The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	256863	264815	5790408		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|256863_257148_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_079244990.1|257187_258822_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	57.8	1.0e-156
WP_000743908.1|259228_260767_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.8e-22
WP_000833094.1|261153_262479_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.5	7.1e-44
WP_079244991.1|262624_263326_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.9	1.2e-39
WP_079244992.1|263309_264815_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.5	1.3e-30
>prophage 2
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	294145	302521	5790408		Synechococcus_phage(33.33%)	8	NA	NA
WP_000625687.1|294145_295453_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	1.1e-20
WP_001170545.1|295541_296261_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|296253_296508_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666782.1|296504_297188_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_079244996.1|297171_299391_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.0	4.4e-163
WP_000879026.1|299375_300791_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.4	3.3e-55
WP_001262424.1|300896_301937_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	46.3	5.5e-68
WP_000088578.1|301933_302521_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	7.0e-28
>prophage 3
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	1140005	1179149	5790408	protease,bacteriocin,tail,plate,head,portal,terminase,capsid	Bacillus_phage(46.51%)	50	NA	NA
WP_016097899.1|1140005_1141784_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.1	3.5e-22
WP_016097900.1|1141814_1143218_-	recombinase family protein	NA	A0A2I7SDG6	Paenibacillus_phage	44.8	3.1e-114
WP_000289676.1|1143330_1143549_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079245173.1|1143564_1144248_-	LexA family transcriptional regulator	NA	A0A2I6PF08	Staphylococcus_phage	29.4	1.4e-16
WP_016097902.1|1144398_1144671_+	helix-turn-helix transcriptional regulator	NA	A0A141E0W0	Streptococcus_phage	50.0	2.3e-10
WP_000651465.1|1145137_1145368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000959062.1|1145369_1145582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079245174.1|1145636_1145987_+	hypothetical protein	NA	A0A2H4JGP5	uncultured_Caudovirales_phage	74.1	2.8e-40
WP_079245175.1|1146011_1146659_+	sigma-70 family RNA polymerase sigma factor	NA	W8CYN8	Bacillus_phage	87.4	2.9e-99
WP_000636796.1|1146719_1146986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000023094.1|1147147_1147435_+	hypothetical protein	NA	A0A2H4J830	uncultured_Caudovirales_phage	48.9	3.5e-17
WP_079245176.1|1147412_1147961_+	hypothetical protein	NA	A0A2H4JFP8	uncultured_Caudovirales_phage	91.2	2.3e-89
WP_079245177.1|1147963_1148218_+	hypothetical protein	NA	A0A2H4JG95	uncultured_Caudovirales_phage	92.6	4.2e-38
WP_079245178.1|1148220_1149153_+	AAA family ATPase	NA	A0A2H4JFH2	uncultured_Caudovirales_phage	95.1	1.8e-163
WP_079245179.1|1149152_1149587_+	DUF669 domain-containing protein	NA	Q9ZXC5	Bacillus_phage	66.9	1.3e-50
WP_079245180.1|1149656_1152044_+	DNA primase	NA	A0A2H4JEX8	uncultured_Caudovirales_phage	94.8	0.0e+00
WP_079245181.1|1152336_1152708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245182.1|1152708_1153143_+	hypothetical protein	NA	A0A2H4J832	uncultured_Caudovirales_phage	95.1	2.5e-75
WP_079245183.1|1153143_1153683_+	nuclease	NA	A0A2H4J819	uncultured_Caudovirales_phage	90.5	1.2e-87
WP_016097914.1|1153716_1154154_+	hypothetical protein	NA	A0A2H4JBP0	uncultured_Caudovirales_phage	95.2	1.3e-71
WP_042596414.1|1154226_1154418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245184.1|1154601_1154997_+	sigma-70 family RNA polymerase sigma factor	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	89.3	2.0e-58
WP_079246249.1|1155262_1155466_+	hypothetical protein	NA	A0A1C8E9B9	Bacillus_phage	83.1	2.0e-22
WP_079245185.1|1155506_1155848_+	hypothetical protein	NA	A0A1C8E9B7	Bacillus_phage	93.8	1.2e-56
WP_079245186.1|1155972_1156296_+	hypothetical protein	NA	A0A2H4J758	uncultured_Caudovirales_phage	50.0	1.0e-20
WP_079245187.1|1156292_1156658_+	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	63.6	9.0e-42
WP_000101699.1|1156777_1157212_+	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	95.1	8.7e-68
WP_079245188.1|1157208_1158933_+|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	96.3	0.0e+00
WP_000523160.1|1158948_1160154_+|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	94.5	4.1e-216
WP_079245189.1|1160122_1160701_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	82.0	9.5e-86
WP_079245190.1|1160702_1162076_+|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	77.2	5.3e-151
WP_000998745.1|1162079_1162340_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	93.0	1.3e-39
WP_079245191.1|1162314_1162650_+	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	95.4	5.2e-52
WP_079245192.1|1162639_1162969_+	hypothetical protein	NA	A0A1B0T6B7	Bacillus_phage	96.3	3.8e-55
WP_079245193.1|1162968_1163346_+	HK97 gp10 family phage protein	NA	A0A1C8E995	Bacillus_phage	96.8	4.8e-62
WP_079245194.1|1163357_1163993_+|tail	phage tail protein	tail	A0A1B1P7Q4	Bacillus_phage	99.1	3.3e-116
WP_079245195.1|1164004_1164391_+	hypothetical protein	NA	A0A1B1P7Q6	Bacillus_phage	99.2	9.5e-66
WP_006927278.1|1164429_1164618_+	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_079245196.1|1164634_1168513_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	72.3	3.9e-252
WP_070184119.1|1168514_1169198_+|tail	phage tail protein	tail	A0A1B1P7Q0	Bacillus_phage	99.1	4.8e-129
WP_145953779.1|1169194_1171537_+	endopeptidase	NA	A0A1B1P7P0	Bacillus_phage	99.0	0.0e+00
WP_079245197.1|1171551_1172820_+|plate	BppU family phage baseplate upper protein	plate	A0A1B0T696	Bacillus_phage	92.7	3.9e-225
WP_000392439.1|1172882_1173113_+|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	100.0	5.7e-34
WP_079245198.1|1173109_1174162_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	97.1	5.7e-198
WP_079245199.1|1174340_1174670_-	hypothetical protein	NA	A0A1C8E989	Bacillus_phage	79.8	2.3e-36
WP_079245200.1|1174808_1175027_+	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	95.8	3.0e-32
WP_079245201.1|1175050_1175344_+	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	88.7	9.4e-42
WP_079245202.1|1175360_1176185_-	cytosolic protein	NA	A0A2H4J969	uncultured_Caudovirales_phage	89.7	3.9e-133
WP_000159538.1|1176663_1177623_+	ferrochelatase	NA	NA	NA	NA	NA
WP_001069166.1|1177682_1179149_+	catalase	NA	A0A2K9L572	Tupanvirus	47.8	1.7e-123
>prophage 4
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	1406984	1491426	5790408	protease,tail,plate,head,holin,portal,terminase,capsid,integrase	Bacillus_phage(79.63%)	102	1457252:1457271	1493520:1493539
WP_079245241.1|1406984_1408871_-	LTA synthase family protein	NA	W6LM83	Streptococcus_phage	34.1	1.1e-85
WP_079245242.1|1409066_1410176_-|integrase	site-specific integrase	integrase	A0A0U3U8Y8	Bacillus_phage	76.2	1.6e-142
WP_079245243.1|1410601_1410946_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P888	Bacillus_phage	43.8	3.5e-19
WP_029437996.1|1411470_1412610_+	hypothetical protein	NA	H0UST6	Bacillus_phage	37.1	8.4e-62
WP_155417052.1|1412900_1413053_+	hypothetical protein	NA	A0A0A7AQZ6	Bacillus_phage	74.0	5.2e-12
WP_079245244.1|1413059_1413407_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AR52	Bacillus_phage	93.0	5.0e-50
WP_033694466.1|1413581_1413800_+	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV9	Bacillus_phage	90.3	4.7e-30
WP_079245245.1|1413859_1414534_+	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	52.2	1.2e-58
WP_029438000.1|1414571_1414847_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	86.5	2.1e-35
WP_079245248.1|1415258_1416083_+	replication protein	NA	V5UQV4	Oenococcus_phage	41.0	1.8e-42
WP_016123366.1|1416021_1416897_+	ATP-binding protein	NA	Q2I8C8	Bacillus_phage	47.2	4.3e-66
WP_079245249.1|1416912_1417107_+	hypothetical protein	NA	A0A1B1P7U7	Bacillus_phage	76.6	1.5e-19
WP_079245250.1|1417123_1417534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245251.1|1417747_1418233_-	DUF2321 domain-containing protein	NA	A0A1Q1PVY6	Staphylococcus_phage	53.6	5.0e-40
WP_079245252.1|1418322_1418601_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	62.7	1.8e-13
WP_079245253.1|1418593_1418953_+	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	53.4	3.2e-31
WP_050842983.1|1418973_1419138_+	DUF3954 domain-containing protein	NA	A0A1B0T6B8	Bacillus_phage	57.7	4.1e-10
WP_023522896.1|1419166_1419418_+	hypothetical protein	NA	A0A0K2CNP4	Brevibacillus_phage	42.2	8.4e-07
WP_079245254.1|1419437_1419947_+	dUTPase	NA	A0A1L2JY27	Aeribacillus_phage	44.9	3.9e-27
WP_072190986.1|1420134_1420344_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245255.1|1420359_1420740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245256.1|1421012_1421405_+	hypothetical protein	NA	A0A0S2MVH4	Bacillus_phage	69.6	3.2e-29
WP_016077632.1|1421441_1421831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245257.1|1421867_1422848_+	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	61.5	2.5e-118
WP_079245258.1|1423617_1423848_-	CGEA protein	NA	NA	NA	NA	NA
WP_079246255.1|1424208_1424433_+	hypothetical protein	NA	I7J6W4	Bacillus_phage	77.0	2.1e-25
WP_079245259.1|1424467_1425064_+	hypothetical protein	NA	A0A0F6SJ62	Sinorhizobium_phage	31.8	9.0e-15
WP_079245260.1|1425093_1425324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245261.1|1425432_1425783_+	hypothetical protein	NA	A0A1B1P8B5	Bacillus_phage	38.8	2.8e-08
WP_049106871.1|1425812_1425935_+	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
WP_079245263.1|1426241_1426712_+	ArpU family transcriptional regulator	NA	A0A1B1P744	Bacillus_phage	62.5	1.3e-48
WP_079245264.1|1426708_1427251_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P746	Bacillus_phage	98.9	1.6e-95
WP_021727596.1|1427854_1428046_+	hypothetical protein	NA	Q2I8B4	Bacillus_phage	82.5	1.3e-20
