The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	544813	553285	2907074		Streptococcus_phage(66.67%)	9	NA	NA
WP_002294039.1|544813_545458_+	dTMP kinase	NA	M1PSC7	Streptococcus_phage	52.6	4.2e-58
WP_002292340.1|545472_545802_+	cyclic-di-AMP receptor	NA	NA	NA	NA	NA
WP_002288071.1|545815_546754_+	DNA polymerase III subunit delta'	NA	M1NSC1	Streptococcus_phage	34.4	3.3e-35
WP_002288073.1|546789_547614_+	stage 0 sporulation family protein	NA	NA	NA	NA	NA
WP_002288076.1|547606_547954_+	DNA replication initiation control protein YabA	NA	M1PFV3	Streptococcus_phage	41.1	5.1e-18
WP_002288078.1|548022_548895_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	60.4	3.1e-88
WP_002294035.1|549003_550125_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_002288081.1|550178_550781_-	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	58.6	1.7e-53
WP_002288083.1|551095_553285_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	66.6	1.8e-286
>prophage 2
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	663385	754959	2907074	head,capsid,tail,plate,transposase,terminase,integrase,tRNA,protease,portal,holin	Streptococcus_phage(32.08%)	102	679141:679181	722796:722836
WP_002296623.1|663385_664681_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002320964.1|664786_666055_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.1	1.9e-54
WP_002297196.1|666327_668799_+	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	28.8	7.0e-45
WP_002297195.1|668901_670638_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	34.1	1.2e-27
WP_002293705.1|670634_671339_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.2	1.4e-38
WP_002297194.1|671469_671973_+	DUF523 domain-containing protein	NA	NA	NA	NA	NA
WP_002293708.1|671932_672271_+	putative DNA-binding protein	NA	NA	NA	NA	NA
WP_002293709.1|672291_673710_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_002293710.1|673821_674400_+	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_002297192.1|674403_674925_+	dihydrofolate reductase	NA	NA	NA	NA	NA
WP_002293714.1|675003_675558_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	29.3	2.3e-12
WP_002290274.1|675810_676086_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_002290277.1|676097_676349_+	KH domain-containing protein	NA	NA	NA	NA	NA
WP_002297190.1|676473_677265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002293716.1|677434_677956_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_002293717.1|677945_678707_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_002286913.1|678842_679190_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
679141:679181	attL	TACGTGCATTACACGGAAAAGCTGCTCGTATCAAAGAAATC	NA	NA	NA	NA
WP_077974390.1|679321_680458_-|integrase	site-specific integrase	integrase	A0A1P8BMN3	Lactococcus_phage	37.1	1.7e-54
WP_077974389.1|680573_681488_-	DUF4352 domain-containing protein	NA	NA	NA	NA	NA
WP_070676686.1|681578_682007_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_002337457.1|682011_682386_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	44.6	6.9e-21
WP_002315391.1|682671_682857_+	helix-turn-helix transcriptional regulator	NA	Q5YAA3	Bacillus_phage	56.7	8.4e-12
WP_002325021.1|682868_683117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296610.1|683147_683327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286568.1|683369_683840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286562.1|683926_684625_+	phage regulatory protein	NA	D2IYT0	Enterococcus_phage	34.6	1.7e-25
WP_002286559.1|684802_685144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286557.1|685136_685808_+	DUF1071 domain-containing protein	NA	A0A1B1P7F0	Bacillus_phage	47.4	4.2e-29
WP_077974388.1|685813_686500_+	hypothetical protein	NA	C9E2N1	Enterococcus_phage	68.6	7.0e-88
WP_079200755.1|686502_687333_+	phage replisome organizer N-terminal domain-containing protein	NA	C9E2N2	Enterococcus_phage	43.9	2.6e-52
WP_002323158.1|687348_688200_+	ATP-binding protein	NA	A0A0P0I3L9	Lactobacillus_phage	28.7	6.2e-25
WP_002317837.1|688196_688556_+	DUF1064 domain-containing protein	NA	A0A1P8BKR1	Lactococcus_phage	48.3	1.1e-18
WP_079200798.1|688728_689034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200797.1|689033_689345_+	hypothetical protein	NA	A0A0D3MVS9	Staphylococcus_phage	56.0	2.0e-26
WP_002375499.1|689341_689515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200796.1|689511_689928_+	DNA-packaging protein	NA	D2IZL0	Enterococcus_phage	54.0	6.9e-30
WP_079200795.1|689927_690596_+	DUF1642 domain-containing protein	NA	Q8W5X2	Listeria_phage	45.7	1.5e-21
WP_101706191.1|690592_690970_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200794.1|690966_691266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164450255.1|691255_691414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002318885.1|691507_691924_+	autolysin	NA	C9E2P5	Enterococcus_phage	68.1	4.8e-47
WP_002287522.1|692433_692838_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002287525.1|692854_694003_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_060809366.1|694204_694465_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	50.0	1.0e-15
WP_060809365.1|694505_694733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200793.1|694797_695370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077974384.1|695370_695682_+	HNH endonuclease	NA	A0A1S5SFB3	Streptococcus_phage	59.2	6.3e-28
WP_071244186.1|695672_695933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073357560.1|696093_696453_+	hypothetical protein	NA	A0A2H4JAH7	uncultured_Caudovirales_phage	67.2	5.2e-34
WP_073357561.1|696449_698093_+|terminase	terminase large subunit	terminase	A0A1S5SF58	Streptococcus_phage	65.3	1.8e-206
WP_158182303.1|698127_699210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073357563.1|699253_700426_+|portal	phage portal protein	portal	A0A2P0ZLC9	Lactobacillus_phage	46.6	6.8e-83
WP_002371767.1|700412_701117_+|protease	Clp protease ClpP	protease	A0A2H4J8Y7	uncultured_Caudovirales_phage	45.9	9.5e-48
WP_071244203.1|701121_702282_+|capsid	phage major capsid protein	capsid	D2XR18	Bacillus_phage	39.7	8.3e-65
WP_002371763.1|702357_702636_+	hypothetical protein	NA	A0A1W6JQ66	Staphylococcus_phage	48.2	1.8e-13
WP_073357576.1|702616_702988_+|head,tail	phage head-tail adapter protein	head,tail	A0A059T6F2	Listeria_phage	55.4	1.2e-28
WP_073357564.1|703003_703408_+	hypothetical protein	NA	A0A2H4J7V9	uncultured_Caudovirales_phage	38.5	7.7e-18
WP_077974383.1|703404_703815_+	hypothetical protein	NA	A0A059T681	Listeria_phage	48.0	1.6e-23
WP_077974382.1|703875_704463_+|tail	phage tail protein	tail	A0A2P0ZLF5	Lactobacillus_phage	41.0	1.6e-35
WP_002371755.1|704535_705003_+	Ig domain-containing protein	NA	C9E2K1	Enterococcus_phage	43.9	8.1e-19
WP_002337251.1|705048_705357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002342059.1|712291_713164_+|plate	phage baseplate protein	plate	NA	NA	NA	NA
WP_071244211.1|713160_714210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002290629.1|714213_715038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079200790.1|715055_717098_+|plate	BppU family phage baseplate upper protein	plate	A0A096XSZ6	Enterococcus_phage	46.8	2.0e-82
WP_164853016.1|717111_717261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332429.1|717257_717704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002327992.1|717705_717843_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002303476.1|717879_718173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|718169_718394_+|holin	phage holin	holin	NA	NA	NA	NA
WP_079232052.1|718390_719410_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1G5SA77	Enterococcus_phage	66.1	2.4e-60
WP_002286474.1|719710_720118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347084.1|721054_721225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002330843.1|722065_722365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079232053.1|722379_722601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002286921.1|723217_723880_+	hypothetical protein	NA	NA	NA	NA	NA
722796:722836	attR	TACGTGCATTACACGGAAAAGCTGCTCGTATCAAAGAAATC	NA	NA	NA	NA
WP_002286925.1|727297_727612_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.7e-25
WP_002286926.1|727624_727999_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	62.9	1.1e-34
WP_002286928.1|728008_728353_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002286930.1|728423_729776_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	64.6	5.9e-163
WP_002286932.1|729835_730978_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	62.1	1.7e-126
WP_002286933.1|731002_731257_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286934.1|731512_732697_+	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	60.8	1.9e-141
WP_002305703.1|732693_732831_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|733576_735487_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033657400.1|735590_735815_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	8.8e-24
WP_002288934.1|735827_736328_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.6	7.0e-53
WP_002288935.1|736424_738272_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_002297208.1|738274_739171_+	AAA family ATPase	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	29.7	1.1e-16
WP_002288938.1|739220_739610_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	65.9	1.4e-40
WP_002321772.1|739596_741942_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	76.0	0.0e+00
WP_002296840.1|742034_743222_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002289059.1|743522_745652_+	FUSC family protein	NA	A0A1S5SF30	Streptococcus_phage	60.3	3.1e-182
WP_002289057.1|745648_746656_+	lipoprotein	NA	A0A1S5SEZ8	Streptococcus_phage	63.9	4.8e-117
WP_002289055.1|746672_747584_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	42.2	1.1e-59
WP_002289053.1|747711_748440_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	37.1	5.1e-36
WP_002321361.1|748436_749846_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002289051.1|750173_751295_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_077828749.1|751714_751951_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002343922.1|751903_752857_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002305710.1|753195_753705_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087040414.1|753797_754959_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	53.5	1.6e-79
>prophage 3
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	768870	868151	2907074	head,capsid,tail,transposase,terminase,integrase,tRNA,protease,portal,holin	Streptococcus_phage(19.05%)	113	793037:793052	825217:825232
