The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019979	Streptococcus agalactiae strain Sag158 chromosome, complete genome	2096882	40713	48819	2096882		Synechococcus_phage(33.33%)	7	NA	NA
WP_000220683.1|40713_42168_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	32.5	1.4e-53
WP_001291337.1|42195_43218_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	R9TMC7	Synechococcus_phage	42.4	1.2e-62
WP_000686114.1|43385_43934_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	35.6	1.0e-25
WP_000780022.1|43956_44709_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_050265479.1|44728_46276_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	49.2	3.0e-78
WP_001045908.1|46468_47368_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A221J6U0	Arthrobacter_phage	45.9	4.1e-19
WP_000783419.1|47514_48819_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2D1GNZ3	Streptomyces_phage	40.5	3.7e-05
>prophage 2
NZ_CP019979	Streptococcus agalactiae strain Sag158 chromosome, complete genome	2096882	559483	693530	2096882	terminase,holin,head,integrase,protease,capsid,portal,tail,transposase	Streptococcus_phage(85.0%)	140	561090:561111	643677:643698
WP_000595708.1|559483_560680_+	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	54.5	4.6e-103
561090:561111	attL	AATAATAGACTTCCTGCGAAAC	NA	NA	NA	NA
WP_088181596.1|561132_561937_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_001068667.1|562120_562468_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000264730.1|562692_563772_-|integrase	site-specific integrase	integrase	A0A1X9IGD8	Lactococcus_phage	39.8	3.2e-63
WP_000505363.1|563895_564099_-	hypothetical protein	NA	O34033	Streptococcus_phage	48.4	1.7e-10
WP_000891065.1|564201_564759_-	hypothetical protein	NA	Q0H269	Geobacillus_phage	30.2	1.6e-18
WP_079218627.1|564760_565558_-	XRE family transcriptional regulator	NA	A0A1S5S8S8	Streptococcus_phage	75.9	6.7e-66
WP_079218629.1|566179_566362_-	DUF1508 domain-containing protein	NA	NA	NA	NA	NA
WP_079218631.1|566419_566578_+	hypothetical protein	NA	J7KH24	Streptococcus_phage	92.3	1.3e-21
WP_079218635.1|566799_567642_-	DUF4393 domain-containing protein	NA	NA	NA	NA	NA
WP_001183891.1|567700_567892_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079218637.1|567958_568879_+	DUF3102 domain-containing protein	NA	J7KDG2	Streptococcus_phage	79.0	4.6e-74
WP_001872799.1|568875_569331_+	hypothetical protein	NA	A0A0A0YSF8	Streptococcus_phage	38.7	1.6e-11
WP_001000651.1|569756_570065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000879943.1|570170_570401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109867766.1|570808_570901_-	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_133256335.1|571456_571636_+	hypothetical protein	NA	A0A1X9I5M8	Streptococcus_phage	53.6	1.4e-08
WP_000860559.1|571812_572253_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000514063.1|572369_573284_+	replisome organizer	NA	A0A2I6QQV2	Streptococcus_phage	76.1	1.8e-59
WP_000863938.1|573293_574136_+	ATP-binding protein	NA	E8ZDI3	Streptococcus_phage	39.6	1.3e-48
WP_017285245.1|574135_574324_+	hypothetical protein	NA	J7KBQ4	Streptococcus_phage	95.7	2.6e-16
WP_017285246.1|574310_574565_+	hypothetical protein	NA	J7KK18	Streptococcus_phage	98.8	2.2e-42
WP_017285247.1|574567_574729_+	hypothetical protein	NA	J7KDI4	Streptococcus_phage	86.8	5.2e-18
WP_047201014.1|574730_575060_+	hypothetical protein	NA	J7KGX3	Streptococcus_phage	85.3	4.9e-47
WP_017285249.1|575062_576025_+	recombinase RecT	NA	J7KDK3	Streptococcus_phage	96.2	2.0e-173
WP_047200445.1|576021_576819_+	hypothetical protein	NA	J7KGZ1	Streptococcus_phage	90.9	1.1e-140
WP_000474006.1|576979_577177_+	hypothetical protein	NA	J7KIX6	Streptococcus_phage	93.8	1.8e-25