WP_079245265.1|1428045_1428540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953850.1|1428529_1428754_+	hypothetical protein	NA	A0A1B1P745	Bacillus_phage	81.1	1.8e-24
WP_079245267.1|1428760_1429057_+	hypothetical protein	NA	Q2I8B8	Bacillus_phage	55.6	1.6e-09
WP_021727591.1|1429207_1429453_+	hypothetical protein	NA	A0A288WG15	Bacillus_phage	61.7	7.9e-18
WP_079246256.1|1429566_1429761_+	HNH endonuclease	NA	A0A1B1P757	Bacillus_phage	90.6	2.1e-29
WP_021727589.1|1429763_1430072_+	hypothetical protein	NA	A0A1B1P767	Bacillus_phage	90.4	1.6e-44
WP_061685182.1|1430179_1430500_+	hypothetical protein	NA	A0A1B1P762	Bacillus_phage	84.9	5.5e-43
WP_079245268.1|1430483_1432166_+|terminase	terminase large subunit	terminase	A0A1B1P766	Bacillus_phage	94.3	1.8e-310
WP_079245269.1|1432180_1433347_+|portal	phage portal protein	portal	A0A1B1P754	Bacillus_phage	93.2	1.0e-208
WP_079246257.1|1433492_1434053_+|protease	Clp protease ClpP	protease	A0A0U4B047	Bacillus_phage	49.5	4.2e-38
WP_079245270.1|1434094_1435258_+|capsid	phage major capsid protein	capsid	A0A1B1P752	Bacillus_phage	42.9	2.8e-84
WP_076775023.1|1435398_1435695_+	hypothetical protein	NA	A0A1B1P751	Bacillus_phage	99.0	6.8e-48
WP_079245271.1|1435675_1436032_+|head	phage head closure protein	head	A0A1B1P760	Bacillus_phage	94.9	5.7e-57
WP_079246258.1|1436048_1436426_+	hypothetical protein	NA	A0A1B1P759	Bacillus_phage	96.0	2.6e-60
WP_033707118.1|1436412_1436841_+	hypothetical protein	NA	A0A1B1P769	Bacillus_phage	95.1	3.2e-70
WP_079245272.1|1436842_1437427_+|tail	phage tail protein	tail	A0A1B1P778	Bacillus_phage	84.5	6.8e-92
WP_079245273.1|1437496_1437958_+	hypothetical protein	NA	A0A1B1P772	Bacillus_phage	93.5	1.7e-74
WP_159451453.1|1437984_1438122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245274.1|1438136_1439750_+	hypothetical protein	NA	A0A1B1P775	Bacillus_phage	89.9	4.1e-110
WP_079245275.1|1439964_1443060_+	hypothetical protein	NA	A0A1B1P764	Bacillus_phage	79.9	1.8e-186
WP_079245276.1|1443061_1443745_+|tail	phage tail protein	tail	A0A1B1P761	Bacillus_phage	98.2	2.9e-126
WP_079245277.1|1443744_1446150_+	endopeptidase	NA	A0A1B1P770	Bacillus_phage	98.1	0.0e+00
WP_079245278.1|1446164_1447436_+|plate	BppU family phage baseplate upper protein	plate	A0A1B1P7N9	Bacillus_phage	95.0	1.1e-230
WP_145953782.1|1447558_1448518_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0S2GLC8	Bacillus_phage	96.2	1.9e-176
WP_000373869.1|1448533_1448959_+|holin	phage holin family protein	holin	A0A1B1P787	Bacillus_phage	99.3	9.7e-72
WP_079245280.1|1448958_1449894_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	97.7	5.5e-184
WP_079245281.1|1450967_1451234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050843053.1|1451249_1451441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001228823.1|1452001_1452397_+	DUF3888 domain-containing protein	NA	NA	NA	NA	NA
WP_079245282.1|1452848_1454165_+	diaminopimelate decarboxylase	NA	NA	NA	NA	NA
WP_000116158.1|1454460_1454604_+	YezD family protein	NA	NA	NA	NA	NA
WP_079245283.1|1454691_1455396_+	phosphoadenylyl-sulfate reductase	NA	NA	NA	NA	NA
WP_000108784.1|1455434_1456571_+	sulfate adenylyltransferase	NA	A0A2K9L0F0	Tupanvirus	29.7	1.2e-44
WP_000380490.1|1456583_1457195_+	adenylyl-sulfate kinase	NA	NA	NA	NA	NA
1457252:1457271	attL	TGATTAAAGTTTCACTTTAT	NA	NA	NA	NA
WP_000119600.1|1457287_1458910_+	ferredoxin--nitrite reductase	NA	NA	NA	NA	NA
WP_000424930.1|1458920_1459121_+	DUF3906 family protein	NA	NA	NA	NA	NA
WP_000521277.1|1459207_1459984_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_079245284.1|1459985_1460738_+	sirohydrochlorin chelatase	NA	NA	NA	NA	NA
WP_000283361.1|1460712_1461327_+	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_000665434.1|1461751_1463107_+	sodium-dependent transporter	NA	NA	NA	NA	NA
WP_000726091.1|1463392_1464667_-	M23 family metallopeptidase	NA	A0A2D0ZM66	Rhodococcus_phage	36.5	2.0e-11
WP_000821134.1|1465161_1466436_+	glutamate/aspartate:proton symporter GltP	NA	NA	NA	NA	NA
WP_000824630.1|1466504_1467023_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_000665498.1|1467343_1468660_+	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_079245285.1|1468841_1469198_+	flagellar basal body rod protein	NA	NA	NA	NA	NA
WP_000814131.1|1469245_1469908_+	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000716094.1|1470015_1470756_+	cell wall-active antibiotics response protein	NA	NA	NA	NA	NA
WP_079245286.1|1470755_1471811_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000598702.1|1471807_1472440_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_118961699.1|1472497_1472836_+	DUF3922 domain-containing protein	NA	NA	NA	NA	NA
WP_079245287.1|1472860_1474207_-	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_000880630.1|1474794_1475004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245288.1|1475044_1475821_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000677057.1|1475929_1476781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053359.1|1476979_1477177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000794496.1|1477325_1478423_+|protease	site-2 protease family protein	protease	NA	NA	NA	NA
WP_000735433.1|1478537_1479056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000947319.1|1479215_1480424_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000600585.1|1480456_1480969_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_000882911.1|1481139_1481367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245289.1|1481660_1482461_-	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_000380276.1|1482578_1483577_-	inorganic phosphate transporter	NA	NA	NA	NA	NA
WP_000231445.1|1483588_1484209_-	DUF47 domain-containing protein	NA	NA	NA	NA	NA
WP_079245290.1|1484520_1486563_+	PBP1A family penicillin-binding protein	NA	NA	NA	NA	NA
WP_001265587.1|1486643_1487072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063675147.1|1488102_1489368_-	PAS domain-containing protein	NA	W8CYF6	Bacillus_phage	24.5	1.3e-15
WP_000897362.1|1489519_1490365_+	DUF72 domain-containing protein	NA	NA	NA	NA	NA
WP_001094856.1|1490579_1490774_-	DUF3924 domain-containing protein	NA	NA	NA	NA	NA
WP_000806236.1|1490895_1491426_-|integrase	tyrosine-type recombinase/integrase	integrase	A3F636	Streptococcus_phage	39.4	1.1e-24
1493520:1493539	attR	TGATTAAAGTTTCACTTTAT	NA	NA	NA	NA
>prophage 5
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	1746034	1762853	5790408	tail	Brevibacillus_phage(100.0%)	11	NA	NA
WP_000465973.1|1746034_1746487_+	hypothetical protein	NA	A0A0K2CP30	Brevibacillus_phage	43.0	8.9e-23
WP_000077127.1|1746486_1747575_+	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	55.6	2.7e-94
WP_000004091.1|1747807_1748278_+	hypothetical protein	NA	A0A0K2CPC8	Brevibacillus_phage	52.9	8.1e-35
WP_000743722.1|1748364_1748607_+	hypothetical protein	NA	A0A0K2CP74	Brevibacillus_phage	55.0	2.7e-18
WP_079245328.1|1748679_1754031_+|tail	phage tail tape measure protein	tail	A0A0K2CPN3	Brevibacillus_phage	26.0	1.6e-142
WP_000068594.1|1754089_1754707_+	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	61.2	1.1e-71
WP_001126627.1|1754709_1755783_+	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	40.3	9.1e-74
WP_001134178.1|1755796_1759003_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	50.0	3.7e-06
WP_079245329.1|1759080_1759797_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000007797.1|1759811_1760252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001145942.1|1760267_1762853_+	hypothetical protein	NA	A0A0K2CPJ7	Brevibacillus_phage	44.2	1.6e-31
>prophage 6
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	1798476	1807862	5790408		Brevibacillus_phage(100.0%)	9	NA	NA
WP_000177370.1|1798476_1799184_-	DNA polymerase I	NA	A0A0K2CNW2	Brevibacillus_phage	53.9	1.1e-64
WP_000781409.1|1799352_1799757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002083222.1|1800380_1801775_-	hypothetical protein	NA	A0A0K2CP19	Brevibacillus_phage	46.1	1.2e-102
WP_000207533.1|1801861_1802521_-	hypothetical protein	NA	A0A0K2CPH8	Brevibacillus_phage	56.9	4.7e-57
WP_001090550.1|1802983_1803541_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	41.1	2.4e-25
WP_001167934.1|1803568_1804645_-	toprim domain-containing protein	NA	A0A0K2CNW6	Brevibacillus_phage	54.0	1.3e-104
WP_001139152.1|1804669_1805962_-	DNA helicase	NA	A0A0K2CP24	Brevibacillus_phage	57.9	1.1e-139
WP_001005180.1|1806441_1807212_-	ATP-binding protein	NA	A0A0K2CNX1	Brevibacillus_phage	48.4	3.3e-62
WP_000278516.1|1807271_1807862_-	helix-turn-helix domain-containing protein	NA	A0A0K2CNS5	Brevibacillus_phage	43.7	1.0e-26
>prophage 7
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	2035295	2089222	5790408	tail,transposase,holin,portal,terminase	Bacillus_phage(68.97%)	67	NA	NA
WP_079245061.1|2035295_2036492_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_079245386.1|2036933_2038490_+	AAA family ATPase	NA	A7KV18	Bacillus_phage	31.8	1.8e-22
WP_079245387.1|2038503_2038806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245388.1|2038805_2039039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245389.1|2039052_2039688_+	chromosome partitioning protein ParA	NA	A7KV15	Bacillus_phage	35.0	8.4e-27
WP_061884020.1|2039704_2040070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953789.1|2040069_2041128_+	exonuclease SbcD	NA	NA	NA	NA	NA
WP_042597771.1|2041124_2041427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953790.1|2041419_2041971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000371313.1|2041980_2042499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953853.1|2042582_2044175_+	DEAD/DEAH box helicase family protein	NA	A0A1B0Z0P8	Vibrio_phage	24.4	3.7e-15
WP_079245392.1|2044264_2044543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953791.1|2044542_2045286_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245394.1|2045305_2048392_+	DNA primase	NA	A0A1L4BKL0	Thermus_phage	28.6	4.7e-14
WP_145953792.1|2048415_2050842_+	bifunctional 3'-5' exonuclease/DNA polymerase	NA	F8WQ35	Bacillus_phage	23.6	3.0e-32