WP_002299190.1|768870_770418_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002288962.1|770569_770998_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288964.1|770984_771227_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288966.1|771526_771742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300928.1|771848_772163_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002288969.1|772266_773445_+|integrase	site-specific integrase	integrase	S6C485	Thermus_phage	31.1	1.4e-30
WP_002288970.1|773847_774141_+	DUF2087 domain-containing protein	NA	NA	NA	NA	NA
WP_002305732.1|774983_777311_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002352916.1|777436_777766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158003446.1|777805_778810_+	isopeptide-forming domain-containing fimbrial protein	NA	NA	NA	NA	NA
WP_002288979.1|778806_779253_+	cell wall anchor	NA	NA	NA	NA	NA
WP_002288981.1|779402_780218_+	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_010721614.1|780423_781596_+	class C sortase	NA	NA	NA	NA	NA
WP_010721943.1|781757_782252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010721616.1|782834_783257_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010721617.1|783422_784616_-	MFS transporter	NA	NA	NA	NA	NA
WP_002302962.1|784839_785217_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016631212.1|785676_786120_+	LysR family transcriptional regulator substrate-binding protein	NA	NA	NA	NA	NA
WP_010721620.1|786380_787196_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_077974320.1|787205_787868_+	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_002297645.1|788075_789740_+	acetolactate synthase AlsS	NA	NA	NA	NA	NA
WP_077974323.1|789752_790463_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_002289618.1|790592_791090_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_002289617.1|791274_791535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321266.1|791896_792136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002323892.1|792421_792736_+	hypothetical protein	NA	NA	NA	NA	NA
793037:793052	attL	TTTGAATGTTTTTTTG	NA	NA	NA	NA
WP_002288592.1|793706_794480_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002288595.1|794623_794974_+	SdpI family protein	NA	NA	NA	NA	NA
WP_002293942.1|794954_795671_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.0e-33
WP_002288588.1|795670_797119_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	29.3	1.7e-19
WP_002288586.1|797188_797698_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297641.1|797687_798413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002333083.1|798635_800756_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	58.3	1.7e-220
WP_002322842.1|800985_802164_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	48.9	5.1e-102
WP_002326253.1|802179_802938_+	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	36.9	6.5e-26
WP_002288577.1|802960_803446_+|tRNA	Cys-tRNA(Pro) deacylase	tRNA	NA	NA	NA	NA
WP_002302440.1|803588_804890_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002288576.1|805017_806271_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	55.3	7.7e-24
WP_002288575.1|806388_807738_+	NADP-specific glutamate dehydrogenase	NA	NA	NA	NA	NA
WP_002288574.1|807849_809196_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_002288573.1|809503_809890_-	YxeA family protein	NA	NA	NA	NA	NA
WP_002288571.1|810113_811559_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.2e-125
WP_002311774.1|812613_813573_+|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	7.5e-11
WP_002293931.1|813825_813975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297633.1|814436_814649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287775.1|814926_816726_-	glycerophosphoryl diester phosphodiesterase membrane domain-containing protein	NA	I6XE30	Staphylococcus_phage	26.5	5.3e-10
WP_002287776.1|816849_817446_-	TVP38/TMEM64 family protein	NA	M1Q152	Streptococcus_phage	41.7	8.7e-34
WP_002325884.1|817637_818591_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002296337.1|818862_819207_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_002296336.1|819207_819627_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_002296335.1|819718_820069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296334.1|820034_821366_-	DUF1576 domain-containing protein	NA	NA	NA	NA	NA
WP_002296332.1|821621_822188_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002343600.1|822526_823675_-|integrase	site-specific integrase	integrase	A0A1S5S7K9	Streptococcus_phage	38.9	1.6e-68
WP_002329429.1|823782_824418_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	52.6	5.1e-32
WP_077974328.1|824499_824922_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_010729725.1|824939_825263_-	helix-turn-helix transcriptional regulator	NA	Q9AZJ7	Lactococcus_phage	48.3	7.0e-14
825217:825232	attR	TTTGAATGTTTTTTTG	NA	NA	NA	NA
WP_002321800.1|825554_825746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002323902.1|825759_826020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073466440.1|826068_826251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002332465.1|826341_826800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350675.1|826967_827285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002329420.1|827217_827697_+	siphovirus Gp157 family protein	NA	E5DV79	Deep-sea_thermophilic_phage	49.0	5.3e-34
WP_010725526.1|827713_827890_+	hypothetical protein	NA	D7RWL9	Brochothrix_phage	56.4	3.7e-09
WP_073466443.1|828098_828530_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073466445.1|828629_829340_+	AAA family ATPase	NA	A8YQL5	Lactobacillus_phage	64.3	5.4e-83
WP_073466447.1|829311_830835_+	DEAD/DEAH box helicase	NA	Q9T0Y3	Lactobacillus_phage	47.9	1.4e-107
WP_079232054.1|830852_831359_+	DUF669 domain-containing protein	NA	A8ATF2	Listeria_phage	45.2	3.3e-34
WP_073466450.1|831358_833695_+	DNA primase	NA	Q9T0Y1	Lactobacillus_phage	51.1	2.2e-226
WP_073466452.1|834009_834327_+	VRR-NUC domain-containing protein	NA	W0G8N0	Listeria_phage	64.1	4.5e-29
WP_002290675.1|834323_834485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305393.1|834481_834787_+	hypothetical protein	NA	NA	NA	NA	NA
WP_073466454.1|834786_835107_+	DUF1140 family protein	NA	A0A2H4JAZ4	uncultured_Caudovirales_phage	36.4	1.8e-09
WP_045135992.1|835729_835927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045135991.1|835923_836229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045135990.1|836251_836482_+	hypothetical protein	NA	A0A0S2MYD2	Enterococcus_phage	53.5	3.6e-12
WP_045135989.1|836488_836686_+	toxin PIN	NA	NA	NA	NA	NA
WP_045135988.1|836682_836889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079232055.1|836888_837185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002304479.1|837260_837674_+	autolysin	NA	C9E2P5	Enterococcus_phage	81.0	1.1e-56
WP_045135986.1|838019_838394_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002340810.1|838430_838598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045135985.1|838623_838968_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	58.1	1.0e-26
WP_002296599.1|838972_839254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286538.1|839356_839671_+|terminase	terminase	terminase	A0A1S7FYW6	Listeria_phage	37.9	3.3e-08
WP_002286533.1|839648_841343_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	49.6	3.0e-148
WP_002286530.1|841362_842541_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	40.4	5.4e-80
WP_079232056.1|842503_843190_+|protease	Clp protease ClpP	protease	A0A2I6PDD0	Staphylococcus_phage	39.7	1.0e-30
WP_002286525.1|843189_844350_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	50.1	1.8e-99
WP_002286524.1|844359_845235_+	hypothetical protein	NA	D2IYX3	Enterococcus_phage	74.2	5.6e-130
WP_002286523.1|845231_845543_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	42.1	6.3e-12
WP_002286522.1|845532_845886_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_002296598.1|845875_846277_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	33.3	1.1e-13
WP_002286516.1|846269_846674_+	hypothetical protein	NA	R4IBU7	Listeria_phage	29.5	6.1e-07
WP_002286512.1|846685_847294_+	hypothetical protein	NA	Q8W5Z9	Listeria_phage	41.1	3.0e-34
WP_002299170.1|847313_847676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047929880.1|847678_847861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079232057.1|847877_851483_+|tail	phage tail protein	tail	D2J070	Enterococcus_phage	44.8	8.6e-52
WP_079232058.1|851533_852271_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_077974331.1|852280_854572_+|tail	phage tail protein	tail	A0A1D3SNL1	Enterococcus_phage	29.5	2.8e-88
WP_077974334.1|854595_856686_+	hypothetical protein	NA	A0A249XZH9	Enterococcus_phage	50.0	2.8e-87
WP_002290627.1|856702_856852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286491.1|856848_857295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296594.1|857296_857434_+	XkdX family protein	NA	NA	NA	NA	NA
WP_002286686.1|857471_857765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286683.1|857761_857986_+|holin	phage holin	holin	NA	NA	NA	NA
WP_002286484.1|857982_859008_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A139ZVY1	Enterococcus_phage	61.3	2.1e-64
WP_087046766.1|859947_861109_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_002286474.1|862032_862440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296902.1|862453_862855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002286473.1|862856_863228_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000997695.1|864899_866078_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002296918.1|866705_868151_+|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.0	1.5e-124
>prophage 4
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1021050	1069629	2907074	transposase,integrase,tRNA,protease	Streptococcus_phage(23.08%)	44	1039995:1040012	1073154:1073171
WP_002297404.1|1021050_1022301_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296405.1|1023255_1024197_+	rhodanese-related sulfurtransferase	NA	NA	NA	NA	NA
WP_002296404.1|1024265_1024997_+	serine/threonine protein phosphatase	NA	A7KV25	Bacillus_phage	30.8	1.7e-15
WP_002296403.1|1025140_1027321_+	RNA-binding transcriptional accessory protein	NA	NA	NA	NA	NA
WP_002296402.1|1027340_1027823_+	SprT family protein	NA	NA	NA	NA	NA
WP_077974348.1|1027838_1028600_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002296400.1|1028730_1030065_+	UDP-N-acetylmuramate--L-alanine ligase	NA	NA	NA	NA	NA
WP_002296398.1|1030492_1030978_+	dehydratase	NA	NA	NA	NA	NA
WP_002296397.1|1030970_1031654_+	Bax inhibitor-1/YccA family protein	NA	NA	NA	NA	NA