WP_000143298.1|577166_577643_+	RusA family crossover junction endodeoxyribonuclease	NA	J7KBT1	Streptococcus_phage	98.2	1.3e-59
WP_047200446.1|577632_577980_+	hypothetical protein	NA	J7KK12	Streptococcus_phage	83.5	2.0e-51
WP_047200447.1|577991_578279_+	DUF1599 domain-containing protein	NA	J7KBY0	Streptococcus_phage	67.0	6.7e-24
WP_000612386.1|578262_578670_+	hypothetical protein	NA	A0A141E233	Streptococcus_phage	38.2	6.8e-14
WP_079218754.1|578793_579279_+	methyltransferase domain-containing protein	NA	A0A097PAU8	Streptococcus_pyogenes_phage	88.8	2.3e-85
WP_154021647.1|579280_579430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079218639.1|579426_579786_+	DUF1642 domain-containing protein	NA	Q9MCL5	Streptococcus_virus	45.8	4.0e-18
WP_079218641.1|579817_580117_+	hypothetical protein	NA	M1PFH6	Streptococcus_phage	45.4	9.7e-18
WP_000660738.1|580134_580401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142566.1|580790_581225_+	ArpU family phage encoded transcriptional regulator	NA	J7KDQ1	Streptococcus_phage	93.7	1.1e-70
WP_000033708.1|581708_582032_+	hypothetical protein	NA	A0A1W6JHU2	Lactococcus_phage	40.8	1.4e-14
WP_000964195.1|582087_582465_-	HicB family protein	NA	I3NLB2	Bifidobacterium_phage	41.3	1.5e-15
WP_001867670.1|582517_582658_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000687301.1|582814_583132_+	HNH endonuclease	NA	A3F639	Streptococcus_phage	69.1	1.1e-30
WP_000343900.1|583268_583625_+	hypothetical protein	NA	A0A2H4JAH7	uncultured_Caudovirales_phage	61.0	3.0e-34
WP_000628069.1|583621_585265_+|terminase	terminase large subunit	terminase	A0A1S5SF58	Streptococcus_phage	80.6	4.8e-268
WP_000764511.1|585275_585599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000696092.1|585670_586819_+|portal	phage portal protein	portal	A0A1S5SFG8	Streptococcus_phage	53.0	8.7e-107
WP_000192152.1|586799_587531_+|protease	Clp protease ClpP	protease	A0A1S5SFF8	Streptococcus_phage	61.5	1.4e-73
WP_000178057.1|587552_588713_+|capsid	phage major capsid protein	capsid	A0A1S5SFB4	Streptococcus_phage	57.6	3.6e-116
WP_000343312.1|588716_589010_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JAA9	uncultured_Caudovirales_phage	42.5	9.5e-10
WP_000087630.1|589123_589471_+	hypothetical protein	NA	A3F648	Streptococcus_phage	55.7	3.7e-29
WP_000500612.1|589474_589867_+	hypothetical protein	NA	A3F649	Streptococcus_phage	78.9	2.9e-54
WP_000237791.1|589859_590240_+	hypothetical protein	NA	A3F650	Streptococcus_phage	64.3	1.8e-40
WP_001149163.1|590254_590860_+	hypothetical protein	NA	A3F651	Streptococcus_phage	74.1	1.2e-70
WP_001281299.1|590870_591173_+	hypothetical protein	NA	A3F652	Streptococcus_phage	69.4	7.5e-34
WP_079218643.1|591399_595323_+|tail	phage tail tape measure protein	tail	J7KDT4	Streptococcus_phage	64.7	0.0e+00
WP_047201285.1|595334_596843_+	minor structural protein	NA	J7KH53	Streptococcus_phage	77.5	1.5e-228
WP_116449332.1|596854_600661_+	CHAP domain-containing protein	NA	J7KBT9	Streptococcus_phage	79.5	0.0e+00
WP_017647444.1|600671_602696_+	hypothetical protein	NA	J7KC14	Streptococcus_phage	49.6	9.4e-165
WP_000404431.1|602710_603037_+	DUF1366 domain-containing protein	NA	J7KDI9	Streptococcus_phage	68.2	1.3e-31
WP_000698337.1|603011_603224_+	hypothetical protein	NA	J7KDP6	Streptococcus_phage	60.0	2.1e-14
WP_000215499.1|603236_603539_+	hypothetical protein	NA	X2KT07	Streptococcus_phage	59.6	2.2e-25
WP_000611524.1|603540_603795_+|holin	phage holin	holin	J7KDR1	Streptococcus_phage	96.4	1.6e-37
WP_001061853.1|605385_606282_+	sensor histidine kinase	NA	J7KDG8	Streptococcus_phage	100.0	1.8e-168
WP_000258211.1|606275_606575_+	STAS-like domain-containing protein	NA	J7KJ12	Streptococcus_phage	100.0	3.8e-46
WP_000076712.1|606684_606885_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	100.0	2.9e-26