WP_000532406.1|2050845_2051118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_078993311.1|2051080_2051338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953793.1|2051363_2051729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159451458.1|2051725_2051872_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953794.1|2051871_2052195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245396.1|2052191_2052731_+	hypothetical protein	NA	R9TQ23	Paenibacillus_phage	37.6	8.7e-25
WP_079245397.1|2052745_2053522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245398.1|2054010_2054991_+	site-specific DNA-methyltransferase	NA	A0A2H4JD00	uncultured_Caudovirales_phage	62.7	6.1e-117
WP_079245399.1|2055720_2056041_+	hypothetical protein	NA	A0A0A7AR06	Bacillus_phage	53.8	2.7e-26
WP_079245400.1|2056076_2056397_+	hypothetical protein	NA	A0A0S2MVI8	Bacillus_phage	48.5	6.3e-15
WP_079245402.1|2056438_2056882_+	hypothetical protein	NA	S5MUC4	Brevibacillus_phage	56.6	1.3e-10
WP_079245403.1|2056878_2057532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245405.1|2057528_2057711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245407.1|2057707_2058025_+	transglycosylase	NA	NA	NA	NA	NA
WP_079245408.1|2058041_2058980_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245409.1|2058982_2059129_+	BC1881 family protein	NA	NA	NA	NA	NA
WP_079245411.1|2059255_2059450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042597802.1|2059851_2060133_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A2I7SC16	Paenibacillus_phage	57.1	2.7e-14
WP_042597805.1|2060134_2060332_+	hypothetical protein	NA	A0A1L2JY50	Aeribacillus_phage	49.1	6.6e-07
WP_145953795.1|2060328_2060526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953796.1|2060522_2060771_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200016.1|2061285_2061615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000196739.1|2061874_2062255_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086032.1|2062968_2063397_+	hypothetical protein	NA	A0A2H4J6Z8	uncultured_Caudovirales_phage	51.1	1.2e-32
WP_079245413.1|2063413_2065129_+|terminase	phage terminase large subunit	terminase	A0A142F1L6	Bacillus_phage	52.7	1.9e-150
WP_079245414.1|2065145_2066663_+|portal	phage portal protein	portal	A0A142F1L7	Bacillus_phage	29.6	1.5e-66
WP_140158368.1|2066721_2067504_+	scaffolding protein	NA	Q4ZC70	Staphylococcus_virus	40.0	9.7e-09
WP_075717831.1|2067564_2068689_+	DUF5309 family protein	NA	NA	NA	NA	NA
WP_000027968.1|2068738_2068963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025118134.1|2068991_2069333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245416.1|2069337_2070144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245417.1|2070147_2070522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245418.1|2070884_2071292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000852562.1|2071305_2071812_+|tail	phage major tail protein, TP901-1 family	tail	NA	NA	NA	NA
WP_079245419.1|2071835_2072195_+	hypothetical protein	NA	A0A0A7AQ61	Bacillus_phage	81.0	2.7e-38
WP_079245420.1|2072181_2072397_+	hypothetical protein	NA	A0A0S2MV92	Bacillus_phage	92.8	3.3e-28
WP_000818630.1|2072468_2072846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953797.1|2072935_2073190_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245424.1|2077137_2078634_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	80.4	6.4e-219
WP_079245425.1|2078630_2082653_+	hypothetical protein	NA	A0A0U3SD62	Bacillus_phage	77.1	0.0e+00
WP_079245426.1|2082691_2082976_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245428.1|2082990_2083221_+|holin	phage holin	holin	A0A0S2MVE8	Bacillus_phage	77.3	5.7e-26
WP_079245429.1|2083234_2084068_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	88.1	1.0e-149
WP_079245430.1|2084121_2084388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079245431.1|2084667_2085270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000578036.1|2085369_2085606_-	helix-turn-helix transcriptional regulator	NA	Q2I8D9	Bacillus_phage	57.9	9.0e-19
WP_145953798.1|2085762_2085885_+	DUF3961 domain-containing protein	NA	Q3HKZ4	Bacillus_phage	59.5	4.1e-07
WP_079245436.1|2086527_2086719_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079246274.1|2086875_2087178_+	hypothetical protein	NA	A0A288WG08	Bacillus_phage	55.1	7.5e-26
WP_079245437.1|2087174_2087357_+	hypothetical protein	NA	Q2I8E2	Bacillus_phage	90.0	8.8e-22
WP_079245438.1|2087472_2088657_+	cell division protein FtsK	NA	A0A288WFS1	Bacillus_phage	63.3	4.3e-141
WP_079245439.1|2088598_2089222_+	hypothetical protein	NA	H0USY2	Bacillus_phage	79.6	4.1e-95
>prophage 8
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	2124442	2133331	5790408		Bacillus_phage(71.43%)	8	NA	NA
WP_063675233.1|2124442_2125729_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	30.6	3.8e-10
WP_079245451.1|2125828_2126593_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_079245452.1|2126828_2128589_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.8	2.2e-274
WP_016082005.1|2128673_2129351_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	3.9e-123
WP_142307883.1|2129347_2130421_+	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	96.9	4.4e-185
WP_000818985.1|2130648_2131368_+	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_145953799.1|2131470_2131935_+	O-methyltransferase	NA	W8CYT3	Bacillus_phage	97.8	9.0e-71
WP_079245455.1|2132461_2133331_+	aminoglycoside 6-adenylyltransferase	NA	E4ZFP8	Streptococcus_phage	44.2	1.3e-65
>prophage 9
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	2314288	2322316	5790408	transposase	Bacillus_phage(28.57%)	9	NA	NA
WP_000427801.1|2314288_2314564_+	stage V sporulation protein S	NA	J9PTX7	Bacillus_phage	41.2	2.9e-08
WP_000478850.1|2314762_2315026_+	hypothetical protein	NA	A0A218KBU4	Bacillus_phage	38.9	4.4e-06
WP_145953776.1|2315667_2316814_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.8	2.4e-48
WP_079245479.1|2316822_2317188_-	YolD-like family protein	NA	A0A2H4JEH6	uncultured_Caudovirales_phage	27.5	7.0e-10
WP_017763084.1|2317378_2318452_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	2.6e-73
WP_000709202.1|2318448_2318574_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044784193.1|2318893_2319667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044784192.1|2319776_2320424_+	HD domain-containing protein	NA	S4W232	Pandoravirus	29.1	3.5e-12
WP_000783164.1|2320420_2322316_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2H4UUX5	Bodo_saltans_virus	25.3	4.9e-46
>prophage 10
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	3062723	3116511	5790408	protease,coat,tail,transposase,head,portal,terminase,capsid,integrase	Bacillus_phage(89.58%)	67	3068594:3068610	3120457:3120473
WP_000415813.1|3062723_3063176_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_000342252.1|3063190_3063391_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_000332789.1|3063758_3064307_-|coat	spore coat protein	coat	NA	NA	NA	NA
WP_000027167.1|3064964_3065396_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000581062.1|3065749_3066520_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000340384.1|3066776_3067556_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001062742.1|3067808_3068129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000229634.1|3068208_3069723_-	MFS transporter	NA	NA	NA	NA	NA
3068594:3068610	attL	ATACTTAGTACAGAGAA	NA	NA	NA	NA
WP_000401028.1|3069746_3070454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001258382.1|3070472_3071183_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_000102243.1|3071196_3071820_-	YhbD family protein	NA	NA	NA	NA	NA
WP_000470218.1|3071980_3073717_-	SgrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079245620.1|3075184_3076012_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	70.2	1.6e-102
WP_079245621.1|3076021_3076642_-	hypothetical protein	NA	H0USY2	Bacillus_phage	95.1	2.8e-112
WP_079245622.1|3076583_3077765_-	cell division protein FtsK	NA	H0USY1	Bacillus_phage	94.1	5.8e-215
WP_159451460.1|3077989_3078079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079245623.1|3078059_3078377_-	hypothetical protein	NA	H0USY0	Bacillus_phage	97.1	2.4e-51
WP_079245624.1|3078559_3078757_+	helix-turn-helix transcriptional regulator	NA	A0A288WG80	Bacillus_phage	76.2	3.4e-19
WP_079245625.1|3078765_3078945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245626.1|3078950_3079538_+	type IV secretory system conjugative DNA transfer family protein	NA	A0A288WG09	Bacillus_phage	90.2	1.7e-98
WP_079245627.1|3079606_3079936_+	hypothetical protein	NA	A0A0S2GLG3	Bacillus_phage	93.6	7.3e-51
WP_079245628.1|3079974_3081030_-	N-acetylmuramoyl-L-alanine amidase	NA	D3WK93	Bacillus_phage	94.0	1.8e-191
WP_044798115.1|3081026_3081266_-	hypothetical protein	NA	A0A288WFV1	Bacillus_phage	94.9	1.2e-31
WP_079245061.1|3081563_3082760_+|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_079245629.1|3082961_3083195_-	hypothetical protein	NA	A0A2H4J382	uncultured_Caudovirales_phage	87.8	3.9e-14
WP_079245630.1|3083362_3083812_-	hypothetical protein	NA	A0A2H4J6F8	uncultured_Caudovirales_phage	96.6	6.7e-79
WP_079245631.1|3083834_3087845_-	hypothetical protein	NA	H0USX5	Bacillus_phage	88.9	0.0e+00
WP_079245632.1|3087841_3089323_-|tail	phage tail protein	tail	W8CYY9	Bacillus_phage	93.7	8.4e-280
WP_079245633.1|3089337_3093189_-|tail	phage tail tape measure protein	tail	A0A288WG88	Bacillus_phage	96.2	0.0e+00
WP_044798120.1|3093411_3093729_-	hypothetical protein	NA	A0A288WGA9	Bacillus_phage	97.1	4.9e-52
WP_044798121.1|3093776_3094385_-|tail	tail protein	tail	A0A288WG55	Bacillus_phage	98.5	8.1e-104
WP_044798123.1|3094385_3094745_-	DUF3168 domain-containing protein	NA	Q2I8F3	Bacillus_phage	95.8	3.2e-60
WP_044798124.1|3094741_3095182_-	HK97 family phage protein	NA	A0A288WGB7	Bacillus_phage	100.0	4.2e-78
WP_044798125.1|3095174_3095498_-|head	phage head closure protein	head	Q2I8F5	Bacillus_phage	97.2	2.2e-55
WP_044798126.1|3095494_3095785_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A288WGQ6	Bacillus_phage	96.9	1.1e-45