WP_002303538.1|1031779_1034425_+	DNA polymerase I	NA	F8WQ35	Bacillus_phage	35.7	3.0e-54
WP_002288323.1|1034469_1035306_+	DNA-formamidopyrimidine glycosylase	NA	A0A127AWE5	Bacillus_phage	30.2	1.8e-24
WP_002288324.1|1035269_1035899_+	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_002303537.1|1035950_1036283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288327.1|1036594_1037086_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_002288329.1|1037108_1038482_+	DnaD domain protein	NA	NA	NA	NA	NA
WP_002288331.1|1038481_1039408_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	41.3	5.1e-33
WP_002288333.1|1039536_1039977_+	lipoprotein	NA	NA	NA	NA	NA
1039995:1040012	attL	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
WP_002288335.1|1040120_1040822_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_002288338.1|1040818_1041940_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_002288340.1|1041954_1043187_+	peptidase T	NA	NA	NA	NA	NA
WP_002288343.1|1043318_1044227_+	YegS/Rv2252/BmrU family lipid kinase	NA	NA	NA	NA	NA
WP_002305633.1|1044261_1044534_+	DUF1294 domain-containing protein	NA	NA	NA	NA	NA
WP_002288347.1|1044544_1045591_+	flippase-like domain-containing protein	NA	NA	NA	NA	NA
WP_002301554.1|1045841_1048451_+	ATP-dependent chaperone ClpB	NA	A0A2I7SAX5	Vibrio_phage	35.0	1.6e-132
WP_002362216.1|1048601_1049288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288352.1|1049265_1049760_-	nucleoside deoxyribosyltransferase	NA	A0A1W6JK28	Lactococcus_phage	56.5	7.2e-42
WP_002288353.1|1049779_1051000_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002288355.1|1051146_1052982_+	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.4	3.4e-20
WP_002288357.1|1053075_1054203_-|integrase	site-specific integrase	integrase	A0A2I7SCV1	Paenibacillus_phage	55.5	1.8e-109
WP_000222572.1|1054259_1055213_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_000997695.1|1055368_1056547_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002289415.1|1057597_1058011_-	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	31.5	2.1e-07
WP_002303864.1|1058466_1058952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289418.1|1059090_1059306_-	DUF378 domain-containing protein	NA	NA	NA	NA	NA
WP_002289420.1|1059529_1060330_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	26.2	2.6e-09
WP_002289421.1|1060348_1062217_+	HTH domain-containing protein	NA	NA	NA	NA	NA
WP_002289422.1|1062209_1062701_+	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289423.1|1062688_1063243_+	PTS glucitol/sorbitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002289425.1|1063260_1064256_+	PTS glucitol/sorbitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1064397_1065648_-|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002296624.1|1066056_1066455_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311093.1|1066438_1067134_+	fructose-6-phosphate aldolase	NA	E3SKN5	Synechococcus_phage	31.5	1.0e-22
WP_002296627.1|1067717_1068605_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_002296628.1|1068789_1069629_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
1073154:1073171	attR	AAAATAAGAAAATGTTGT	NA	NA	NA	NA
>prophage 5
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1276856	1324001	2907074	transposase,tRNA	Lysinibacillus_phage(14.29%)	40	NA	NA
WP_002297185.1|1276856_1278152_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002295819.1|1278260_1279148_-	glucosaminidase domain-containing protein	NA	A0A0K2CP65	Brevibacillus_phage	43.2	4.5e-18
WP_016171142.1|1279329_1280283_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_002295818.1|1280460_1282458_-	transketolase	NA	NA	NA	NA	NA
WP_002295816.1|1282559_1282811_-	DUF896 family protein	NA	NA	NA	NA	NA
WP_002296572.1|1282957_1283581_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	59.4	2.2e-16
WP_002297436.1|1283760_1283979_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287525.1|1284175_1285324_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.4	1.2e-204
WP_002287522.1|1285340_1285745_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002295813.1|1286158_1286671_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.6	2.4e-32
WP_002296571.1|1286684_1288982_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	33.9	1.3e-80
WP_002303793.1|1289123_1289567_-	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_002296573.1|1289567_1290356_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_002295809.1|1290352_1291294_-	ribonuclease Z	NA	NA	NA	NA	NA
WP_002295807.1|1291470_1292058_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303792.1|1292278_1293586_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_002289734.1|1293879_1294890_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289735.1|1294974_1295910_-	alpha/beta hydrolase	NA	W5S4D8	Pithovirus	25.4	2.0e-05
WP_002303791.1|1296095_1297055_+|transposase	IS30-like element IS6770 family transposase	transposase	NA	NA	NA	NA
WP_002295800.1|1297140_1298235_-	DUF871 domain-containing protein	NA	NA	NA	NA	NA
WP_002296283.1|1298423_1299185_+	peptidylprolyl isomerase	NA	A0A1V0S9I2	Catovirus	38.0	6.7e-23
WP_002295797.1|1299299_1299740_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_002295795.1|1299959_1300715_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_002296282.1|1300824_1301838_-	branched-chain amino acid aminotransferase	NA	NA	NA	NA	NA
WP_002295791.1|1302002_1302923_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_002295789.1|1303202_1303703_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_002288030.1|1303809_1304328_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002296875.1|1304328_1305684_-	ribonuclease PH	NA	A0A0P0A2M4	Ugandan_cassava_brown_streak_virus	30.8	9.2e-15
WP_002317207.1|1305686_1306508_-	glutamate racemase	NA	NA	NA	NA	NA
WP_002296876.1|1306669_1307326_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002288038.1|1307341_1307989_-	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_002288041.1|1308001_1308817_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_002296877.1|1308830_1309568_-	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.6	7.7e-32
WP_002288045.1|1309821_1310832_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002296881.1|1311001_1313422_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002295783.1|1313426_1314470_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	33.6	1.9e-31
WP_002303789.1|1314778_1315120_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296885.1|1315188_1318911_-	helicase-exonuclease AddAB subunit AddA	NA	S5MMD7	Bacillus_phage	23.3	2.7e-24
WP_002296887.1|1318907_1322435_-	PD-(D/E)XK nuclease family protein	NA	NA	NA	NA	NA
WP_002297218.1|1322705_1324001_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 6
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1388216	1397277	2907074		Synechococcus_phage(16.67%)	9	NA	NA
WP_002288010.1|1388216_1388795_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	1.3e-26
WP_002288011.1|1388791_1389844_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.7	2.7e-62
WP_002288013.1|1389866_1391306_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.1	5.3e-53
WP_002288015.1|1391290_1393513_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	41.3	1.9e-150
WP_002288017.1|1393513_1394185_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_002295474.1|1394186_1394441_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_002288021.1|1394440_1395169_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	E3SPA9	Prochlorococcus_phage	41.4	4.6e-45
WP_002297115.1|1395424_1395802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288023.1|1395981_1397277_-	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	33.1	4.5e-19
>prophage 7
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1437625	1486552	2907074	transposase,tRNA,protease	Lysinibacillus_phage(12.5%)	44	NA	NA
WP_002297218.1|1437625_1438921_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002289257.1|1439208_1439949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289258.1|1440078_1441026_-	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002289259.1|1441154_1441919_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002297001.1|1441922_1442312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289260.1|1442446_1442989_+	DUF2179 domain-containing protein	NA	NA	NA	NA	NA
WP_002301399.1|1443037_1443997_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	26.8	2.2e-10
WP_002289266.1|1444201_1444834_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002296999.1|1444967_1445093_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_002289262.1|1445226_1446120_-	DUF1803 domain-containing protein	NA	NA	NA	NA	NA
WP_002289263.1|1446301_1447228_-	manganese-dependent inorganic pyrophosphatase	NA	NA	NA	NA	NA
WP_002289264.1|1447312_1448074_-	pyruvate formate lyase-activating protein	NA	NA	NA	NA	NA
WP_002289265.1|1448317_1450549_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	42.5	2.4e-169
WP_002320956.1|1450825_1453276_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	31.6	9.2e-98
WP_002303746.1|1453287_1455333_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	41.3	2.4e-115
WP_002296996.1|1455498_1455933_-	CoA-binding protein	NA	NA	NA	NA	NA
WP_002296995.1|1456059_1456698_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_002296994.1|1456829_1457705_-	aldose 1-epimerase family protein	NA	NA	NA	NA	NA
WP_002290223.1|1457786_1458578_-	GTP-sensing pleiotropic transcriptional regulator CodY	NA	NA	NA	NA	NA
WP_002288421.1|1458595_1459996_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A173GFL6	Erwinia_phage	28.8	1.7e-43
WP_002288419.1|1460009_1460558_-	HslU--HslV peptidase proteolytic subunit	NA	NA	NA	NA	NA
WP_002297404.1|1460967_1462218_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002288415.1|1462377_1463283_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	29.4	9.4e-32
WP_086953915.1|1464593_1465933_-|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002320953.1|1466421_1467798_-|tRNA	FADH(2)-oxidizing methylenetetrahydrofolate--tRNA-(uracil(54)-C(5))- methyltransferase TrmFO	tRNA	NA	NA	NA	NA
WP_002288411.1|1467766_1469845_-	type I DNA topoisomerase	NA	A0A167R9A0	Powai_lake_megavirus	38.5	1.2e-101
WP_002303743.1|1469966_1470824_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_002296990.1|1470879_1471647_-	ribonuclease HII	NA	D2TEQ2	Emiliania_huxleyi_virus	39.5	2.7e-27
WP_002296988.1|1471639_1472500_-	ribosome biogenesis GTPase YlqF	NA	NA	NA	NA	NA
WP_002288405.1|1472759_1473158_+	VOC family protein	NA	NA	NA	NA	NA
WP_002320949.1|1473436_1473937_+	folate family ECF transporter S component	NA	NA	NA	NA	NA