WP_000356856.1|606925_607096_-	hypothetical protein	NA	A0A286QNA2	Streptococcus_phage	63.8	1.1e-07
WP_000965642.1|607511_607691_+	hypothetical protein	NA	J7KIW4	Streptococcus_phage	86.2	2.1e-20
WP_079218646.1|607790_608405_-|integrase	site-specific integrase	integrase	F8HGP4	Streptococcus_phage	60.7	9.2e-55
WP_001872365.1|608407_608674_-	hypothetical protein	NA	Q77YW7	Streptococcus_phage	65.2	9.2e-20
WP_000640620.1|608673_609078_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001122304.1|609239_609440_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_001865698.1|609461_609722_+|transposase	IS3 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	43.0	3.4e-11
WP_001867107.1|609847_610057_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	55.4	1.4e-15
WP_000508795.1|610229_610391_-	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_000594360.1|611132_612410_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000353149.1|612419_613076_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.8	2.2e-22
WP_000699093.1|614547_615201_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.6	8.1e-25
WP_000734169.1|615197_616517_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.9	2.2e-05
WP_000076708.1|617393_617594_+	CsbD family protein	NA	J7KJ36	Streptococcus_phage	97.0	8.4e-26
WP_000027835.1|617635_617824_+	hypothetical protein	NA	J7KIW4	Streptococcus_phage	78.2	3.3e-16
WP_000078931.1|618248_619454_+	rod shape-determining protein RodA	NA	NA	NA	NA	NA
WP_001106189.1|619572_620133_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_000134196.1|620133_622086_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.8	1.5e-143
WP_000094341.1|622179_623904_+	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_000589685.1|623997_624639_+	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_000409124.1|624659_625145_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_000137373.1|625157_625613_-	YueI family protein	NA	W6LLD2	Streptococcus_phage	48.9	7.8e-27
WP_000564846.1|625768_626902_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_000022832.1|627136_628444_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	95.4	1.5e-235
WP_000823924.1|628551_629616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000772014.1|629844_631128_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001127193.1|631120_631633_+	shikimate kinase	NA	NA	NA	NA	NA
WP_000089337.1|631689_633063_+	LCP family protein	NA	NA	NA	NA	NA
WP_000902655.1|633163_634519_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	D0R096	Streptococcus_phage	73.4	3.9e-191
WP_017649105.1|636045_636576_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_154021648.1|636745_642748_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_154021649.1|643697_644503_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
643677:643698	attR	AATAATAGACTTCCTGCGAAAC	NA	NA	NA	NA
WP_001122248.1|646745_647315_+	hypothetical protein	NA	A0A1B0RXB3	Streptococcus_phage	81.0	2.5e-86
WP_000905643.1|647353_649309_-	DNA polymerase	NA	D0R0B0	Streptococcus_phage	84.3	0.0e+00
WP_000208945.1|649539_650103_-	DUF2815 family protein	NA	A0A1B0RXA9	Streptococcus_phage	93.9	1.9e-91
WP_001914156.1|650107_651229_-	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	88.2	8.0e-198
WP_000041407.1|651221_651545_-	hypothetical protein	NA	A0A1B0RXB7	Streptococcus_phage	71.2	2.0e-32
WP_001160921.1|651941_654224_+	hypothetical protein	NA	A0A1B0RXC5	Streptococcus_phage	79.6	0.0e+00
WP_001208492.1|654507_654789_+	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	79.6	7.9e-38
WP_000768925.1|654769_656146_+	DEAD/DEAH box helicase	NA	A0A1X9I6B0	Streptococcus_phage	86.2	1.8e-231