WP_079245634.1|3095802_3096972_-|capsid	phage major capsid protein	capsid	A0A288WG01	Bacillus_phage	92.1	3.9e-195
WP_044798129.1|3097010_3097631_-|head,protease	HK97 family phage prohead protease	head,protease	Q2I8F8	Bacillus_phage	98.1	1.2e-110
WP_079245635.1|3097593_3098892_-|portal	phage portal protein	portal	Q2LIC9	Bacillus_phage	98.4	3.2e-243
WP_044798130.1|3098907_3100605_-|terminase	terminase large subunit	terminase	A0A288WFW5	Bacillus_phage	98.8	0.0e+00
WP_044798131.1|3100601_3101087_-|terminase	phage terminase small subunit P27 family	terminase	Q2I8G1	Bacillus_phage	96.9	6.5e-80
WP_044798132.1|3101187_3101571_-	HNH endonuclease	NA	Q2I8B2	Bacillus_phage	97.6	2.6e-68
WP_079246301.1|3101640_3101907_-	hypothetical protein	NA	H0USV8	Bacillus_phage	53.9	6.8e-15
WP_079245636.1|3102067_3102256_-	hypothetical protein	NA	A0A0S2GLH7	Bacillus_phage	66.0	1.4e-11
WP_079245637.1|3102454_3102709_-	hypothetical protein	NA	A0A288WG25	Bacillus_phage	97.6	1.1e-41
WP_079245638.1|3102728_3102920_-	hypothetical protein	NA	A0A288WFV5	Bacillus_phage	76.2	1.1e-19
WP_079245639.1|3102906_3103248_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	81.4	7.9e-24
WP_079245640.1|3103252_3103474_-	hypothetical protein	NA	Q2LI85	Bacillus_phage	93.2	1.3e-30
WP_079246302.1|3103480_3103705_-	hypothetical protein	NA	Q3HKX2	Bacillus_phage	87.8	2.0e-28
WP_044821902.1|3103824_3104220_-	sigma-70 family RNA polymerase sigma factor	NA	A0A288WFT8	Bacillus_phage	96.9	6.3e-65
WP_001258960.1|3104395_3104518_-	DUF3983 domain-containing protein	NA	A0A288WG42	Bacillus_phage	95.0	8.5e-13
WP_079245641.1|3104671_3104860_-	hypothetical protein	NA	Q3HKX5	Bacillus_phage	88.7	1.2e-21
WP_153599617.1|3105237_3105396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798137.1|3105435_3105735_-	hypothetical protein	NA	A0A0M4REQ3	Bacillus_phage	80.8	2.0e-39
WP_044798138.1|3105897_3106410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044798140.1|3106718_3107261_-	hypothetical protein	NA	A0A288WGA4	Bacillus_phage	95.0	1.9e-96
WP_079245643.1|3107317_3107794_-	hypothetical protein	NA	A0A288WFT9	Bacillus_phage	94.3	1.4e-90
WP_079245644.1|3107790_3108537_-	sigma-70 family RNA polymerase sigma factor	NA	Q2I8C6	Bacillus_phage	73.4	1.4e-97
WP_079245645.1|3108529_3108757_-	hypothetical protein	NA	C7DTL1	Bacillus_phage	73.3	1.6e-25
WP_079245646.1|3108756_3109638_-	ATP-binding protein	NA	A0A0S2SXI8	Bacillus_phage	34.5	1.6e-28
WP_079245647.1|3109649_3110423_-	replication protein	NA	A0A1W6JNI1	Staphylococcus_phage	48.2	4.4e-54
WP_079245648.1|3110552_3111434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079245649.1|3111457_3112132_-	Rha family transcriptional regulator	NA	A0A288WFT2	Bacillus_phage	66.1	4.3e-82
WP_079245650.1|3112340_3112529_-	helix-turn-helix domain-containing protein	NA	A0A1B2APY7	Phage_Wrath	79.0	1.0e-20
WP_021727906.1|3112710_3112917_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079245651.1|3113075_3113417_+	helix-turn-helix transcriptional regulator	NA	H0UST7	Bacillus_phage	33.3	1.1e-09
WP_079245652.1|3113828_3114995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079245653.1|3115449_3116511_+|integrase	site-specific integrase	integrase	H0UST3	Bacillus_phage	79.9	3.5e-163
3120457:3120473	attR	TTCTCTGTACTAAGTAT	NA	NA	NA	NA
>prophage 11
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	4593203	4700185	5790408	protease,coat,bacteriocin,portal,tail,head,tRNA,plate,terminase,capsid	Bacillus_phage(50.91%)	112	NA	NA
WP_001266969.1|4593203_4593644_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_001262795.1|4593660_4595844_-	GTP diphosphokinase	NA	A0A1B1IUF0	uncultured_Mediterranean_phage	36.5	2.4e-12
WP_000346215.1|4596054_4596567_-	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	43.8	8.5e-30
WP_000941227.1|4596614_4598954_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	32.8	2.9e-85
WP_000409739.1|4599055_4599949_-	cation transporter	NA	NA	NA	NA	NA
WP_001119057.1|4600105_4602370_-	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.3	7.4e-33
WP_000884549.1|4602639_4602924_-	histidine kinase	NA	NA	NA	NA	NA
WP_000198293.1|4603109_4604669_+	stage V sporulation protein B	NA	NA	NA	NA	NA
WP_000454822.1|4604749_4605397_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000349145.1|4605500_4605884_+	TIGR04086 family membrane protein	NA	NA	NA	NA	NA
WP_000991113.1|4605920_4606181_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	43.9	2.8e-05
WP_000125365.1|4606208_4607348_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	42.3	1.1e-82
WP_000354016.1|4607360_4608413_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_000138162.1|4608432_4608633_-	DUF2905 domain-containing protein	NA	NA	NA	NA	NA
WP_000344464.1|4608629_4609631_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	26.3	6.8e-07
WP_000464512.1|4609636_4610254_-	Holliday junction DNA helicase RuvA	NA	NA	NA	NA	NA
WP_000823610.1|4610442_4611387_+	iron-hydroxamate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000871202.1|4611398_4611929_-	BofC protein	NA	NA	NA	NA	NA
WP_000874881.1|4612410_4612791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093530.1|4612824_4613472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079245941.1|4613650_4615618_-|coat	spore coat assembly protein ExsA	coat	NA	NA	NA	NA
WP_153578016.1|4615639_4615816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000025283.1|4615844_4616951_-	quinolinate synthase NadA	NA	NA	NA	NA	NA
WP_001092241.1|4616982_4617816_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_001138543.1|4617835_4619365_-	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_000973781.1|4619517_4620660_+	aminotransferase class V-fold PLP-dependent enzyme	NA	A0A1X7QGF3	Faustovirus	29.2	8.5e-30
WP_000812273.1|4620659_4621202_+	transcription repressor NadR	NA	NA	NA	NA	NA
WP_000511662.1|4621281_4621929_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_000796366.1|4622121_4622592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621701.1|4622769_4623621_-	prephenate dehydratase	NA	NA	NA	NA	NA
WP_079245942.1|4623717_4625628_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_001011409.1|4625677_4627600_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000114530.1|4627574_4628351_-	ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	31.0	1.6e-19
WP_000865417.1|4628444_4629527_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_002082113.1|4629516_4630224_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000497121.1|4630413_4631700_-	GTPase ObgE	NA	NA	NA	NA	NA
WP_001003585.1|4631704_4632247_-	sporulation protein	NA	NA	NA	NA	NA
WP_000944957.1|4632310_4632601_-	50S ribosomal protein L27	NA	NA	NA	NA	NA
WP_002082112.1|4632604_4632949_-|protease	ribosomal-processing cysteine protease Prp	protease	NA	NA	NA	NA
WP_000270907.1|4632960_4633269_-	50S ribosomal protein L21	NA	NA	NA	NA	NA
WP_079245943.1|4633438_4634827_-	Rne/Rng family ribonuclease	NA	NA	NA	NA	NA
WP_000599046.1|4634894_4635755_-	stage IV sporulation protein SpoIVFB	NA	NA	NA	NA	NA
WP_000797477.1|4635747_4636494_-	stage IV sporulation protein SpoIVFA	NA	NA	NA	NA	NA
WP_000503309.1|4636627_4637425_-	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_000391514.1|4637427_4638114_-	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000975762.1|4638149_4638695_-	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_001135484.1|4638709_4639561_-	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_000466736.1|4639602_4640622_-	rod shape-determining protein MreB	NA	NA	NA	NA	NA
WP_145953834.1|4640779_4641184_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_079245944.1|4641291_4642125_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	86.3	2.5e-127
WP_079245945.1|4642141_4642435_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	93.8	9.1e-45
WP_044797844.1|4642458_4642677_-	hypothetical protein	NA	A0A1C8E991	Bacillus_phage	100.0	7.0e-34
WP_079245946.1|4642815_4643148_+	hypothetical protein	NA	A0A1B2AQ49	Phage_Wrath	60.9	1.4e-25
WP_079245947.1|4643326_4644379_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1C8E990	Bacillus_phage	98.0	4.0e-199
WP_000392439.1|4644375_4644606_-|bacteriocin	bacteriocin biosynthesis protein	bacteriocin	A0A1B1P7Q9	Bacillus_phage	100.0	5.7e-34
WP_079245948.1|4644668_4645937_-|plate	BppU family phage baseplate upper protein	plate	A0A1B0T696	Bacillus_phage	92.2	3.0e-225
WP_079245949.1|4645951_4648294_-	endopeptidase	NA	A0A1B1P7P0	Bacillus_phage	96.4	0.0e+00
WP_079245950.1|4648290_4648974_-|tail	phage tail protein	tail	A0A1C8EA72	Bacillus_phage	98.2	1.8e-128
WP_079245951.1|4648975_4652854_-|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	71.2	9.4e-238
WP_006927278.1|4652870_4653059_-	hypothetical protein	NA	A0A1C8E979	Bacillus_phage	98.4	8.2e-31
WP_000113340.1|4653097_4653484_-	hypothetical protein	NA	A0A1C8E984	Bacillus_phage	99.2	3.6e-65
WP_016125430.1|4653495_4654131_-|tail	phi13 family phage major tail protein	tail	A0A1C8E980	Bacillus_phage	98.6	4.8e-115
WP_060852321.1|4654142_4654520_-	hypothetical protein	NA	A0A2H4JDG0	uncultured_Caudovirales_phage	87.2	5.1e-56
WP_061884612.1|4654519_4654849_-	hypothetical protein	NA	A0A1B1P7P2	Bacillus_phage	98.2	2.6e-56
WP_079245952.1|4654838_4655174_-	hypothetical protein	NA	A0A1C8E986	Bacillus_phage	97.2	2.1e-53
WP_000998745.1|4655148_4655409_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1C8E967	Bacillus_phage	93.0	1.3e-39
WP_079245190.1|4655412_4656786_-|capsid	phage major capsid protein	capsid	A0A1B2APY9	Phage_Wrath	77.2	5.3e-151
WP_042596662.1|4656787_4657366_-|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4J6Z9	uncultured_Caudovirales_phage	81.5	4.7e-85
WP_079245953.1|4657334_4658540_-|portal	phage portal protein	portal	A0A1B2APW5	Phage_Wrath	95.5	8.8e-219
WP_079245954.1|4658628_4658907_+	hypothetical protein	NA	D2IZW1	Enterococcus_phage	60.9	1.3e-27
WP_079245955.1|4658903_4659107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079245956.1|4659121_4660846_-|terminase	terminase large subunit	terminase	A0A1B2AQ28	Phage_Wrath	96.7	0.0e+00