WP_002294418.1|1474019_1474571_-	signal peptidase I	NA	NA	NA	NA	NA
WP_002288398.1|1474722_1474950_-	YozE family protein	NA	NA	NA	NA	NA
WP_002288397.1|1474946_1475465_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288396.1|1475484_1476198_-	YpmS family protein	NA	NA	NA	NA	NA
WP_002288395.1|1476200_1477097_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288394.1|1477254_1478097_-	DegV family protein	NA	A0A0N9SI50	Staphylococcus_phage	40.2	6.5e-19
WP_002288393.1|1478228_1478882_+	hemolysin III family protein	NA	NA	NA	NA	NA
WP_002288392.1|1478944_1479472_-	dihydrofolate reductase	NA	A0A1D6X864	Bacillus_phage	37.1	6.7e-22
WP_002294416.1|1479491_1480439_-	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	64.6	7.1e-123
WP_002288390.1|1480450_1482337_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.6e-52
WP_002324658.1|1482501_1484574_-	sodium:proton antiporter	NA	NA	NA	NA	NA
WP_002290188.1|1484586_1484862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297185.1|1485256_1486552_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
>prophage 8
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1501853	1563599	2907074	transposase	Streptococcus_phage(20.0%)	52	NA	NA
WP_002302440.1|1501853_1503155_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002294399.1|1503273_1504614_-	Sapep family Mn(2+)-dependent dipeptidase	NA	NA	NA	NA	NA
WP_002290168.1|1504850_1506374_-	YfcC family protein	NA	NA	NA	NA	NA
WP_002296977.1|1506751_1507363_-	ECF transporter S component	NA	NA	NA	NA	NA
WP_002294391.1|1507692_1508409_-	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_002296975.1|1508414_1508984_-	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	1.5e-14
WP_002305297.1|1508967_1509765_-	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	25.0	6.4e-08
WP_002294387.1|1509734_1510106_-	protein RibT	NA	NA	NA	NA	NA
WP_002294386.1|1510124_1511012_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	29.7	1.2e-31
WP_002302440.1|1511330_1512632_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002297218.1|1512768_1514064_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002322512.1|1514130_1514604_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002290060.1|1514708_1515572_-	S1 RNA-binding protein	NA	NA	NA	NA	NA
WP_002321398.1|1515767_1517867_-	TFIIB-type zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_002289498.1|1518086_1519196_-	RNA polymerase sigma factor RpoD	NA	F4YCU2	Synechococcus_phage	38.9	9.8e-39
WP_002289497.1|1519219_1521061_-	DNA primase	NA	A0A1S5RH70	Helicobacter_phage	32.1	1.2e-49
WP_002303731.1|1521242_1523558_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	26.2	9.2e-39
WP_002289459.1|1523742_1524603_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_002303352.1|1524661_1525183_-	lysozyme family protein	NA	A0A0N9SIT8	Bacillus_phage	38.1	4.6e-15
WP_002289461.1|1525460_1526222_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002294379.1|1526247_1528839_+	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_002289463.1|1529026_1530214_-	elongation factor Tu	NA	A0A076FFS6	Aureococcus_anophage	28.5	1.3e-33
WP_002289464.1|1530581_1530938_+	YxeA family protein	NA	NA	NA	NA	NA
WP_002294378.1|1531178_1532183_-	nucleoid-associated protein	NA	NA	NA	NA	NA
WP_002289273.1|1532348_1533200_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.4	1.4e-53
WP_002289275.1|1533216_1533462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289272.1|1533648_1534353_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289271.1|1534682_1537124_-	hydroxymethylglutaryl-CoA reductase, degradative	NA	NA	NA	NA	NA
WP_077974289.1|1537420_1538500_-|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002289270.1|1538701_1539856_+	hydroxymethylglutaryl-CoA synthase	NA	NA	NA	NA	NA
WP_002289269.1|1539877_1540630_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_002294372.1|1540993_1543660_-	cation-translocating P-type ATPase	NA	M1HJQ2	Paramecium_bursaria_Chlorella_virus	30.1	1.6e-82
WP_002289473.1|1544000_1545452_+	cardiolipin synthase	NA	NA	NA	NA	NA
WP_002289472.1|1545780_1546596_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_002289474.1|1546889_1547165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002289471.1|1547591_1548047_+	Spx/MgsR family RNA polymerase-binding regulatory protein	NA	NA	NA	NA	NA
WP_002289470.1|1548126_1548876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289468.1|1548876_1549203_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002289467.1|1549350_1549791_-	universal stress protein	NA	NA	NA	NA	NA
WP_002296967.1|1549871_1551269_-	glycoside hydrolase family 1 protein	NA	NA	NA	NA	NA
WP_002294365.1|1551421_1552693_+	PTS cellobiose transporter subunit IIC	NA	NA	NA	NA	NA
WP_002296966.1|1552819_1553539_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288275.1|1553916_1554891_+	ring-cleaving dioxygenase	NA	NA	NA	NA	NA
WP_002288276.1|1554943_1555549_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_002288278.1|1555642_1556395_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_002288318.1|1556408_1556669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288281.1|1556690_1558052_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_002288285.1|1558124_1558424_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002287107.1|1558833_1560084_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002291790.1|1560226_1560559_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002297183.1|1560558_1562421_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_000222572.1|1562645_1563599_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1643339	1750184	2907074	transposase,tRNA,protease	Streptococcus_phage(20.0%)	91	NA	NA
WP_002302440.1|1643339_1644641_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002287603.1|1644806_1646534_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	35.9	9.3e-20
WP_002287602.1|1646533_1646800_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_002287598.1|1647278_1649513_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A223W0B1	Agrobacterium_phage	39.1	5.1e-127
WP_002290825.1|1649660_1649981_+	DUF1827 family protein	NA	NA	NA	NA	NA
WP_002295394.1|1650606_1652187_-	peptide chain release factor 3	NA	A0A1B0RXH7	Streptococcus_phage	28.4	5.1e-33
WP_002295395.1|1652587_1653964_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_002290821.1|1654091_1655210_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_002297185.1|1655722_1657018_-|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_002290817.1|1657385_1657919_-	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_002296955.1|1658012_1659191_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_002295398.1|1659183_1659981_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_002295399.1|1660087_1661470_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	37.4	3.5e-86
WP_002292856.1|1661643_1662222_-	lytic polysaccharide monooxygenase	NA	A0A0K1Y848	Apis_mellifera_filamentous_virus	34.4	9.7e-14
WP_077495118.1|1662543_1663014_+	tryptophan-rich sensory protein	NA	NA	NA	NA	NA
WP_002295400.1|1663121_1664348_-	LCP family protein	NA	NA	NA	NA	NA
WP_002292860.1|1665101_1665302_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	67.7	7.6e-19
WP_002295401.1|1665435_1666044_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	60.1	7.7e-70
WP_002292862.1|1666128_1666599_-	GtrA family protein	NA	NA	NA	NA	NA
WP_002317368.1|1666646_1667561_-	cation transporter	NA	A0A1V0SED0	Indivirus	31.5	2.1e-10
WP_002289147.1|1667706_1668510_+	DUF1189 domain-containing protein	NA	NA	NA	NA	NA
WP_002289148.1|1668687_1669635_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_002289149.1|1669702_1669996_-	iron-sulfur cluster biosynthesis protein	NA	NA	NA	NA	NA
WP_002289151.1|1670023_1670689_-	TrkA family potassium uptake protein	NA	NA	NA	NA	NA
WP_002289153.1|1670828_1671461_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_002289154.1|1671467_1672535_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_002292871.1|1672531_1673263_-	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_002289156.1|1673431_1673911_-	transcription elongation factor GreA	NA	NA	NA	NA	NA
WP_002289159.1|1674046_1675222_-	endolytic transglycosylase MltG	NA	NA	NA	NA	NA
WP_002289161.1|1675425_1676595_+	serine hydrolase	NA	A0A2R4AS58	Mycobacterium_phage	26.3	1.6e-10
WP_172801848.1|1676919_1677168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002347285.1|1677235_1678531_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	5.0e-10
WP_002287105.1|1678686_1679661_-	choloylglycine hydrolase family protein	NA	M1HVK5	Paramecium_bursaria_Chlorella_virus	31.8	5.4e-25
WP_002287107.1|1680070_1681321_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
WP_002295273.1|1681606_1681864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002305693.1|1682095_1682527_-	DUF4231 domain-containing protein	NA	NA	NA	NA	NA
WP_000997695.1|1684236_1685415_-|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_086953915.1|1685584_1686923_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_077974309.1|1686963_1687656_-	N-acetylmuramoyl-L-alanine amidase	NA	Q9MCC6	Lactobacillus_phage	43.4	5.2e-30
WP_002294835.1|1688092_1688662_-	prevent-host-death protein	NA	NA	NA	NA	NA
WP_002304701.1|1688735_1689059_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294839.1|1689212_1690025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002304700.1|1690378_1691227_+	MoxR family ATPase	NA	NA	NA	NA	NA
WP_002289045.1|1691371_1692313_+	DUF58 domain-containing protein	NA	NA	NA	NA	NA
WP_002297218.1|1694702_1695998_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296533.1|1696107_1698279_-	copper/silver-translocating P-type ATPase CopB	NA	A0A218MNH6	uncultured_virus	32.3	5.0e-71
WP_002289041.1|1698298_1700485_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	38.6	1.5e-120
WP_002289040.1|1700484_1700694_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_002289038.1|1700706_1701147_-	CopY/TcrY family copper transport repressor	NA	NA	NA	NA	NA
WP_002289037.1|1701220_1701760_-	transcriptional regulator	NA	A0A097BYE2	Leuconostoc_phage	34.5	3.8e-20
WP_002297185.1|1702007_1703303_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	21.4	3.8e-10
WP_077974307.1|1703773_1705240_-	amino acid permease	NA	NA	NA	NA	NA
WP_002296577.1|1705530_1707615_-	cadmium-translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	35.7	4.9e-116
WP_002297218.1|1707873_1709169_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002288776.1|1709661_1710021_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_002319756.1|1710050_1710392_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288769.1|1710388_1711063_-	SGNH/GDSL hydrolase family protein	NA	NA	NA	NA	NA