WP_000361944.1|656138_656636_+	hypothetical protein	NA	A0A1B0RXB9	Streptococcus_phage	74.4	1.7e-62
WP_000640706.1|657028_658066_+	methionine adenosyltransferase	NA	E4ZFL0	Streptococcus_phage	84.6	1.9e-169
WP_001138031.1|658067_658433_+	HNH endonuclease	NA	A0A1B0RXJ3	Streptococcus_phage	86.0	6.6e-61
WP_000999417.1|658721_659177_+	hypothetical protein	NA	M1Q209	Streptococcus_phage	51.0	2.1e-43
WP_000211624.1|659148_660405_+	DNA modification methylase	NA	A0A1B0RXJ0	Streptococcus_phage	88.7	1.8e-222
WP_000164558.1|661716_661971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000999360.1|661981_662431_+	DUF4314 domain-containing protein	NA	A0A1X9I6A3	Streptococcus_phage	62.1	6.1e-16
WP_000290865.1|662482_662956_+|terminase	phage terminase small subunit P27 family	terminase	A0A1X9I6K0	Streptococcus_phage	97.5	2.3e-85
WP_000220984.1|662952_664545_+|terminase	terminase large subunit	terminase	A0A1X9I6B3	Streptococcus_phage	95.1	2.8e-305
WP_001166641.1|664615_664873_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	E4ZFM1	Streptococcus_phage	95.3	1.2e-35
WP_001221830.1|664869_665241_+	type II toxin-antitoxin system death-on-curing family toxin	NA	A0A1X9I6C0	Streptococcus_phage	89.4	1.2e-57
WP_000149738.1|665266_665593_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000523693.1|665660_666950_+|portal	phage portal protein	portal	A0A1B0RXD8	Streptococcus_phage	90.6	2.2e-228
WP_001225240.1|666942_667641_+|protease	Clp protease ClpP	protease	A0A1B0RXE1	Streptococcus_phage	83.2	1.0e-105
WP_000040493.1|667654_668863_+|capsid	phage major capsid protein	capsid	E4ZFM5	Streptococcus_phage	91.0	1.8e-211
WP_000987322.1|668859_669117_+|head,tail	phage gp6-like head-tail connector protein	head,tail	D0R0D7	Streptococcus_phage	74.1	1.5e-27
WP_000705390.1|669116_669455_+|head,tail	head-tail adaptor protein	head,tail	A0A1B0RXJ6	Streptococcus_phage	66.1	6.2e-37
WP_000161243.1|669447_669816_+	hypothetical protein	NA	Q6DMT7	Streptococcus_phage	63.8	1.1e-34
WP_001209973.1|669824_670151_+	hypothetical protein	NA	M1Q1Z4	Streptococcus_phage	67.6	1.6e-37
WP_000818566.1|670153_670723_+|tail	phage tail protein	tail	E4ZFM9	Streptococcus_phage	95.7	1.6e-98
WP_001249615.1|670734_671154_+	hypothetical protein	NA	E4ZFN0	Streptococcus_phage	74.8	1.3e-55
WP_050265437.1|671448_674568_+	hypothetical protein	NA	Q6DMT2	Streptococcus_phage	75.5	3.0e-242
WP_000589858.1|674564_675290_+	hypothetical protein	NA	Q6DMT1	Streptococcus_phage	57.9	8.0e-82
WP_000966166.1|675289_678205_+	hypothetical protein	NA	Q6DMT0	Streptococcus_phage	65.2	0.0e+00
WP_000564846.1|679440_680574_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_000661350.1|681416_681815_+|holin	phage holin family protein	holin	D0R0E9	Streptococcus_phage	60.8	5.1e-38
WP_000123549.1|683358_683466_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_000290966.1|684003_685245_+	recombinase family protein	NA	A0A1X9I6J1	Streptococcus_phage	70.0	1.9e-171
WP_079218654.1|685189_686494_+	recombinase family protein	NA	E4ZFN9	Streptococcus_phage	80.0	4.9e-199
WP_079218656.1|686576_687647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000672531.1|687668_688967_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001176342.1|689193_689406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000757296.1|689523_690261_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_001267084.1|690581_691100_+	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_000944931.1|691936_692266_+	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_088187511.1|692385_693530_-|transposase	IS3-like element ISSag5 family transposase	transposase	Q8W6R2	Burkholderia_virus	26.1	2.4e-16
>prophage 3
