5VWA9	Enterobacteria_phage	100.0	4.7e-65
WP_001111304.1|2645812_2646109_+	DUF2856 family protein	NA	A5VWB0	Enterobacteria_phage	100.0	7.8e-52
WP_000812193.1|2646203_2646722_+	hypothetical protein	NA	A5VWB1	Enterobacteria_phage	100.0	7.2e-93
WP_000215166.1|2646718_2647018_+	hypothetical protein	NA	A5VWB2	Enterobacteria_phage	100.0	1.5e-58
WP_000161575.1|2647019_2647592_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	100.0	4.0e-105
WP_000253289.1|2647591_2647876_+	DUF4752 family protein	NA	A5VWB4	Enterobacteria_phage	100.0	3.8e-48
WP_000002106.1|2647868_2648153_+	ASCH domain-containing protein	NA	A5VWB6	Enterobacteria_phage	100.0	2.4e-50
WP_000545737.1|2648225_2648393_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	100.0	9.8e-28
WP_001163428.1|2648450_2648651_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
>prophage 8
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	2864644	2951997	5076615	portal,protease,tail,lysis,holin,head,plate,tRNA,capsid,terminase	Shigella_phage(42.86%)	95	NA	NA
WP_000083664.1|2864644_2865382_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_000219193.1|2865513_2866848_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001350886.1|2866880_2867762_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189209.1|2867864_2868452_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2868507_2868891_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262723.1|2869195_2869885_+	uracil-DNA glycosylase	NA	A0A077BCN4	Equid_alphaherpesvirus	52.1	2.1e-55
WP_000997387.1|2869932_2870970_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2871176_2871596_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001298618.1|2871664_2872363_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_000082936.1|2872394_2875055_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949265.1|2875168_2876524_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001370843.1|2876569_2876893_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_001298619.1|2876889_2878188_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	31.7	4.8e-45
WP_001350770.1|2886676_2889250_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.2	5.8e-127
WP_000040118.1|2889379_2890111_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079114.1|2890107_2891088_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197686.1|2891222_2891960_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178456.1|2892229_2892571_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_001386991.1|2892674_2892722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200106.1|2892820_2893981_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_000225230.1|2894023_2895145_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168026.1|2895155_2896226_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_001296308.1|2896435_2896801_+	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001212400.1|2896949_2897468_+	YfiR family protein	NA	NA	NA	NA	NA
WP_000969016.1|2897457_2898684_+	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_000589793.1|2898699_2899182_+	OmpA family protein	NA	NA	NA	NA	NA
WP_000065253.1|2899258_2899606_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264777.1|2899647_2900415_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000043335.1|2900445_2900994_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256450.1|2901012_2901261_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460035.1|2901397_2902759_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001338897.1|2902925_2903717_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_077634785.1|2903737_2905024_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001332400.1|2905078_2905672_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059176.1|2905794_2906673_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880938.1|2906758_2908420_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203437.1|2908568_2908910_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001117834.1|2908971_2909262_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000600193.1|2909251_2909728_-	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_000162574.1|2909859_2910342_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000183405.1|2911498_2912287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000174562.1|2912374_2912668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000353910.1|2912878_2913652_-	hypothetical protein	NA	G9IA57	Pseudomonas_phage	39.2	3.6e-40
WP_000834402.1|2914703_2916593_+	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_001115559.1|2916846_2917338_+	hypothetical protein	NA	F1BUP1	Erwinia_phage	35.3	4.8e-06
WP_001089535.1|2917340_2917784_+|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	50.3	4.8e-37
WP_000356380.1|2917755_2918358_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	86.0	3.4e-94
WP_000554665.1|2918357_2919101_-|tail	tail fiber protein	tail	O22004	Shigella_phage	92.6	3.7e-50
WP_000539246.1|2919104_2919689_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	1.0e-111
WP_000785328.1|2919679_2920738_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	97.7	2.6e-198