WP_002288767.1|1712238_1713537_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2P1EMB4	Moumouvirus	30.3	1.2e-59
WP_002296294.1|1713576_1714767_-	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_002321579.1|1714787_1715315_-	DUF5590 domain-containg protein	NA	NA	NA	NA	NA
WP_002288763.1|1715361_1718151_-	DEAD/DEAH box helicase family protein	NA	A0A1X9I5C8	Streptococcus_phage	30.9	1.4e-89
WP_002288762.1|1718297_1718498_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	74.2	2.5e-22
WP_002296295.1|1718950_1719271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002294874.1|1719773_1720892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296298.1|1721362_1722670_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_002296299.1|1722790_1723990_+	YdcF family protein	NA	NA	NA	NA	NA
WP_002296300.1|1724016_1725285_-	voltage-gated chloride channel family protein	NA	A0A1X9I5Z9	Streptococcus_phage	32.3	4.4e-43
WP_002296301.1|1725454_1726096_-	elongation factor G-binding protein	NA	NA	NA	NA	NA
WP_002296302.1|1726504_1727008_-	HD domain-containing protein	NA	NA	NA	NA	NA
WP_002294889.1|1727130_1727895_-	RNA methyltransferase	NA	A0A2D1A6G0	Rhodococcus_phage	26.1	1.7e-05
WP_002289551.1|1728002_1728278_+	acylphosphatase	NA	NA	NA	NA	NA
WP_002317189.1|1728837_1729788_+	membrane protein insertase YidC	NA	NA	NA	NA	NA
WP_002311321.1|1729833_1730235_-	PTS fructose transporter subunit IIA	NA	NA	NA	NA	NA
WP_002311319.1|1730248_1731058_-	PTS system mannose/fructose/sorbose family transporter subunit IID	NA	NA	NA	NA	NA
WP_002311317.1|1731044_1731935_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_024635520.1|1731947_1732427_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_002311314.1|1732602_1733544_-	hexose kinase	NA	NA	NA	NA	NA
WP_002311313.1|1733540_1734536_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002311312.1|1734528_1735725_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002311311.1|1735742_1736471_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002311310.1|1736911_1737886_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002294893.1|1737882_1738341_-	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_002317191.1|1738337_1739801_-	PTS transporter subunit EIIC	NA	NA	NA	NA	NA
WP_002317192.1|1739782_1740715_-	1-phosphofructokinase	NA	NA	NA	NA	NA
WP_002285758.1|1741447_1741642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|1741631_1741985_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_002296127.1|1742086_1743634_+|transposase	IS66 family transposase	transposase	NA	NA	NA	NA
WP_002337813.1|1743801_1744755_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_077974463.1|1744956_1745073_-	DUF1972 domain-containing protein	NA	NA	NA	NA	NA
WP_000195429.1|1745239_1746412_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002297179.1|1749245_1750184_-|transposase	IS30 family transposase	transposase	H7BW61	unidentified_phage	27.2	3.6e-10
>prophage 10
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1769815	1818582	2907074	transposase,bacteriocin,tRNA,holin	Bacillus_phage(33.33%)	41	NA	NA
WP_077974298.1|1769815_1770724_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_002296756.1|1770758_1771109_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_002296753.1|1771108_1771312_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_000997695.1|1771543_1772722_+|transposase	IS256-like element ISEf1 family transposase	transposase	NA	NA	NA	NA
WP_002297218.1|1773269_1774565_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002296162.1|1774688_1776764_-|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_002296161.1|1776765_1777683_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_002296160.1|1778066_1778879_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_002288753.1|1779021_1779921_-	GTPase Era	NA	NA	NA	NA	NA
WP_002301250.1|1779935_1780331_-	diacylglycerol kinase family protein	NA	NA	NA	NA	NA
WP_002288749.1|1780314_1780791_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_002296158.1|1780807_1783000_-	HDIG domain-containing protein	NA	NA	NA	NA	NA
WP_002291698.1|1783023_1783995_-	PhoH family protein	NA	W8D063	Erwinia_phage	49.8	3.5e-48
WP_002296157.1|1784700_1786080_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_002287318.1|1786233_1786680_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	39.5	5.3e-20
WP_002287321.1|1786706_1786883_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_002287322.1|1787044_1787473_-	transcriptional repressor	NA	NA	NA	NA	NA
WP_002296156.1|1787564_1788425_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_002321425.1|1788516_1788867_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002296152.1|1788881_1790609_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	63.6	3.3e-211
WP_002296150.1|1790822_1791749_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	52.4	5.0e-89
WP_002296149.1|1791893_1793327_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296147.1|1793326_1794730_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_002296146.1|1794960_1795863_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296142.1|1797881_1798733_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_002296141.1|1799058_1800843_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.2	7.8e-46
WP_002296139.1|1800842_1802594_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.2	8.2e-56
WP_002294955.1|1802735_1802960_-	YneF family protein	NA	NA	NA	NA	NA
WP_002296138.1|1803210_1804797_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002294959.1|1804862_1806638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296136.1|1806850_1807753_-	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	30.0	1.5e-21
WP_002296135.1|1808031_1810377_+	penicillin-binding protein	NA	NA	NA	NA	NA
WP_002291653.1|1810713_1811715_-	catabolite control protein A	NA	NA	NA	NA	NA
WP_002296134.1|1811924_1813031_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_002296133.1|1813089_1813692_-	YtxH domain-containing protein	NA	NA	NA	NA	NA
WP_002289575.1|1813694_1814135_-	DUF948 domain-containing protein	NA	NA	NA	NA	NA
WP_002289574.1|1814259_1815198_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	51.2	4.2e-75
WP_002296128.1|1815212_1816238_-	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_002289570.1|1816281_1817112_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_002289568.1|1817126_1818065_-	HPr kinase/phosphorylase	NA	NA	NA	NA	NA
WP_002289566.1|1818231_1818582_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 11
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1876144	1935061	2907074	head,capsid,tail,transposase,terminase,portal	Staphylococcus_phage(16.67%)	53	NA	NA
WP_002297218.1|1876144_1877440_-|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
WP_002292825.1|1877650_1878271_-	DNA-directed RNA polymerase subunit delta	NA	NA	NA	NA	NA
WP_002296448.1|1878346_1878784_-	DUF1934 domain-containing protein	NA	NA	NA	NA	NA
WP_002295123.1|1878946_1879777_+	lipoate--protein ligase family protein	NA	NA	NA	NA	NA
WP_002295121.1|1879760_1881128_+	HD domain-containing protein	NA	A0A1B1ISR1	uncultured_Mediterranean_phage	32.3	1.5e-25
WP_002295119.1|1881146_1881956_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_002295117.1|1881998_1882442_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_002295115.1|1882575_1882947_+	VOC family protein	NA	NA	NA	NA	NA
WP_002295114.1|1883115_1883898_-	PhzF family phenazine biosynthesis protein	NA	NA	NA	NA	NA
WP_002296449.1|1883894_1884866_-	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_002296450.1|1884957_1886352_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_002295106.1|1886543_1887899_-	Trk family potassium uptake protein	NA	NA	NA	NA	NA
WP_002295103.1|1887928_1888564_-	V-type ATP synthase subunit D	NA	NA	NA	NA	NA
WP_002292842.1|1888570_1889947_-	V-type ATP synthase subunit B	NA	NA	NA	NA	NA
WP_002295101.1|1889939_1891721_-	V-type ATP synthase subunit A	NA	NA	NA	NA	NA
WP_002292844.1|1891742_1892054_-	V-type ATP synthase subunit F	NA	NA	NA	NA	NA
WP_002304547.1|1892043_1893030_-	V-type ATPase subunit	NA	NA	NA	NA	NA
WP_002296452.1|1893044_1893629_-	V-type sodium ATP synthase subunit E	NA	NA	NA	NA	NA
WP_002292848.1|1893649_1894120_-	V-type ATP synthase subunit K	NA	NA	NA	NA	NA
WP_002296453.1|1894138_1896142_-	V-type ATP synthase subunit I	NA	NA	NA	NA	NA
WP_002320976.1|1896128_1896461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002292852.1|1896797_1897517_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_002296455.1|1897815_1899714_-	fructose-bisphosphatase class III	NA	NA	NA	NA	NA
WP_002296456.1|1899876_1901139_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002295091.1|1901131_1902031_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.1e-23
WP_002296457.1|1902175_1903954_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_002290803.1|1904135_1904450_-	thioredoxin	NA	A0A1J0GW78	Streptomyces_phage	40.8	3.6e-15
WP_002296458.1|1904536_1906897_-	endonuclease MutS2	NA	Q94M10	Lactobacillus_phage	50.4	1.7e-24
WP_002295087.1|1907616_1908054_-	cell division protein ZapA	NA	NA	NA	NA	NA
WP_002296459.1|1908255_1909173_+	ribonuclease HIII	NA	NA	NA	NA	NA
WP_002295084.1|1909428_1910340_-	N-acetylmuramoyl-L-alanine amidase	NA	C8CHK8	Thermus_virus	41.1	5.3e-06
WP_002295080.1|1910742_1911321_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002296462.1|1911340_1912009_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	41.4	1.8e-35
WP_002296464.1|1912023_1913094_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002296465.1|1913264_1914629_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	25.7	9.3e-07
WP_002311258.1|1914625_1916185_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002296469.1|1916240_1918721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002301068.1|1918704_1919040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296471.1|1919053_1920088_-	DUF916 and DUF3324 domain-containing protein	NA	NA	NA	NA	NA
WP_002296472.1|1920177_1920858_-	WxL domain-containing protein	NA	NA	NA	NA	NA
WP_002296473.1|1921141_1922245_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_002296474.1|1922873_1923344_-	DUF4809 family protein	NA	NA	NA	NA	NA
WP_002296476.1|1923673_1925314_+	NAD-dependent malic enzyme	NA	NA	NA	NA	NA
WP_002296477.1|1925467_1926790_+	2-hydroxycarboxylate transporter family protein	NA	NA	NA	NA	NA
WP_002296478.1|1926857_1927292_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_079232062.1|1927356_1928196_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_002296481.1|1928937_1929564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296483.1|1929858_1930194_-|head	phage head closure protein	head	V5UQC7	Enterococcus_phage	35.6	4.7e-13