NZ_CP019979	Streptococcus agalactiae strain Sag158 chromosome, complete genome	2096882	982897	1012060	2096882	transposase	Streptococcus_phage(81.82%)	29	NA	NA
WP_000168898.1|982897_985690_+	cation-transporting P-type ATPase	NA	M1HK51	Paramecium_bursaria_Chlorella_virus	29.9	7.1e-78
WP_000065321.1|985689_986793_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_000146565.1|986913_987552_-	CatB-related O-acetyltransferase	NA	A0A2R8FE91	Brazilian_cedratvirus	43.4	4.9e-19
WP_001056394.1|988262_988874_+	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	54.9	2.7e-54
WP_001291561.1|989047_990265_-|transposase	transposase	transposase	A0A1S5SEW7	Streptococcus_phage	100.0	3.7e-233
WP_000814511.1|990346_990550_-	excisionase	NA	A0A1S5SF07	Streptococcus_phage	100.0	4.0e-31
WP_001845478.1|990533_990785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000857133.1|991010_991241_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	100.0	2.7e-36
WP_000804885.1|991237_991660_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	100.0	2.5e-72
WP_013670292.1|991888_991960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001227346.1|992164_992518_+	helix-turn-helix transcriptional regulator	NA	A0A1S5SFA6	Streptococcus_phage	99.1	2.3e-58
WP_011058338.1|992577_992763_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	67.9	3.9e-17
WP_000691727.1|992863_994783_-	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A1S5SF82	Streptococcus_phage	100.0	0.0e+00
WP_011058339.1|994798_994885_-	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_001224319.1|995159_996092_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	100.0	1.1e-171
WP_000769868.1|996088_997090_-	peptidase P60	NA	A0A1S5SEZ8	Streptococcus_phage	100.0	5.0e-191
WP_000331160.1|999266_1001714_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	100.0	0.0e+00
WP_000506270.1|1001697_1002204_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	100.0	8.6e-91
WP_000342539.1|1002178_1002676_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	100.0	1.7e-91
WP_001009056.1|1002792_1003014_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	100.0	4.3e-31
WP_000398284.1|1003056_1004262_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	100.0	2.8e-233
WP_000813488.1|1004438_1005824_-	DNA translocase FtsK	NA	A0A1S5SFB5	Streptococcus_phage	100.0	1.1e-265
WP_000985015.1|1005852_1006239_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	100.0	3.0e-64
WP_000420682.1|1006254_1006569_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	100.0	5.2e-54
WP_001825268.1|1006591_1006711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000467138.1|1006949_1007732_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000192686.1|1007743_1008442_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.6	3.2e-19
WP_000312256.1|1008442_1008811_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000457960.1|1008955_1012060_+	DNA polymerase III subunit alpha	NA	A0A0K1Y8J9	Streptomyces_phage	28.8	1.1e-114
>prophage 4
NZ_CP019979	Streptococcus agalactiae strain Sag158 chromosome, complete genome	2096882	1231552	1294596	2096882	transposase,tRNA,protease	Indivirus(12.5%)	45	NA	NA
WP_001259491.1|1231552_1232263_-|protease	matrixin family metalloprotease	protease	NA	NA	NA	NA
WP_001280077.1|1233196_1234858_-	ribonuclease J	NA	NA	NA	NA	NA
WP_000564846.1|1235213_1236347_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_000245079.1|1236481_1237243_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	29.3	4.1e-12
WP_000587303.1|1237242_1238106_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000790858.1|1238118_1239123_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000006719.1|1239480_1241136_+	fibronectin/fibrinogen-binding protein	NA	A0A1J0F9J4	Only_Syngen_Nebraska_virus	41.0	2.3e-07