WP_000424731.1|2920724_2921150_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	98.6	7.4e-80
WP_000103707.1|2921149_2921698_-|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	98.9	5.6e-96
WP_000999498.1|2921697_2922777_-|plate	baseplate protein	plate	Q8SBG7	Shigella_phage	99.4	1.5e-206
WP_001350765.1|2922773_2924102_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.6	7.2e-246
WP_000807182.1|2924162_2925998_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	98.4	7.7e-307
WP_000661051.1|2926139_2926409_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	98.9	6.0e-43
WP_000090998.1|2926408_2926765_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	100.0	5.3e-63
WP_000155718.1|2926764_2928261_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	95.6	4.3e-263
WP_000497751.1|2928244_2928415_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779291.1|2928423_2928984_-	hypothetical protein	NA	S5FM61	Shigella_phage	98.9	1.5e-104
WP_000213503.1|2928980_2929487_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	99.4	3.2e-90
WP_000702385.1|2929461_2929872_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	96.3	1.1e-72
WP_000927711.1|2929868_2930192_-|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000601360.1|2930194_2930395_-	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000257492.1|2930444_2931650_-|capsid	phage major capsid protein	capsid	U5P0G9	Shigella_phage	99.5	9.1e-224
WP_001193631.1|2931664_2932315_-|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	100.0	2.5e-119
WP_000466267.1|2932292_2933534_-|portal	phage portal protein	portal	U5P411	Shigella_phage	99.3	6.5e-241
WP_000605604.1|2933533_2933716_-	hypothetical protein	NA	M1FJ83	Enterobacteria_phage	100.0	1.7e-25
WP_072011717.1|2933727_2935224_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.8	7.4e-300
WP_000929172.1|2935457_2935952_-|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	99.4	8.6e-88
WP_001135216.1|2936077_2936428_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	95.7	3.4e-62
WP_001332386.1|2937076_2937328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000092331.1|2937398_2937836_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	92.3	5.3e-65
WP_001180490.1|2937832_2938309_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	93.0	2.8e-83
WP_000544527.1|2938295_2938601_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	86.6	1.6e-39
WP_000606308.1|2938752_2939088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001047143.1|2939273_2940026_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.1e-134
WP_001350764.1|2940039_2941029_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.2	1.3e-191
WP_001061411.1|2941036_2941834_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	5.8e-150
WP_000767113.1|2941853_2942243_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210172.1|2942239_2942566_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	99.1	2.7e-53
WP_001332383.1|2942562_2943216_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	99.1	1.6e-126
WP_001332382.1|2943215_2943710_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_000104933.1|2943706_2944648_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	98.4	1.3e-153
WP_001250269.1|2944637_2944817_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|2944992_2945544_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|2945587_2945788_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|2945878_2946553_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000500990.1|2946755_2947268_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135691.1|2947736_2948099_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	98.3	1.2e-59
WP_000081287.1|2948164_2948989_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008234.1|2949116_2949641_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	5.4e-96
WP_001075212.1|2949749_2950616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001331174.1|2950657_2950864_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	70.3	6.9e-23
WP_000531794.1|2950824_2951997_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	67.5	3.3e-146
>prophage 9
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	3027526	3035245	5076615		Escherichia_phage(83.33%)	6	NA	NA
WP_000103864.1|3027526_3030088_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	2.0e-31
WP_001555984.1|3030193_3030418_+	hypothetical protein	NA	A0A2L1IV26	Escherichia_phage	100.0	5.8e-07
WP_001296319.1|3031479_3032247_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	57.4	9.7e-70
WP_000847997.1|3032442_3033351_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_000590420.1|3033347_3034610_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_001279003.1|3034606_3035245_+	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.4e-82
>prophage 10
NZ_CP019777	Escherichia coli NU14 chromosome, complete genome	5076615	4998284	5045823	5076615	protease,lysis,tail,integrase,portal,terminase	Enterobacteria_phage(48.08%)	56	4995907:4995923	5033982:5033998
4995907:4995923	attL	TCTGCTCGGCGATGCGC	NA	NA	NA	NA
WP_001218287.1|4998284_4999499_+|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	99.3	1.6e-236