WP_016084503.1|4660842_4661277_-	hypothetical protein	NA	A0A1B2APW6	Phage_Wrath	95.1	3.5e-69
WP_079245957.1|4661396_4661762_-	HNH endonuclease	NA	A0A2H4JA38	uncultured_Caudovirales_phage	63.6	2.0e-41
WP_079245958.1|4661758_4662040_-	hypothetical protein	NA	A0A1C8EAA0	Bacillus_phage	69.5	1.7e-27
WP_079245959.1|4662036_4662258_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079245960.1|4662396_4662783_-	hypothetical protein	NA	A0A2H4JFW6	uncultured_Caudovirales_phage	72.8	1.3e-46
WP_079245961.1|4663169_4665032_-	DNA primase	NA	A0A1B1P7L5	Bacillus_phage	96.8	0.0e+00
WP_079245962.1|4665108_4665912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245963.1|4665945_4667634_-	hypothetical protein	NA	A0A1B1P7M5	Bacillus_phage	98.4	0.0e+00
WP_079245964.1|4667851_4668343_-	DUF669 domain-containing protein	NA	A0A1B1P7N3	Bacillus_phage	89.0	1.4e-82
WP_079245965.1|4668342_4668684_-	organic solvent tolerance protein OstA	NA	A0A1B1P7N6	Bacillus_phage	99.1	1.0e-55
WP_079245966.1|4668686_4670621_-	AAA family ATPase	NA	A0A1B1P7N0	Bacillus_phage	96.1	0.0e+00
WP_079245967.1|4670793_4671072_-	nuclease	NA	A0A1B1P7M6	Bacillus_phage	98.9	1.5e-49
WP_079245968.1|4671064_4671268_-	hypothetical protein	NA	A0A1B1P7L2	Bacillus_phage	97.0	3.5e-27
WP_079245969.1|4671279_4671594_-	hypothetical protein	NA	A0A1B1P7L0	Bacillus_phage	81.7	2.9e-41
WP_001262629.1|4671590_4671788_-	hypothetical protein	NA	A0A1B1P7L7	Bacillus_phage	100.0	5.6e-30
WP_079245970.1|4671788_4673012_-	DEAD/DEAH box helicase	NA	A0A1B1P7L4	Bacillus_phage	98.3	4.4e-234
WP_079245971.1|4673056_4673707_-	sigma-70 family RNA polymerase sigma factor	NA	H0USU1	Bacillus_phage	77.7	2.9e-91
WP_079245972.1|4673727_4674078_-	hypothetical protein	NA	A0A2H4JBP9	uncultured_Caudovirales_phage	88.8	9.2e-52
WP_079245973.1|4674882_4675134_-	transcriptional regulator	NA	A0A2H4JEY2	uncultured_Caudovirales_phage	86.9	6.2e-34
WP_079245974.1|4675304_4675991_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JDE4	uncultured_Caudovirales_phage	94.7	8.2e-121
WP_060851674.1|4676074_4677469_+	recombinase family protein	NA	A0A2H4JFH9	uncultured_Caudovirales_phage	81.7	3.9e-218
WP_001013397.1|4677472_4677871_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000720491.1|4677917_4678493_-	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_079245975.1|4678725_4679676_-	stage II sporulation protein B	NA	NA	NA	NA	NA
WP_017763622.1|4679840_4681142_-	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_079245976.1|4681235_4683881_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	43.0	4.2e-165
WP_000350652.1|4684364_4685390_-|coat	spore coat protein YsxE	coat	NA	NA	NA	NA
WP_003256548.1|4685456_4686458_-	stage VI sporulation protein D	NA	NA	NA	NA	NA
WP_000712938.1|4686538_4687825_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	A0A1V0SKB7	Klosneuvirus	34.1	1.7e-05
WP_001087080.1|4687824_4688814_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000992324.1|4688834_4689587_-	uroporphyrinogen-III synthase	NA	NA	NA	NA	NA
WP_001226403.1|4689589_4690519_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_000009002.1|4690534_4691368_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_079245977.1|4691385_4692720_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_000133913.1|4693136_4693589_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000359773.1|4693591_4694008_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000869118.1|4694042_4694639_-	ribosome biogenesis GTP-binding protein YsxC	NA	NA	NA	NA	NA
WP_000097281.1|4694635_4696966_-	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	43.7	7.3e-177
WP_000119171.1|4697148_4698819_-|protease	ATP-dependent protease LonB	protease	E3T4F6	Cafeteria_roenbergensis_virus	33.5	8.7e-15
WP_000472289.1|4698925_4700185_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	66.3	1.0e-148
>prophage 12
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	4759454	4767142	5790408		Staphylococcus_phage(16.67%)	9	NA	NA
WP_000221121.1|4759454_4760378_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	2.6e-45
WP_079245996.1|4760503_4761439_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	26.3	2.8e-23
WP_000018046.1|4761440_4762133_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	26.9	6.8e-06
WP_001014310.1|4762477_4762672_+	YwbE family protein	NA	NA	NA	NA	NA
WP_001255945.1|4762711_4763911_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.0	6.1e-71
WP_000587818.1|4764205_4764529_+	heme oxygenase	NA	NA	NA	NA	NA
WP_002162479.1|4764601_4765366_-	class B sortase	NA	NA	NA	NA	NA
WP_000403765.1|4765398_4766169_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	1.7e-13
WP_001036829.1|4766158_4767142_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.2	1.9e-17
>prophage 13
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	5165492	5244178	5790408	protease,coat,portal,tail,head,holin,terminase,capsid,integrase	Bacillus_phage(39.29%)	100	5187521:5187537	5228010:5228026
WP_000614219.1|5165492_5166494_-|coat	spore coat protein CotS	coat	NA	NA	NA	NA
WP_000665102.1|5166614_5167106_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	54.5	4.6e-41
WP_000351144.1|5167129_5167609_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_017763721.1|5167770_5168874_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_017763722.1|5168818_5170165_+	hypothetical protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.0	3.6e-11
WP_000241496.1|5170170_5171283_+|protease	cysteine protease StiP family protein	protease	NA	NA	NA	NA
WP_000575387.1|5171279_5172095_+	HAD hydrolase family protein	NA	NA	NA	NA	NA
WP_000683427.1|5172647_5173229_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000276470.1|5173268_5174033_-	TIGR01457 family HAD-type hydrolase	NA	NA	NA	NA	NA
WP_000503340.1|5174142_5174775_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000274010.1|5174855_5175296_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_000439090.1|5175443_5176415_+	class II fructose-bisphosphatase	NA	NA	NA	NA	NA
WP_000392611.1|5176432_5176699_+	DUF3055 domain-containing protein	NA	NA	NA	NA	NA
WP_017763725.1|5177072_5177570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435946.1|5177615_5177924_-	YutD family protein	NA	NA	NA	NA	NA
WP_000744128.1|5178042_5178621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000178111.1|5178648_5179383_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025989102.1|5179483_5180299_+|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000738177.1|5180323_5180767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000721045.1|5180900_5181455_+	histidine phosphatase family protein	NA	NA	NA	NA	NA
WP_000272753.1|5181529_5182009_+	YbaK/EbsC family protein	NA	NA	NA	NA	NA
WP_000166367.1|5182029_5182926_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_000944693.1|5183115_5184099_+	M23 family metallopeptidase	NA	NA	NA	NA	NA
WP_000021796.1|5184171_5184903_-	sporulation protein YunB	NA	NA	NA	NA	NA
WP_000248473.1|5184957_5185260_-	DUF1805 domain-containing protein	NA	NA	NA	NA	NA
WP_079246078.1|5185325_5186717_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
5187521:5187537	attL	ATAGAACCTTCCATCTC	NA	NA	NA	NA
WP_079246079.1|5187860_5188694_+	cytosolic protein	NA	A0A2H4J6G7	uncultured_Caudovirales_phage	84.8	9.3e-127
WP_079246080.1|5188711_5189002_-	hypothetical protein	NA	A0A1C8E992	Bacillus_phage	89.7	6.1e-41
WP_001016120.1|5189026_5189245_-	hypothetical protein	NA	A0A2H4JC50	uncultured_Caudovirales_phage	93.1	1.6e-30
WP_079246081.1|5189384_5189951_+	hypothetical protein	NA	A6XML2	Bacillus_virus	45.0	1.8e-25
WP_079246082.1|5190129_5190348_-	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	75.4	6.0e-17
WP_079246083.1|5190347_5191463_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	55.1	3.1e-109
WP_079246084.1|5191666_5192599_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	83.6	6.7e-158
WP_000373898.1|5192598_5193024_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	100.0	2.6e-72
WP_048549194.1|5193061_5193436_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	100.0	6.4e-67
WP_079246085.1|5193451_5199010_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	59.4	0.0e+00
WP_079246086.1|5199006_5200476_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	78.5	1.6e-230
WP_145953858.1|5200517_5202932_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	42.8	2.1e-41
WP_000415931.1|5204416_5204779_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	71.7	1.4e-42
WP_001004918.1|5204785_5205379_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	91.8	9.7e-102
WP_079246088.1|5205379_5205709_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	94.5	5.4e-54
WP_079246089.1|5205705_5206050_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	79.6	1.7e-45
WP_079246090.1|5206051_5206402_-|head	phage head closure protein	head	D2XR20	Bacillus_phage	88.8	2.2e-53
WP_079246091.1|5206403_5206697_-	hypothetical protein	NA	A0A2H4JG04	uncultured_Caudovirales_phage	79.4	2.8e-38
WP_079246092.1|5206702_5207860_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	91.7	4.7e-201
WP_079246334.1|5207863_5208607_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	85.4	2.6e-112
WP_016123349.1|5208606_5209776_-|portal	phage portal protein	portal	A0A2H4JBZ5	uncultured_Caudovirales_phage	95.0	3.7e-206
WP_079246093.1|5211348_5211660_-|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	5.5e-40
WP_000253626.1|5211765_5212263_-	endonuclease	NA	A0A2H4J2Q3	uncultured_Caudovirales_phage	43.9	9.8e-31
WP_079246094.1|5212256_5212592_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_079246095.1|5212557_5212932_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000378697.1|5212922_5213180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177575.1|5213186_5213396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246096.1|5213464_5213899_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	59.4	4.1e-17
WP_079246097.1|5213904_5214108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246098.1|5214121_5214346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246335.1|5214525_5214708_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	65.5	2.7e-15