WP_000005484.1|1241189_1241909_-	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000140348.1|1241922_1243605_-	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_000934876.1|1243714_1244941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001081539.1|1244930_1246121_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_000796045.1|1246212_1246674_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000163516.1|1246663_1247146_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000564846.1|1248721_1249855_+|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_000277598.1|1251958_1252999_-	dTDP-glucose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	43.6	9.4e-68
WP_000459888.1|1253050_1253563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000139165.1|1253562_1254156_-	dTDP-4-keto-6-deoxy-D-glucose epimerase	NA	NA	NA	NA	NA
WP_000676113.1|1254155_1255025_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	61.8	3.5e-100
WP_000716841.1|1255083_1256187_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000647414.1|1256195_1256984_-	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_000365677.1|1256973_1257657_-|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000221657.1|1257760_1258441_-	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	31.8	1.9e-08
WP_000365343.1|1258558_1259077_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	44.1	4.6e-31
WP_000564797.1|1259258_1260392_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
WP_075316611.1|1263073_1263172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000622242.1|1263241_1265440_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.9	1.2e-72
WP_050881983.1|1265436_1266198_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000405387.1|1266199_1267129_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_000568323.1|1267170_1267818_-	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_000573350.1|1267810_1269049_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001226482.1|1269139_1270030_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_000239229.1|1270140_1270317_+	DUF3042 family protein	NA	NA	NA	NA	NA
WP_000130593.1|1276087_1276672_-	uracil-DNA glycosylase family protein	NA	NA	NA	NA	NA
WP_000150956.1|1276768_1278175_-	dipeptidase PepV	NA	NA	NA	NA	NA
WP_079218697.1|1278221_1278824_-	nitroreductase family protein	NA	NA	NA	NA	NA
WP_001003961.1|1280816_1282598_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_000567584.1|1282756_1283524_+	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_000285038.1|1283582_1284923_-	MATE family efflux transporter	NA	NA	NA	NA	NA
WP_000643714.1|1285022_1285433_-	VOC family protein	NA	NA	NA	NA	NA
WP_000582587.1|1285442_1285940_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000162276.1|1286161_1286758_+	Lj965 prophage superinfection immunity protein	NA	NA	NA	NA	NA
WP_088196775.1|1286946_1288051_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	49.3	1.4e-69
WP_000754576.1|1289880_1292352_-	pneumococcal-type histidine triad protein	NA	NA	NA	NA	NA
WP_000715197.1|1292364_1293285_-	metal ABC transporter substrate-binding lipoprotein/laminin-binding adhesin Lmb	NA	NA	NA	NA	NA
WP_000564846.1|1293462_1294596_-|transposase	ISAs1-like element IS1548 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP019979	Streptococcus agalactiae strain Sag158 chromosome, complete genome	2096882	1548651	1560169	2096882	transposase	Streptococcus_phage(90.91%)	15	NA	NA
WP_000767484.1|1548651_1549479_+	exodeoxyribonuclease III	NA	M1PSC0	Streptococcus_phage	78.0	4.3e-124
WP_000287944.1|1549518_1549875_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	71.8	1.5e-41
WP_000966773.1|1549876_1550353_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	50.3	1.0e-37