WP_002296484.1|1930180_1930465_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_002296485.1|1930520_1932044_-|capsid	phage major capsid protein	capsid	A0A1W6JPR8	Staphylococcus_phage	37.4	1.4e-48
WP_002296486.1|1932036_1933212_-|portal	phage portal protein	portal	A0A2H4J5A4	uncultured_Caudovirales_phage	35.6	3.2e-64
WP_002317249.1|1933215_1933401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296487.1|1933366_1935061_-|terminase	terminase large subunit	terminase	A0A2H4JBN3	uncultured_Caudovirales_phage	43.8	9.1e-129
>prophage 12
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	1967336	2010468	2907074	transposase,integrase,tRNA	Bacillus_phage(16.67%)	38	1968312:1968328	1993802:1993818
WP_000222572.1|1967336_1968290_+|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
1968312:1968328	attL	AAAAATAAAATTTTATT	NA	NA	NA	NA
WP_002289406.1|1968323_1969553_-	GTPase HflX	NA	NA	NA	NA	NA
WP_002289405.1|1969554_1970472_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_002289404.1|1970475_1971213_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	40.0	2.3e-12
WP_002289403.1|1971303_1971831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289402.1|1972010_1972604_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.6	8.9e-55
WP_002289401.1|1972707_1973193_-	gamma carbonic anhydrase family protein	NA	NA	NA	NA	NA
WP_002296291.1|1973345_1973543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002289400.1|1973637_1975398_-	multidrug efflux ABC transporter subunit EfrB	NA	W8CYL7	Bacillus_phage	28.6	2.5e-52
WP_002296290.1|1975394_1977125_-	multidrug efflux ABC transporter subunit EfrA	NA	W8CYL7	Bacillus_phage	27.6	2.1e-43
WP_002287947.1|1977517_1977730_+	DNA-dependent RNA polymerase auxiliary subunit epsilon family protein	NA	NA	NA	NA	NA
WP_002287948.1|1977731_1979411_+	ribonuclease J	NA	NA	NA	NA	NA
WP_002294067.1|1979664_1979865_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	71.2	3.7e-21
WP_001092058.1|1980392_1981055_-	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_001072201.1|1981563_1982295_+	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
WP_000067268.1|1982420_1983203_-	aminoglycoside nucleotidyltransferase ANT(9)-Ia	NA	NA	NA	NA	NA
WP_000361059.1|1983356_1983734_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002300187.1|1983740_1985633_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_002300186.1|1985629_1986715_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	1.2e-12
WP_002287951.1|1987451_1988105_-	HAD family phosphatase	NA	NA	NA	NA	NA
WP_002294071.1|1988094_1989408_-	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_002287953.1|1989717_1992363_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	42.9	4.0e-163
WP_002287954.1|1992755_1993403_-	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_002287955.1|1993975_1995187_-|tRNA	tRNA 4-thiouridine(8) synthase ThiI	tRNA	NA	NA	NA	NA
1993802:1993818	attR	AATAAAATTTTATTTTT	NA	NA	NA	NA
WP_002287956.1|1995202_1996345_-	cysteine desulfurase	NA	NA	NA	NA	NA
WP_002287957.1|1996509_1998231_-	septation ring formation regulator EzrA	NA	NA	NA	NA	NA
WP_002287958.1|1998429_1998990_-	haloacid dehalogenase	NA	A0A0H3UZF4	Geobacillus_virus	45.1	2.3e-28
WP_002287959.1|1999015_1999855_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_002287960.1|1999888_2000722_-	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_002287961.1|2000953_2001922_+	asparaginase	NA	NA	NA	NA	NA
WP_002287962.1|2002076_2002814_-	acyl-ACP thioesterase	NA	NA	NA	NA	NA
WP_002287963.1|2002829_2003663_-	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_002294080.1|2003864_2005193_-	aminopeptidase C	NA	R4TV59	Phaeocystis_globosa_virus	38.1	7.3e-73
WP_002296289.1|2005487_2005652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287965.1|2006282_2006912_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_002287966.1|2007025_2007400_-	iron-sulfur cluster biosynthesis family protein	NA	NA	NA	NA	NA
WP_086956687.1|2007608_2008770_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_002297218.1|2009172_2010468_+|transposase	ISL3-like element ISEfa11 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	20.9	2.1e-08
>prophage 13
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	2586094	2602990	2907074		Streptococcus_phage(92.86%)	19	NA	NA
WP_002297366.1|2586094_2586409_+	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	53.4	1.0e-25
WP_002297365.1|2586421_2586796_+	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	66.1	2.4e-34
WP_002297364.1|2586805_2587141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729284.1|2587223_2588564_+	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	65.2	1.5e-163
WP_002297358.1|2588641_2589316_+	zeta toxin family protein	NA	NA	NA	NA	NA
WP_002297357.1|2589308_2589473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002321810.1|2589548_2589983_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1S5SDW2	Streptococcus_phage	77.1	6.5e-63
WP_002297356.1|2589983_2590691_+	DNA cytosine methyltransferase	NA	A0A1S5SEK0	Streptococcus_phage	50.4	5.8e-53
WP_002297354.1|2590680_2590971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002297353.1|2591229_2592414_+	replication initiation factor domain-containing protein	NA	A0A1S5SEX3	Streptococcus_phage	61.6	2.9e-142
WP_002317225.1|2592410_2592548_+	DUF3789 domain-containing protein	NA	NA	NA	NA	NA
WP_002286940.1|2593293_2595204_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.8	7.1e-37
WP_033658092.1|2595307_2595532_+	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	83.8	1.2e-23
WP_002297350.1|2595544_2596048_+	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	59.9	9.2e-53
WP_002297349.1|2596107_2596497_+	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	68.3	3.9e-43
WP_010729283.1|2596483_2598931_+	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	75.9	0.0e+00
WP_002297347.1|2598935_2601059_+	hypothetical protein	NA	A0A1S5SF30	Streptococcus_phage	59.7	1.2e-181
WP_002297346.1|2601055_2602060_+	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	63.5	5.6e-118
WP_002297345.1|2602078_2602990_+	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	44.0	2.2e-65
>prophage 14
NZ_CP019988	Enterococcus faecium isolate 2014-VREF-63 chromosome, complete genome	2907074	2609193	2676140	2907074	transposase,integrase	Bacillus_phage(16.67%)	57	2632345:2632360	2665913:2665928
WP_077974289.1|2609193_2610273_+|transposase	IS30 family transposase	transposase	H7BUM7	unidentified_phage	34.4	4.6e-49
WP_002297337.1|2610590_2611934_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_059355941.1|2612067_2617995_-	YSIRK-type signal peptide-containing protein	NA	NA	NA	NA	NA
WP_002332818.1|2618611_2619046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297334.1|2619062_2620268_-	YSIRK-targeted surface antigen transcriptional regulator	NA	NA	NA	NA	NA
WP_002297333.1|2620961_2621348_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_002304825.1|2621441_2621633_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002311665.1|2622146_2622479_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297332.1|2622388_2622583_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_077828743.1|2622774_2622930_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_002297326.1|2624786_2626403_-	NusG domain II-containing protein	NA	NA	NA	NA	NA
WP_002317220.1|2626520_2626739_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297325.1|2626933_2627395_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.0	1.5e-12
WP_002304820.1|2627587_2627827_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_002297324.1|2627850_2629374_-	zinc ABC transporter substrate-binding protein AdcA	NA	NA	NA	NA	NA
WP_002322279.1|2629391_2629514_-	putative metal homeostasis protein	NA	NA	NA	NA	NA
WP_002304819.1|2629543_2630527_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_002297320.1|2630550_2630700_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_002297319.1|2630720_2631098_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002297318.1|2631129_2631309_-	50S ribosomal protein L32	NA	NA	NA	NA	NA
WP_002297316.1|2631323_2631593_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_031316216.1|2632115_2633882_-	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	29.1	3.5e-30
2632345:2632360	attL	ATACGTTTTTCATTTT	NA	NA	NA	NA
WP_002302406.1|2633841_2635596_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.8	1.3e-24
WP_002302405.1|2635705_2636275_-	MptD family putative ECF transporter S component	NA	NA	NA	NA	NA
WP_002303655.1|2636292_2637708_-	energy-coupling factor ABC transporter ATP-binding protein	NA	A0A1V0SGN0	Hokovirus	26.4	5.8e-20
WP_010729275.1|2637718_2638387_-	cobalt ABC transporter permease	NA	NA	NA	NA	NA
WP_074394433.1|2638516_2639101_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002297302.1|2639431_2639665_-	iron-dependent repressor	NA	NA	NA	NA	NA
WP_010729812.1|2639679_2640630_-	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_010729271.1|2640626_2641469_-	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_010729270.1|2641470_2642190_-	metal ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	32.7	1.6e-18
WP_074394656.1|2642881_2643040_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010729268.1|2643111_2644338_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_002287505.1|2644425_2644818_-	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_002295975.1|2644833_2645277_-	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_002297290.1|2645795_2646263_-	DNA starvation/stationary phase protection protein	NA	NA	NA	NA	NA
WP_002288118.1|2646382_2647921_-	gluconokinase	NA	NA	NA	NA	NA
WP_002288144.1|2648000_2648687_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_002288119.1|2648887_2649415_-	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_002288121.1|2649498_2650176_-	beta-phosphoglucomutase	NA	A0A1D8KNV9	Synechococcus_phage	23.2	1.6e-07
WP_002288122.1|2650172_2651303_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	51.6	1.6e-73
WP_002288124.1|2651302_2653486_-	glycoside hydrolase family 65 protein	NA	NA	NA	NA	NA
WP_002288127.1|2653482_2654508_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_002288129.1|2654552_2655380_-	sugar phosphate isomerase/epimerase	NA	NA	NA	NA	NA
WP_002288131.1|2655376_2656444_-	zinc-binding alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_002288133.1|2656469_2657306_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002288134.1|2657302_2658172_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002288135.1|2658241_2659525_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002303706.1|2659538_2661224_-	sucrose phosphorylase	NA	NA	NA	NA	NA