WP_000711194.1|5214759_5215179_+	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	4.5e-61
WP_079246336.1|5215562_5215964_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	6.8e-67
WP_000074644.1|5216001_5216328_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	99.1	2.8e-58
WP_079246099.1|5216324_5216852_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	7.0e-96
WP_079246100.1|5216880_5217213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512893.1|5217259_5217955_-	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	79.3	3.5e-111
WP_001093039.1|5218037_5218829_-	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_079246101.1|5218975_5219266_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	96.9	2.2e-51
WP_079246102.1|5219324_5219759_-	hypothetical protein	NA	A0A2H4JBD8	uncultured_Caudovirales_phage	91.0	2.0e-72
WP_079246103.1|5219797_5220358_-	hypothetical protein	NA	A0A1C8E9B1	Bacillus_phage	96.8	4.1e-102
WP_079246104.1|5220390_5220984_-	hypothetical protein	NA	A0A1C8E9A7	Bacillus_phage	96.8	4.1e-84
WP_079246105.1|5221007_5221238_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	97.4	1.4e-32
WP_079246106.1|5221230_5221710_-	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	94.3	5.3e-82
WP_079246107.1|5221721_5222642_-	DnaD domain protein	NA	A0A2H4J394	uncultured_Caudovirales_phage	94.5	2.6e-130
WP_079246108.1|5222737_5223076_-	hypothetical protein	NA	A0A2H4J6H7	uncultured_Caudovirales_phage	96.4	2.0e-51
WP_079246109.1|5223008_5223224_-	hypothetical protein	NA	A0A2H4J3B2	uncultured_Caudovirales_phage	91.5	5.1e-29
WP_042597301.1|5223223_5223937_-	hypothetical protein	NA	A0A1C8EA84	Bacillus_phage	97.9	3.0e-126
WP_000453492.1|5223955_5224390_-	hypothetical protein	NA	A0A0S2MVA8	Bacillus_phage	98.6	3.1e-73
WP_079246110.1|5224416_5224605_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	62.9	5.9e-13
WP_079246111.1|5224616_5225375_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	79.4	1.8e-108
WP_016099149.1|5225553_5225742_-	hypothetical protein	NA	R9TQ08	Paenibacillus_phage	67.2	1.4e-17
WP_079246112.1|5225769_5226015_-	helix-turn-helix transcriptional regulator	NA	A0A1B2APZ4	Phage_Wrath	74.7	4.1e-22
WP_016099151.1|5226179_5226806_+	helix-turn-helix domain-containing protein	NA	A0A1B2APZ3	Phage_Wrath	63.2	5.5e-71
WP_016099152.1|5226892_5227936_+|integrase	site-specific integrase	integrase	A0A1J0MF14	Staphylococcus_phage	47.3	3.8e-93
WP_079246113.1|5228002_5229400_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
5228010:5228026	attR	ATAGAACCTTCCATCTC	NA	NA	NA	NA
WP_000009525.1|5229448_5229880_-	iron-sulfur cluster assembly scaffold protein SufU	NA	A0A0K1LS29	Mycobacterium_phage	36.8	1.6e-13
WP_001020767.1|5229869_5231090_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	47.6	2.3e-118
WP_000152177.1|5231089_5232382_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000929162.1|5232397_5233183_-	Fe-S cluster assembly ATPase SufC	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	7.0e-07
WP_079246114.1|5233421_5234228_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000735090.1|5234299_5235112_-	MetQ/NlpA family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000359401.1|5235135_5235801_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_017763726.1|5235793_5236819_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.6	8.5e-29
WP_001242143.1|5237232_5237577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000568179.1|5237729_5238029_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_000640870.1|5238041_5238386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000026896.1|5239116_5239500_-	glycine cleavage system protein GcvH	NA	NA	NA	NA	NA
WP_000218968.1|5239541_5239907_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	48.6	5.1e-21
WP_000826875.1|5240318_5240846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713769.1|5240990_5241638_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000666176.1|5241697_5242711_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_106081637.1|5242733_5243903_-	L-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_001002987.1|5243929_5244178_-|coat	spore coat protein	coat	NA	NA	NA	NA
>prophage 14
NZ_CP020002	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 chromosome, complete genome	5790408	5344494	5439122	5790408	protease,portal,tail,transposase,head,holin,terminase,capsid,integrase	Bacillus_phage(50.91%)	105	5383350:5383370	5422641:5422661
WP_079246133.1|5344494_5347185_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_079246134.1|5347181_5348474_-	TniQ family protein	NA	NA	NA	NA	NA
WP_079246135.1|5348874_5349858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246136.1|5349850_5352001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159451462.1|5351981_5353322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246138.1|5353840_5354677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159451463.1|5354773_5355634_+	hypothetical protein	NA	V5URE9	Synechococcus_phage	29.5	9.9e-23
WP_079246140.1|5356539_5357031_-	DUF4652 domain-containing protein	NA	NA	NA	NA	NA
WP_079246142.1|5357703_5358450_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_079246143.1|5358483_5360667_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.0	1.9e-49
WP_079246144.1|5360903_5361086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_145953845.1|5361305_5362298_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_000412934.1|5362518_5364012_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	40.4	1.1e-82
WP_079246145.1|5365104_5365284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246146.1|5365983_5366199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001123917.1|5367307_5367775_-	SsrA-binding protein	NA	W5RAM5	Staphylococcus_phage	62.5	7.0e-47
WP_079246149.1|5368146_5370585_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	40.6	1.7e-91
WP_000761976.1|5370727_5371468_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000557266.1|5371628_5371862_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000078304.1|5371956_5372649_-	LrgB family protein	NA	NA	NA	NA	NA
WP_000673222.1|5372645_5373014_-|holin	CidA/LrgA family holin-like protein	holin	NA	NA	NA	NA
WP_079246150.1|5373366_5374317_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_000103951.1|5374367_5375663_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	75.4	1.1e-182
WP_001231141.1|5375693_5377223_-	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001231042.1|5377219_5377975_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_001036332.1|5378007_5379192_-	phosphoglycerate kinase	NA	NA	NA	NA	NA
WP_000161234.1|5379331_5380336_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001258185.1|5380362_5381391_-	gapA transcriptional regulator CggR	NA	NA	NA	NA	NA
WP_000869737.1|5381527_5381773_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_000647951.1|5381782_5383090_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
5383350:5383370	attL	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_079246151.1|5383653_5384634_+	cytosolic protein	NA	A0A0S2MVF4	Bacillus_phage	79.5	1.0e-140
WP_044797908.1|5384691_5385132_+	hypothetical protein	NA	NA	NA	NA	NA
WP_044797907.1|5385274_5386378_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	92.5	6.9e-186
WP_079246152.1|5386933_5387869_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVR5	Bacillus_phage	84.2	1.5e-160
WP_079246153.1|5387868_5388294_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	98.6	1.4e-70
WP_079246154.1|5388334_5388700_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	57.4	3.1e-34
WP_079246155.1|5388716_5393561_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	83.4	0.0e+00
WP_079246156.1|5393557_5395027_-|tail	phage tail protein	tail	A0A0S2MV63	Bacillus_phage	80.0	2.0e-236
WP_145953859.1|5395068_5397462_-	hypothetical protein	NA	A0A2H4JC82	uncultured_Caudovirales_phage	41.8	1.5e-39
WP_144489603.1|5397495_5397609_+	TRASH domain-containing protein	NA	NA	NA	NA	NA
WP_038413229.1|5398943_5399306_-	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	69.2	1.2e-41
WP_001004921.1|5399312_5399906_-|tail	phage tail protein	tail	A0A2H4JDV4	uncultured_Caudovirales_phage	93.3	6.7e-103
WP_079246158.1|5399906_5400242_-	hypothetical protein	NA	A0A2H4JAG4	uncultured_Caudovirales_phage	93.6	2.7e-53
WP_000997537.1|5400238_5400583_-	HK97 gp10 family phage protein	NA	A0A2H4JAH8	uncultured_Caudovirales_phage	80.5	1.7e-45
WP_079246159.1|5400584_5400950_-|head	phage head closure protein	head	A0A2H4JGG7	uncultured_Caudovirales_phage	93.3	2.2e-56
WP_000450787.1|5400951_5401251_-	hypothetical protein	NA	D2XR19	Bacillus_phage	86.9	2.1e-41
WP_079246160.1|5401256_5402414_-|capsid	phage major capsid protein	capsid	A0A2H4JHU0	uncultured_Caudovirales_phage	90.6	7.5e-199
WP_079246341.1|5402417_5403161_-|protease	Clp protease ClpP	protease	D2XR17	Bacillus_phage	88.3	2.1e-117
WP_079246161.1|5403160_5404306_-|portal	phage portal protein	portal	A0A2H4JAJ1	uncultured_Caudovirales_phage	82.4	2.2e-182
WP_079246162.1|5404314_5405982_-|terminase	terminase large subunit	terminase	D2XR15	Bacillus_phage	87.6	4.4e-293
WP_079246093.1|5405978_5406290_-|terminase	terminase	terminase	D2XR14	Bacillus_phage	86.3	5.5e-40
WP_000253626.1|5406395_5406893_-	endonuclease	NA	A0A2H4J2Q3	uncultured_Caudovirales_phage	43.9	9.8e-31
WP_079246094.1|5406886_5407222_-	HNH endonuclease	NA	D2XR61	Bacillus_phage	91.0	1.6e-53
WP_079246095.1|5407187_5407562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000378697.1|5407552_5407810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001177575.1|5407816_5408026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246096.1|5408094_5408529_-	hypothetical protein	NA	Q2I8B8	Bacillus_phage	59.4	4.1e-17
WP_079246097.1|5408534_5408738_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246098.1|5408751_5408976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246335.1|5409155_5409338_+	type II toxin-antitoxin system HicA family toxin	NA	A0A0U4KLG1	Pseudomonas_phage	65.5	2.7e-15