WP_000232156.1|1550407_1551589_-	phosphoglycerate dehydrogenase	NA	M1NSB9	Streptococcus_phage	75.6	7.0e-168
WP_001167085.1|1551651_1552200_-	acetyltransferase	NA	M1PSC3	Streptococcus_phage	58.4	1.1e-54
WP_000603277.1|1553492_1554128_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_011058365.1|1554171_1554276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011058366.1|1554260_1554422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001866320.1|1554397_1555261_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	70.4	3.7e-110
WP_000358198.1|1555266_1555593_-	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	61.1	3.2e-30
WP_000364565.1|1555622_1556486_-	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	49.7	7.3e-74
WP_000715592.1|1556505_1557141_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	61.1	2.8e-67
WP_000160532.1|1557349_1558516_+|transposase	IS30-like element ISSag9 family transposase	transposase	NA	NA	NA	NA
WP_050265419.1|1558780_1559440_-	CBS domain-containing protein	NA	M1NSC5	Streptococcus_phage	55.1	1.5e-63
WP_079218706.1|1559458_1560169_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.5	4.7e-18
>prophage 6
NZ_CP019979	Streptococcus agalactiae strain Sag158 chromosome, complete genome	2096882	2041354	2057930	2096882	integrase	Streptococcus_phage(71.43%)	23	2040521:2040540	2055333:2055352
2040521:2040540	attL	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_000381996.1|2041354_2041861_-	DUF4065 domain-containing protein	NA	D7RWK7	Brochothrix_phage	48.8	3.0e-35
WP_079218748.1|2042354_2042741_-	ArpU family transcriptional regulator	NA	NA	NA	NA	NA
WP_047206687.1|2042715_2043078_-	DUF1492 domain-containing protein	NA	NA	NA	NA	NA
WP_000891147.1|2043478_2043967_-	hypothetical protein	NA	A0A1X9I5V2	Streptococcus_phage	56.2	2.5e-47
WP_001258767.1|2044040_2044580_-	hypothetical protein	NA	A0A1X9I5U4	Streptococcus_phage	56.2	1.0e-25
WP_000694574.1|2044760_2044934_-	hypothetical protein	NA	A0A1X9I5U0	Streptococcus_phage	57.9	3.3e-10
WP_100223729.1|2045217_2046711_-	DNA primase	NA	A0A1X9I717	Streptococcus_phage	83.8	6.8e-245
WP_001029294.1|2046874_2047723_-	hypothetical protein	NA	A0A1X9I6L2	Streptococcus_phage	75.4	4.4e-124
WP_000051914.1|2047723_2047996_-	hypothetical protein	NA	A0A1X9I5U9	Streptococcus_phage	60.0	6.1e-19
WP_000174496.1|2047998_2048328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029662159.1|2048340_2048532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079218750.1|2048531_2048864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261784.1|2049106_2049376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079218751.1|2049375_2049999_-	phage repressor protein	NA	A0A1W6JPC3	Staphylococcus_phage	43.4	2.9e-40
WP_017644967.1|2050008_2050761_-	hypothetical protein	NA	A0A0A7RW33	Clostridium_phage	54.1	3.3e-22
WP_001161683.1|2050797_2050986_-	helix-turn-helix transcriptional regulator	NA	A0A0B5A7F0	Streptococcus_phage	60.7	6.5e-12
WP_000834375.1|2051147_2051933_+	helix-turn-helix transcriptional regulator	NA	A0A1X9I5R1	Streptococcus_phage	58.7	2.9e-77
WP_001137532.1|2052032_2052242_+	TM2 domain-containing protein	NA	NA	NA	NA	NA
WP_000429451.1|2052758_2053724_+	DUF3644 domain-containing protein	NA	A0A0N9RUA4	Staphylococcus_phage	51.1	7.1e-86
WP_000605386.1|2054055_2055228_+|integrase	site-specific integrase	integrase	A0A1X9I5Y5	Streptococcus_phage	69.6	1.6e-153
WP_000092759.1|2055334_2055946_-	30S ribosomal protein S4	NA	NA	NA	NA	NA
2055333:2055352	attR	AATTAAAGCATTTTGTTGTA	NA	NA	NA	NA
WP_001278152.1|2056275_2056563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000230635.1|2056574_2057930_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	62.6	1.2e-152