WP_002288139.1|2661498_2662524_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002288141.1|2663118_2666793_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.9	6.5e-63
2665913:2665928	attR	ATACGTTTTTCATTTT	NA	NA	NA	NA
WP_002295964.1|2666850_2670468_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.7	1.5e-48
WP_002289394.1|2671195_2672164_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_002289390.1|2672181_2673087_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_002289388.1|2673083_2673890_+	ATP-binding cassette domain-containing protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.1	1.3e-08
WP_002304811.1|2674025_2675015_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_001015311.1|2675459_2676140_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 1
NZ_CP019989	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence	287502	4590	34890	287502	transposase,protease	Streptococcus_phage(41.67%)	40	NA	NA
WP_002323245.1|4590_5763_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001015311.1|5847_6528_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_010729835.1|6873_7140_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	48.8	8.6e-18
WP_010729836.1|7141_7363_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_002360989.1|7588_8407_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_002320793.1|8410_8707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010729838.1|8888_9242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730992.1|9261_10317_-	ParM/StbA family protein	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	31.7	4.0e-42
WP_010730993.1|10532_10931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320797.1|10933_11107_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320797.1|13079_13253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730993.1|13255_13654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730992.1|13869_14925_+	ParM/StbA family protein	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	31.7	4.0e-42
WP_010729838.1|14944_15298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002320793.1|15479_15776_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002360989.1|15779_16598_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_010729836.1|16823_17045_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_010729835.1|17046_17313_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5S8E8	Streptococcus_phage	48.8	8.6e-18
WP_001015311.1|17658_18339_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002323245.1|18423_19596_-|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001280781.1|19747_20443_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002305818.1|20420_21575_+	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001059542.1|21789_22758_+	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_001079845.1|22750_23782_+	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_000402347.1|23787_24396_+	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_001015311.1|24571_25252_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_060799120.1|25747_26719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350566.1|26838_27096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320840.1|27098_27329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350567.1|27505_28555_-	C39 family peptidase	NA	NA	NA	NA	NA
WP_002350568.1|28733_28988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016922247.1|29177_29393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060799117.1|29444_30359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060799116.1|30358_31258_-	RusA family crossover junction endodeoxyribonuclease	NA	NA	NA	NA	NA
WP_002350572.1|31257_31845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042957131.1|32079_32508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350574.1|32612_32807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060799115.1|32879_33782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350576.1|33798_34275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016922336.1|34290_34890_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP019989	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence	287502	62977	183120	287502	transposase,protease	Streptococcus_phage(31.82%)	107	NA	NA
WP_002323589.1|62977_64126_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002287522.1|64142_64547_-|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002320766.1|65056_67027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320767.1|67041_67908_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320768.1|67897_68131_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_002347429.1|68142_70299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347431.1|70649_70988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347432.1|71387_75029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010730985.1|75031_76981_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2I7REQ1	Vibrio_phage	24.7	2.9e-30
WP_002321771.1|77022_78081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320776.1|78199_78655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320777.1|79238_80042_-	replication initiation protein	NA	NA	NA	NA	NA
WP_025480441.1|80999_82223_+	RepB family plasmid replication initiator protein	NA	NA	NA	NA	NA
WP_010729833.1|82257_83025_+	replication initiation protein	NA	NA	NA	NA	NA
WP_002320781.1|83216_83615_+	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_002287522.1|83834_84239_+|transposase	IS200/IS605-like element ISEfa4 family transposase	transposase	A0A286QN76	Streptococcus_phage	73.8	1.3e-52
WP_002323589.1|84255_85404_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A288TXV8	Enterococcus_phage	93.7	9.0e-205
WP_002347532.1|85812_86187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002350538.1|86208_86586_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002320784.1|86575_86971_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0C5AN56	Paenibacillus_phage	39.7	4.1e-16
WP_002320785.1|87037_87223_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0A7RWW9	Clostridium_phage	40.4	7.6e-05
WP_002347534.1|87304_87559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347535.1|87580_87817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347536.1|87832_88117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347537.1|88219_88402_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|88634_89315_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_154067205.1|89441_90767_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_002325566.1|90766_91519_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	36.5	3.2e-41
WP_002293722.1|91701_92277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002293724.1|93064_93637_+	HAD-IIIA family hydrolase	NA	NA	NA	NA	NA
WP_000017403.1|93829_94393_+	recombinase family protein	NA	A0A219Y9V9	Aeromonas_phage	46.4	2.3e-36
WP_000312841.1|94671_94959_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000629052.1|94948_95278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000754864.1|95582_95912_+	helix-turn-helix transcriptional regulator	NA	E4ZFI8	Streptococcus_phage	44.6	2.6e-16
WP_000516404.1|96198_96684_-	glycopeptide resistance protein VanZ-A	NA	NA	NA	NA	NA
WP_001812592.1|96836_97748_-	D-Ala-D-Ala carboxypeptidase VanY-A	NA	NA	NA	NA	NA
WP_001015311.1|98042_98723_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000402347.1|98898_99507_-	D-Ala-D-Ala dipeptidase VanX-A	NA	NA	NA	NA	NA
WP_001079845.1|99512_100544_-	D-alanine--(R)-lactate ligase VanA	NA	NA	NA	NA	NA
WP_001059542.1|100536_101505_-	D-lactate dehydrogenase VanH-A	NA	M1HUW8	Acanthocystis_turfacea_Chlorella_virus	33.1	3.5e-40
WP_002305818.1|101719_102874_-	VanA-type vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	23.3	1.5e-13
WP_001280781.1|102851_103547_-	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	4.9e-36
WP_002323245.1|103698_104871_+|transposase	IS256-like element IS1542 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	88.8	1.3e-121
WP_001015311.1|104955_105636_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002301128.1|106066_107062_-	tagatose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_002301130.1|107077_108247_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_002301131.1|108262_108997_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086956687.1|109767_110930_-|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	51.3	1.6e-79
WP_086953915.1|111187_112526_+|transposase	IS3-like element ISEnfa3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.7	2.6e-78
WP_002301811.1|112917_114210_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	41.0	6.1e-32
WP_002313174.1|114483_114744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002346943.1|114994_116173_+|transposase	IS256-like element ISEf1 family transposase	transposase	A0A220NQR7	Corynebacterium_phage	25.3	4.0e-30
WP_073120200.1|116524_116821_+|transposase	IS3 family transposase	transposase	A0A0C5AEB1	Paenibacillus_phage	59.2	6.7e-19
WP_002287876.1|117769_118165_-	aspartate 1-decarboxylase	NA	NA	NA	NA	NA
WP_002287875.1|118174_119023_-	pantoate--beta-alanine ligase	NA	NA	NA	NA	NA
WP_002287874.1|119037_119865_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_002349114.1|119876_120737_-	Rossmann-like and DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_002300493.1|120974_122144_+|transposase	IS256 family transposase	transposase	NA	NA	NA	NA
WP_001015311.1|122483_123164_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000195429.1|123793_124966_+|transposase	IS256-like element IS256 family transposase	transposase	A0A0N9STL0	Staphylococcus_phage	100.0	3.5e-135
WP_002303110.1|126796_127834_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	28.5	7.1e-07
WP_002303111.1|127830_128343_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_002303113.1|129342_129894_-	DUF334 domain-containing protein	NA	NA	NA	NA	NA
WP_002319817.1|130438_131119_+|transposase	IS6-like element ISS1N family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	84.1	2.5e-109
WP_002321606.1|131378_131984_+	recombinase family protein	NA	A0A219YA40	Aeromonas_phage	33.2	1.2e-19
WP_000824191.1|132028_132196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000366408.1|132229_132529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001224538.1|132569_133187_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	33.1	5.1e-13
WP_002304891.1|133511_133907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344083.1|133986_136338_-	DUF1906 domain-containing protein	NA	NA	NA	NA	NA