WP_000711194.1|5409389_5409809_+	HicB family protein	NA	A0A2H4J4X8	uncultured_Caudovirales_phage	79.9	4.5e-61
WP_079246336.1|5410192_5410594_-	hypothetical protein	NA	A0A1C8E9D1	Bacillus_phage	98.5	6.8e-67
WP_000074644.1|5410631_5410958_-	hypothetical protein	NA	A0A1C8E9C1	Bacillus_phage	99.1	2.8e-58
WP_079246099.1|5410954_5411482_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	97.7	7.0e-96
WP_079246100.1|5411510_5411843_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053512893.1|5411889_5412585_-	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	79.3	3.5e-111
WP_001093039.1|5412667_5413459_-	prohibitin family protein	NA	A0A1C8E9A9	Bacillus_phage	100.0	6.8e-143
WP_001268029.1|5413605_5413896_-	hypothetical protein	NA	A0A1C8EA94	Bacillus_phage	96.9	5.5e-50
WP_001053193.1|5414002_5414437_-	hypothetical protein	NA	A0A1C8E9B0	Bacillus_phage	98.6	1.7e-79
WP_001245737.1|5414475_5415033_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	70.8	2.0e-64
WP_079246163.1|5415056_5415287_-	hypothetical protein	NA	A0A1C8E9C2	Bacillus_phage	98.7	3.3e-34
WP_079246164.1|5415279_5415759_-	hypothetical protein	NA	A0A2H4J396	uncultured_Caudovirales_phage	93.7	1.2e-81
WP_079246165.1|5415770_5416724_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	90.5	2.2e-148
WP_079246166.1|5416817_5417159_-	hypothetical protein	NA	A0A0S2MVH7	Bacillus_phage	98.2	2.6e-51
WP_000355709.1|5417088_5417304_-	hypothetical protein	NA	A0A1C8E9A6	Bacillus_phage	98.6	1.4e-31
WP_079246167.1|5417303_5418017_-	hypothetical protein	NA	A0A1C8EA84	Bacillus_phage	97.0	1.2e-125
WP_079246168.1|5418034_5418469_-	replication terminator protein	NA	A0A0S2MVA8	Bacillus_phage	98.6	1.8e-73
WP_079246169.1|5418495_5418684_-	hypothetical protein	NA	A0A2H4J4V8	uncultured_Caudovirales_phage	61.3	5.0e-12
WP_001016247.1|5418695_5419451_-	phage regulatory protein	NA	A0A2H4JBC7	uncultured_Caudovirales_phage	83.4	1.9e-110
WP_000410023.1|5419804_5420038_-	DUF771 domain-containing protein	NA	Q9MBW7	Lactococcus_phage	43.5	5.6e-05
WP_000216290.1|5420073_5420304_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002133807.1|5420468_5420861_+	helix-turn-helix transcriptional regulator	NA	A0A1Q1PVX8	Staphylococcus_phage	58.5	3.2e-13
WP_001037137.1|5420871_5421339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000135757.1|5421369_5422506_+|integrase	site-specific integrase	integrase	A8ATX2	Listeria_phage	48.0	6.8e-96
WP_079246170.1|5422920_5423127_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
5422641:5422661	attR	CGCGCCCAGAGGGATTCGAAC	NA	NA	NA	NA
WP_001228537.1|5423220_5423706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000095399.1|5423735_5424212_+	stage V sporulation protein AC	NA	NA	NA	NA	NA
WP_000938953.1|5424212_5425229_+	stage V sporulation protein AD	NA	NA	NA	NA	NA
WP_000575919.1|5425225_5425576_+	stage V sporulation protein AE	NA	NA	NA	NA	NA
WP_000215916.1|5425588_5425795_+	DUF1657 domain-containing protein	NA	NA	NA	NA	NA
WP_016099273.1|5425815_5426685_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001049162.1|5426926_5427508_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	56.5	1.3e-55
WP_000250307.1|5428031_5428280_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000006563.1|5428303_5429254_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	38.1	3.9e-52
WP_000712185.1|5429342_5430296_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	43.1	5.8e-64
WP_079246171.1|5430299_5431181_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.2	1.7e-06
WP_001190080.1|5431201_5431660_-	8-oxo-dGTP diphosphatase	NA	NA	NA	NA	NA
WP_000455196.1|5431889_5432696_-	DUF368 domain-containing protein	NA	NA	NA	NA	NA
WP_001288077.1|5432861_5433818_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	53.9	1.6e-90
WP_000517718.1|5433903_5435415_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_079246172.1|5435554_5436067_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001222403.1|5436100_5436751_-	pyrophosphatase PpaX	NA	NA	NA	NA	NA
WP_000924241.1|5436818_5437631_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_001127251.1|5437655_5438585_-	HPr(Ser) kinase/phosphatase	NA	NA	NA	NA	NA
WP_001267308.1|5438741_5439122_-|holin	phage holin family protein	holin	NA	NA	NA	NA
>prophage 1
NZ_CP020003	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed1, complete sequence	55336	49	54547	55336	terminase,tail,integrase,holin,transposase,capsid,portal	Bacillus_phage(63.64%)	68	273:287	15812:15826
WP_159451465.1|49_361_+	hypothetical protein	NA	A0A1B1P8B5	Bacillus_phage	39.5	2.8e-12
273:287	attL	CTTTTTCTTTGGTAA	NA	NA	NA	NA
WP_062804543.1|2049_2580_+	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	82.4	4.6e-79
WP_062804544.1|2579_2918_+	zinc-finger domain-containing protein	NA	A0A0S2MV86	Bacillus_phage	46.2	4.0e-20
WP_062804545.1|3063_3564_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0S2MVE1	Bacillus_phage	84.2	5.5e-74
WP_079246348.1|4036_4261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418201.1|4750_5155_+	helix-turn-helix domain-containing protein	NA	A0A142F1N8	Bacillus_phage	50.0	2.1e-07
WP_000673901.1|5327_5870_+|integrase	site-specific integrase	integrase	A0A1B0T6D2	Bacillus_phage	49.7	1.7e-44
WP_079246349.1|5929_6178_+	hypothetical protein	NA	A0A1B1P7C3	Bacillus_phage	42.2	2.1e-10
WP_079246350.1|6210_6390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246351.1|6411_7260_+|terminase	terminase	terminase	A0A0A8WJN3	Clostridium_phage	48.2	8.9e-32
WP_000072122.1|7252_8659_+	DEAD/DEAH box helicase family protein	NA	A0A0A8WEW2	Clostridium_phage	63.7	2.0e-169
WP_079246352.1|8728_10207_+|portal	phage portal protein	portal	A0A222YY66	Streptomyces_phage	27.4	1.0e-46
WP_079246353.1|10320_10839_+|capsid	minor capsid protein	capsid	Q1WDG7	Streptomyces_phage	34.4	1.1e-08
WP_079246354.1|10952_12155_+	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	39.8	5.2e-54
WP_000537552.1|12175_13165_+	hypothetical protein	NA	H7BVA6	unidentified_phage	44.8	7.3e-70
WP_079246355.1|13335_13500_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246356.1|13499_14036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001004649.1|14032_14404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246357.1|14410_14821_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246358.1|14824_15247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246359.1|15259_15862_+	hypothetical protein	NA	D3W0E4	Lactococcus_phage	27.4	1.6e-14
15812:15826	attR	TTACCAAAGAAAAAG	NA	NA	NA	NA
WP_079246360.1|15919_16438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246361.1|16401_16824_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246362.1|16856_19880_+|tail	phage tail tape measure protein	tail	A0A1B1P7P9	Bacillus_phage	54.9	5.7e-89
WP_079246363.1|19876_20560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246364.1|20556_22101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016512900.1|22111_22495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246365.1|22539_22914_+	Low copy number virion structural protein	NA	A0A0K2CPR2	Brevibacillus_phage	36.9	3.3e-15
WP_079246366.1|22926_23304_+	Low copy number virion structural protein	NA	A0A0K2CPN7	Brevibacillus_phage	38.3	2.8e-22
WP_079246367.1|23317_24661_+	hypothetical protein	NA	A0A0K2CP42	Brevibacillus_phage	34.8	2.3e-74
WP_000264171.1|24675_26412_+	hypothetical protein	NA	A0A0K2CNY7	Brevibacillus_phage	43.6	4.8e-125
WP_079246368.1|26433_28947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246369.1|28959_30483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246370.1|30495_30876_+	hypothetical protein	NA	G3MAB0	Bacillus_virus	33.3	1.0e-11
WP_079246371.1|30891_31845_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245061.1|32377_33574_-|transposase	IS110 family transposase	transposase	A0A0U3ULR1	Bacillus_phage	25.9	5.6e-24
WP_000439586.1|33869_34367_+|holin	holin	holin	A0A0M4R5G6	Bacillus_phage	42.8	1.2e-25
WP_079246373.1|34446_35505_+	SH3 domain-containing protein	NA	A0A1B1P7Q1	Bacillus_phage	74.3	3.2e-148
WP_061663780.1|35661_36777_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	54.1	1.2e-105
WP_000734385.1|36776_37022_+	hypothetical protein	NA	A0A2H4JBB8	uncultured_Caudovirales_phage	75.4	6.7e-17
WP_061663782.1|37075_37312_-	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	50.6	6.5e-17
WP_061663784.1|37406_37646_-	hypothetical protein	NA	NA	NA	NA	NA
WP_061663786.1|37635_38646_-	plasmid segregation protein ParM	NA	A0A2H4IZP5	uncultured_Caudovirales_phage	27.5	2.7e-27
WP_159451466.1|38851_39910_-	RES domain-containing protein	NA	NA	NA	NA	NA
WP_061663789.1|40074_40605_-	DUF3967 domain-containing protein	NA	A0A1Z1LZN4	Bacillus_phage	38.9	6.8e-14
WP_079246374.1|41062_41437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001246650.1|41579_41858_-	hypothetical protein	NA	A0A0S2MVK9	Bacillus_phage	79.1	8.7e-37
WP_079246376.1|42304_42892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246377.1|42927_43971_-	helix-turn-helix domain-containing protein	NA	A0A0A7AQV7	Bacillus_phage	39.6	6.0e-06
WP_079246378.1|44945_45476_-	ribonuclease	NA	NA	NA	NA	NA
WP_079246379.1|45949_46294_-	helix-turn-helix transcriptional regulator	NA	D2XR39	Bacillus_phage	39.8	9.8e-06
WP_159451467.1|46578_46923_-	helix-turn-helix domain-containing protein	NA	A0A0A7AR52	Bacillus_phage	40.6	2.2e-13
WP_079246381.1|47146_47353_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_079246382.1|47424_47613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246383.1|47618_48311_+	Rha family transcriptional regulator	NA	A0A0U4IS08	Exiguobacterium_phage	40.5	7.0e-35
WP_079246384.1|48333_48696_+	replication terminator protein	NA	A0A0S2MVA8	Bacillus_phage	66.9	2.2e-40
WP_061663800.1|48718_49066_+	hypothetical protein	NA	A0A0S2MVM3	Bacillus_phage	56.5	2.1e-24
WP_000348870.1|49254_49755_+	hypothetical protein	NA	A0A0A7AQW2	Bacillus_phage	73.0	1.3e-62
WP_000139415.1|49723_50140_+	hypothetical protein	NA	A0A0S2MVI0	Bacillus_phage	65.0	6.9e-46