WP_000653746.1|4999874_5000870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000628710.1|5001437_5002232_-	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	49.8	2.7e-59
WP_001229296.1|5002228_5002594_-	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	100.0	5.1e-69
WP_000206713.1|5002595_5002952_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	74.1	7.7e-38
WP_001242727.1|5002951_5003314_-	hypothetical protein	NA	U5P092	Shigella_phage	95.8	1.7e-64
WP_000008232.1|5003304_5003841_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	100.0	7.4e-101
WP_000081290.1|5003968_5004793_-	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.0e-149
WP_000135682.1|5004858_5005221_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001311077.1|5005943_5006636_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	96.5	2.9e-121
WP_001191669.1|5006733_5006994_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_000526665.1|5006986_5007538_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001087313.1|5007534_5008686_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	99.2	1.6e-214
WP_000620696.1|5008682_5008907_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_000061519.1|5008903_5009722_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	99.6	4.7e-123
WP_011478357.1|5009718_5010213_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	96.3	2.6e-84
WP_000066917.1|5010212_5010866_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210170.1|5010862_5011189_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_000767115.1|5011185_5011575_+	RusA family crossover junction endodeoxyribonuclease	NA	K7PH72	Enterobacteria_phage	99.2	3.5e-68
WP_001061386.1|5011594_5012392_+	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	98.5	8.3e-149
WP_001577384.1|5012399_5013389_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.7	4.3e-195
WP_001204752.1|5013406_5013772_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	81.0	5.1e-53
WP_001033965.1|5013856_5014303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000917723.1|5014573_5014777_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	98.5	1.8e-31
WP_000799705.1|5014927_5015980_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.4	6.1e-208
WP_000839596.1|5016047_5016263_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135250.1|5016262_5016760_+	lysozyme RrrD	NA	A0A291AWW2	Escherichia_phage	100.0	4.5e-92
WP_001341210.1|5016756_5017224_+|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	100.0	7.7e-78
WP_001139675.1|5017211_5017364_+	hypothetical protein	NA	A0A291AWZ2	Escherichia_phage	100.0	1.2e-21
WP_000349501.1|5018039_5018531_+	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	86.6	6.6e-72
WP_000934133.1|5018530_5020633_+|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	97.1	0.0e+00
WP_001072975.1|5020629_5020842_+	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_011478361.1|5020769_5022350_+|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	100.0	4.3e-290
WP_001360054.1|5022294_5024322_+|protease	Clp protease ClpP	protease	A5LH30	Enterobacteria_phage	99.7	0.0e+00
WP_001097050.1|5024408_5024732_+	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001283153.1|5024724_5025000_+	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_000677123.1|5025011_5025602_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	80.1	1.6e-80
WP_001079398.1|5025598_5026000_+|tail	tail protein	tail	A0A291AWY2	Escherichia_phage	100.0	8.3e-73
WP_000211119.1|5026010_5026754_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	97.2	1.4e-129
WP_001298500.1|5026814_5027201_+|tail	phage minor tail protein G	tail	K7PLV8	Enterobacteria_phage	100.0	3.3e-66
WP_001161009.1|5027209_5027539_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_000372035.1|5027510_5030567_+|tail	phage tail tape measure protein	tail	A5LH38	Enterobacteria_phage	99.5	0.0e+00
WP_000447253.1|5030566_5030896_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_001152386.1|5030905_5031604_+|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.6	1.0e-134
WP_032142951.1|5031608_5032352_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	4.5e-149
WP_011478365.1|5032249_5032897_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	4.0e-109
WP_000515451.1|5032957_5036353_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.7	0.0e+00
5033982:5033998	attR	TCTGCTCGGCGATGCGC	NA	NA	NA	NA
WP_001228265.1|5036420_5037020_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	90.5	1.2e-99
WP_000741755.1|5037084_5039460_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	70.2	5.1e-170
WP_000654148.1|5039459_5039741_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	51.1	2.4e-18
WP_001555784.1|5039750_5040791_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	2.4e-124
WP_001555785.1|5040833_5041127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000954672.1|5041430_5042189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389073.1|5042287_5043322_-	hypothetical protein	NA	A4KWR9	Enterobacteria_phage	41.8	7.1e-76
WP_001217535.1|5043768_5044017_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	96.3	3.5e-37
WP_000202563.1|5044236_5045823_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	2.4e-30