WP_002297185.1|136563_137859_+|transposase	ISL3-like element ISEfa5 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	29.8	5.3e-44
WP_000751236.1|138688_139141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002325565.1|139271_139952_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	1.3e-126
WP_002300494.1|140053_141373_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002285815.1|141369_142023_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.2	4.0e-24
WP_010729371.1|142310_143585_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	36.6	1.2e-56
WP_032494987.1|143639_145205_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.6	2.4e-19
WP_002285758.1|145338_145533_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|145522_145876_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|145977_147525_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002288609.1|147916_148849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002288608.1|148888_150550_-	hyaluronate lyase	NA	NA	NA	NA	NA
WP_002305865.1|150546_153528_-	glycoside hydrolase family 42	NA	L0N6M2	Herpes_simplex_virus	28.8	2.2e-122
WP_002304880.1|153655_155569_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_002304878.1|155598_156210_-	DUF624 domain-containing protein	NA	NA	NA	NA	NA
WP_010729380.1|156260_157733_-	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_002289655.1|157756_158668_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_002304874.1|158679_159618_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002340467.1|159846_161421_+	histidine kinase	NA	Q9EYF3	Enterobacteria_phage	30.0	9.4e-11
WP_002302980.1|161398_162127_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010729381.1|162509_163784_-|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	35.9	9.5e-54
WP_002299919.1|165377_165707_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	NA	NA	NA	NA
WP_002299921.1|165696_165969_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_002299923.1|166419_167223_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_002299925.1|167200_168325_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.2	1.0e-22
WP_002299926.1|168340_169156_-	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_014748799.1|169145_170036_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_002299928.1|170102_171392_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_060804897.1|172740_174219_-|transposase	IS1182-like element ISEfa7 family transposase	transposase	A0A1X9I5T2	Streptococcus_phage	48.2	5.3e-125
WP_077974474.1|174208_175408_-|transposase	IS256 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	24.7	1.3e-25
WP_002298085.1|175537_176914_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_002298083.1|176913_177570_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.1	1.3e-22
WP_002301194.1|177579_178857_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_087121905.1|179106_180268_+|transposase	IS3 family transposase	transposase	A0A2I7SC85	Paenibacillus_phage	54.2	4.1e-80
WP_010729386.1|180298_180748_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_002298088.1|180903_181446_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331383.1|182439_183120_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
>prophage 3
NZ_CP019989	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-1, complete sequence	287502	198931	246215	287502	holin,transposase	Streptococcus_phage(40.0%)	51	NA	NA
WP_002301399.1|198931_199891_-|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.5	5.0e-31
WP_010729754.1|200440_201349_+|transposase	IS982 family transposase	transposase	NA	NA	NA	NA
WP_010729753.1|201407_203210_-	3'-5' exoribonuclease	NA	A0A0A7RWA3	Clostridium_phage	30.4	7.6e-33
WP_002342384.1|203272_204115_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002331328.1|204130_204352_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002336713.1|204847_205528_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.1	5.8e-127
WP_002339142.1|205585_206806_-	PAS domain-containing protein	NA	A0A2P0ZL82	Lactobacillus_phage	58.5	3.9e-57
WP_002339141.1|206825_207437_-	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	53.2	1.7e-56
WP_002350224.1|207479_208412_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_002350223.1|208832_209693_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002322961.1|210558_210726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002298077.1|210758_212159_-	putative basic amino acid antiporter YfcC	NA	NA	NA	NA	NA
WP_002296840.1|212693_213881_+|transposase	IS256-like element IS16 family transposase	transposase	A0A0K2CZ57	Paenibacillus_phage	46.3	8.2e-92
WP_002288620.1|213938_215180_-	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_010729750.1|215215_215926_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_002288615.1|215993_216809_-	fructoselysine 6-kinase	NA	NA	NA	NA	NA
WP_002336724.1|216819_217788_-	SIS domain-containing protein	NA	NA	NA	NA	NA
WP_010729749.1|218550_219843_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	37.5	3.9e-55
WP_002285758.1|219921_220116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002287659.1|220105_220459_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	38.7	5.7e-17
WP_002296127.1|220560_222108_+|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	28.9	1.7e-44
WP_002302440.1|222333_223635_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002389879.1|223813_224083_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A1S5SCV8	Streptococcus_phage	48.8	8.7e-18
WP_014748823.1|224072_224339_-	antitoxin	NA	NA	NA	NA	NA
WP_077974475.1|224407_224635_-	ADP-ribosylglycohydrolase family protein	NA	NA	NA	NA	NA
WP_010729807.1|224839_225472_-	HAD family phosphatase	NA	A0A1D8KNV9	Synechococcus_phage	27.9	3.0e-08
WP_077974489.1|225484_227275_-	PRD domain-containing protein	NA	NA	NA	NA	NA
WP_010861579.1|227499_228180_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	98.7	2.9e-126
WP_002299575.1|228368_228953_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	51.7	5.9e-43
WP_002299573.1|229163_229367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303116.1|229376_229799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001261742.1|230036_230651_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.9	3.8e-16
WP_001809248.1|230815_231640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347142.1|231663_231819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000588503.1|232277_232535_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_000388479.1|232527_232797_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_001120991.1|232927_233107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002303117.1|233487_234195_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002300851.1|234187_234625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002296238.1|234639_234891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002347218.1|234890_235097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002295623.1|235533_235794_-	hypothetical protein	NA	A0A0S2MYI8	Enterococcus_phage	51.4	1.2e-11
WP_002316074.1|235868_236072_+|holin	putative holin-like toxin	holin	NA	NA	NA	NA
WP_002303313.1|236212_236698_-	single-stranded DNA-binding protein	NA	W6LM61	Streptococcus_phage	59.3	5.8e-44
WP_002303312.1|236700_237600_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_002303311.1|237612_238206_-	type IV toxin-antitoxin system AbiEi family antitoxin domain-containing protein	NA	NA	NA	NA	NA
WP_002303309.1|238281_238431_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002305772.1|238446_240651_-	type IA DNA topoisomerase	NA	A0A1X9I6W8	Streptococcus_phage	50.7	6.1e-117
WP_002347152.1|240661_242122_-	toprim domain-containing protein	NA	NA	NA	NA	NA
WP_002305801.1|242182_244555_-	hypothetical protein	NA	B5SP25	Lactococcus_phage	29.7	3.4e-12
WP_002297404.1|244964_246215_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	63.3	4.0e-113
>prophage 1
NZ_CP019990	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-2, complete sequence	25791	4502	18414	25791	transposase	Streptococcus_phage(40.0%)	17	NA	NA
WP_002302440.1|4502_5804_+|transposase	ISL3 family transposase	transposase	A0A1S5SBP9	Streptococcus_phage	33.6	1.6e-48
WP_002349227.1|6241_6454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000357244.1|6615_7134_+	YfbU family protein	NA	NA	NA	NA	NA
WP_000774078.1|7140_7653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002288897.1|7923_8547_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	30.1	1.8e-13
WP_001015311.1|8642_9323_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_000599739.1|9492_10098_+	cell filamentation protein	NA	NA	NA	NA	NA
WP_002303206.1|10113_10686_+	recombinase family protein	NA	A0A1J1J8Z4	Escherichia_phage	46.0	6.8e-36
WP_073120187.1|11041_11614_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	57.1	5.0e-55
WP_001015311.1|12288_12969_-|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
WP_002322130.1|13129_13384_-|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	50.0	4.1e-09
WP_000199136.1|13494_13749_-|transposase	transposase	transposase	A0A1P8CWP5	Bacillus_phage	47.6	2.1e-13
WP_001196543.1|13941_14217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429439.1|14188_15142_-	ParA family protein	NA	F0PIG8	Enterococcus_phage	26.1	7.7e-16
WP_000947691.1|15753_17247_+	primase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_002347145.1|17381_17696_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001015311.1|17733_18414_+|transposase	IS6-like element IS1216 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	99.6	1.5e-127
>prophage 1
NZ_CP019991	Enterococcus faecium isolate 2014-VREF-63 plasmid p63-3	18099	7750	16803	18099		Bacillus_phage(100.0%)	10	NA	NA
WP_060797271.1|7750_8587_-	hypothetical protein	NA	Q9FZW4	Bacillus_phage	42.2	1.9e-26
WP_079232081.1|8576_9557_-	hypothetical protein	NA	B7SSN1	Bacillus_phage	47.3	1.5e-70
WP_079232082.1|9571_11386_-	hypothetical protein	NA	A0A222YXM6	Bacillus_phage	36.3	2.0e-97
WP_079232083.1|11397_12726_-	hypothetical protein	NA	A0A222YZ89	Bacillus_phage	46.4	3.7e-85
WP_079232084.1|12738_13029_-	hypothetical protein	NA	A0A142IG87	Bacillus_phage	34.4	1.1e-05
WP_154067208.1|13294_13465_-	hypothetical protein	NA	NA	NA	NA	NA
WP_154067209.1|13477_15202_-	hypothetical protein	NA	A0A142IG82	Bacillus_phage	55.7	5.9e-192
WP_079232086.1|15195_16041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079232087.1|16125_16497_-	hypothetical protein	NA	A0A222YYM6	Bacillus_phage	31.9	9.3e-10
WP_079232088.1|16536_16803_-	hypothetical protein	NA	A0A142IG86	Bacillus_phage	39.0	8.4e-05