WP_079246385.1|50142_50610_+	hypothetical protein	NA	A0A0S2MVB7	Bacillus_phage	47.7	3.3e-36
WP_079246386.1|50816_51098_+	hypothetical protein	NA	A0A0S2MVE2	Bacillus_phage	55.2	3.1e-18
WP_079246387.1|51094_51544_+	hypothetical protein	NA	A0A0S2MVJ1	Bacillus_phage	80.0	3.7e-69
WP_062804540.1|51540_52122_+	dUTPase	NA	A0A0S2MVD0	Bacillus_phage	88.1	4.1e-97
WP_079246388.1|52134_52692_+	hypothetical protein	NA	A0A0S2MVC3	Bacillus_phage	95.7	3.7e-103
WP_079246389.1|52749_53088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246390.1|53084_53303_+	DUF3797 domain-containing protein	NA	Q24LE0	Clostridium_phage	41.2	3.1e-05
WP_079246391.1|53472_53823_+	hypothetical protein	NA	NA	NA	NA	NA
WP_061885268.1|53851_54547_+	hypothetical protein	NA	A0A1I9S6E4	Bacillus_phage	82.3	6.4e-113
>prophage 1
NZ_CP020004	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed2, complete sequence	49952	7	49719	49952	integrase,tail,holin,terminase,portal	Bacillus_phage(90.0%)	64	1566:1580	48503:48517
WP_159451468.1|7_211_-	hypothetical protein	NA	A0A1B1P8C8	Bacillus_phage	55.2	3.4e-14
WP_079246439.1|444_669_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159451469.1|715_886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246395.1|1153_1891_-	hypothetical protein	NA	A0A2H4J6H9	uncultured_Caudovirales_phage	47.4	1.0e-55
1566:1580	attL	TTAATTTCTTTTTCT	NA	NA	NA	NA
WP_000661411.1|1937_2165_-	hypothetical protein	NA	A0A218KCK2	Bacillus_phage	65.3	6.9e-24
WP_000654659.1|2161_2449_-	hypothetical protein	NA	G9J1X9	Bacillus_phage	79.6	8.1e-38
WP_079246396.1|2520_3030_-	hypothetical protein	NA	A0A1B1P7A6	Bacillus_phage	88.8	3.0e-83
WP_079246397.1|3165_3939_-	hypothetical protein	NA	A0A1B1P796	Bacillus_phage	64.1	3.0e-95
WP_079246398.1|3956_4331_-	cell division protein SepF	NA	A0A1B1P7A1	Bacillus_phage	73.4	2.5e-47
WP_079246399.1|4358_4775_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	A0A1B1P791	Bacillus_phage	71.0	1.3e-15
WP_079246400.1|4835_5345_-	hypothetical protein	NA	A0A1B1P794	Bacillus_phage	69.4	6.6e-59
WP_079246401.1|5356_5884_-	Holliday junction resolvase RecU	NA	A0A1B1P798	Bacillus_phage	86.9	1.3e-86
WP_159451470.1|6056_6194_-	hypothetical protein	NA	A0A1B1P797	Bacillus_phage	68.9	3.7e-09
WP_043935989.1|6245_6446_-	helix-turn-helix transcriptional regulator	NA	A0A1B1P7A4	Bacillus_phage	51.5	1.9e-09
WP_079246402.1|6638_7073_+	helix-turn-helix transcriptional regulator	NA	A0A1B1P7A0	Bacillus_phage	54.9	1.8e-33
WP_159451471.1|7092_7254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156137705.1|7376_7526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246403.1|7622_8825_-	hypothetical protein	NA	A0A1B1P786	Bacillus_phage	42.3	2.1e-79
WP_043935992.1|8953_9193_+	hypothetical protein	NA	A0A1B1P790	Bacillus_phage	78.5	7.7e-26
WP_079246404.1|11514_11793_+	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_079246440.1|12127_12679_+	hypothetical protein	NA	A0A1B1P785	Bacillus_phage	66.3	1.7e-44
WP_079246405.1|12768_13731_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	74.1	6.7e-137
WP_162494740.1|13895_15137_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_079246406.1|15149_15497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246407.1|15586_15826_+	hypothetical protein	NA	A0A1B1P789	Bacillus_phage	81.0	8.0e-31
WP_079246408.1|15841_16381_+	hypothetical protein	NA	A0A1B1P777	Bacillus_phage	85.5	9.1e-83
WP_079246409.1|16423_16612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246410.1|16823_17198_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	53.2	2.4e-29
WP_000540681.1|17400_18231_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2GLD4	Bacillus_phage	79.3	2.8e-131
WP_000810821.1|18308_18518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000375145.1|18498_19014_-|holin	holin	holin	A0A0M4R5G6	Bacillus_phage	45.6	1.8e-27
WP_079246411.1|19050_19428_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	64.8	7.1e-42
WP_079246412.1|19444_24607_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	56.3	0.0e+00
WP_079246413.1|24603_26106_-|tail	phage tail protein	tail	A0A2H4JC38	uncultured_Caudovirales_phage	67.7	1.8e-205
WP_079246414.1|26110_31138_-|tail	phage tail tape measure protein	tail	A0A1B1P7S6	Bacillus_phage	63.1	1.9e-267
WP_000830810.1|31177_31468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246415.1|31530_32025_-	hypothetical protein	NA	A0A1B1P7E5	Bacillus_phage	44.1	1.2e-28
WP_079246416.1|32057_32870_-	hypothetical protein	NA	A0A1B1P7D9	Bacillus_phage	71.1	7.0e-103
WP_050822267.1|32869_33118_-	hypothetical protein	NA	A0A1B1P7E7	Bacillus_phage	59.8	3.0e-20
WP_079246417.1|33132_33483_-	hypothetical protein	NA	A0A1B1P7D3	Bacillus_phage	75.9	1.5e-49
WP_079246418.1|33493_33907_-	hypothetical protein	NA	A0A1B1P7D0	Bacillus_phage	71.5	3.0e-49
WP_079246419.1|33906_34281_-	hypothetical protein	NA	A0A1B1P7D8	Bacillus_phage	57.9	1.4e-34
WP_079246420.1|34283_34700_-	DUF3199 family protein	NA	A0A1B1P7D6	Bacillus_phage	58.7	4.0e-38
WP_079246421.1|34705_35029_-	hypothetical protein	NA	A0A1B1P7E2	Bacillus_phage	63.2	7.7e-29
WP_079246422.1|35040_35976_-	hypothetical protein	NA	A0A1B1P7E3	Bacillus_phage	85.1	5.5e-144
WP_079246423.1|36003_37200_-	hypothetical protein	NA	A0A1B1P7E4	Bacillus_phage	74.7	2.1e-156
WP_079246425.1|37635_38556_-	hypothetical protein	NA	A0A1B1P7D7	Bacillus_phage	49.2	1.5e-72
WP_079246426.1|38571_40098_-|portal	phage portal protein	portal	A0A1B1P7C8	Bacillus_phage	71.5	2.0e-215
WP_079246427.1|40114_41578_-|terminase	terminase B	terminase	A0A1B1P7D5	Bacillus_phage	83.8	2.1e-243
WP_079246428.1|41584_42100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246429.1|42253_43090_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	88.8	5.1e-141
WP_079246430.1|43094_44036_-	hypothetical protein	NA	A0A1B1P7C9	Bacillus_phage	74.5	5.6e-104
WP_079246431.1|44095_44329_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246442.1|44342_44483_-	BC1881 family protein	NA	NA	NA	NA	NA
WP_079246432.1|44615_44849_-	hypothetical protein	NA	A0A1B1P7D4	Bacillus_phage	79.2	1.3e-25
WP_079246433.1|44986_46207_-	DNA modification methylase	NA	A0A2I4R670	Erysipelothrix_phage	52.0	1.9e-115
WP_050822249.1|46226_46460_-	hypothetical protein	NA	H0USW0	Bacillus_phage	52.5	5.4e-16
WP_079246434.1|47382_47889_-	ArpU family transcriptional regulator	NA	A0A1B1P7B2	Bacillus_phage	83.6	1.6e-68
WP_145953862.1|48100_48343_-	hypothetical protein	NA	A0A1B1P7B9	Bacillus_phage	58.2	1.0e-17
WP_000210444.1|48407_48533_-	DUF3983 domain-containing protein	NA	NA	NA	NA	NA
48503:48517	attR	TTAATTTCTTTTTCT	NA	NA	NA	NA
WP_159451472.1|48575_48752_-	hypothetical protein	NA	A0A0A7AR63	Bacillus_phage	86.2	1.9e-21
WP_079246435.1|48785_49190_-	hypothetical protein	NA	W8EIC5	Pseudomonas_phage	45.3	3.3e-21
WP_079246436.1|49189_49447_-	hypothetical protein	NA	A0A0A0RSN4	Bacillus_phage	35.4	9.6e-06
WP_079246437.1|49485_49719_-	hypothetical protein	NA	A0A1B1P7A2	Bacillus_phage	61.3	8.9e-11
>prophage 1
NZ_CP020005	Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence	408071	286941	390338	408071	holin,transposase	Bacillus_phage(25.0%)	48	NA	NA
WP_079246636.1|286941_288153_+|transposase	IS110 family transposase	transposase	A0A1X9I619	Streptococcus_phage	33.4	2.0e-61
WP_079246637.1|288624_288990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246638.1|290269_290647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053514609.1|291729_291963_+	hypothetical protein	NA	A0A1B1P887	Bacillus_phage	66.2	1.2e-20
WP_079246639.1|292052_292673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053514610.1|293220_293598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053514612.1|296235_296424_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246640.1|297327_297504_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_079245583.1|297687_300660_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.5	4.6e-75
WP_079246294.1|300761_301157_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245584.1|301266_302649_-	MmcB family DNA repair protein	NA	NA	NA	NA	NA
WP_079245585.1|302890_303460_+	recombinase family protein	NA	A0A1V0E035	Clostridioides_phage	39.3	1.5e-30
WP_079246641.1|303487_304009_-	DedA family protein	NA	NA	NA	NA	NA
WP_079246643.1|305617_306340_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	31.0	4.3e-19
WP_079246645.1|306901_307453_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	52.8	1.7e-44
WP_079246646.1|311006_312422_+	helix-turn-helix domain containing protein	NA	NA	NA	NA	NA
WP_001100112.1|314852_315032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079245377.1|315205_316513_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	6.6e-26
WP_001100112.1|318484_318664_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079246647.1|323169_325557_+	vegetative insecticidal protein Vip3A family protein	NA	NA	NA	NA	NA
WP_079246648.1|326925_327420_+	cation:proton antiporter regulatory subunit	NA	NA	NA	NA	NA
WP_079246649.1|327424_328624_+	cation:proton antiporter	NA	NA	NA	NA	NA
WP_079246650.1|329104_330061_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1J0MS59	Bacillus_phage	44.4	1.4e-49
WP_079246651.1|330350_333896_+	pesticidal protein	NA	NA	NA	NA	NA
WP_079246652.1|334402_336562_+	pesticidal protein	NA	NA	NA	NA	NA
WP_014481901.1|336776_337883_-	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.4	2.0e-07
WP_079246653.1|338048_339074_-	macro domain-containing protein	NA	A0A2I7QNM6	Vibrio_phage	38.3	5.5e-20
WP_079246654.1|339088_339721_-	DUF4433 domain-containing protein	NA	NA	NA	NA	NA
WP_014481901.1|339880_340987_+	tyrosine recombinase XerS	NA	A0A1B1IQT7	uncultured_Mediterranean_phage	28.4	2.0e-07
WP_079246655.1|347698_348655_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MV84	Bacillus_phage	39.5	5.3e-49
WP_001035125.1|353087_353618_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_079246656.1|354001_357697_-	pesticidal protein	NA	NA	NA	NA	NA
WP_033698205.1|358399_358651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246657.1|358984_359407_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	77.3	3.5e-53
WP_033698201.1|361307_361712_-	DUF3221 domain-containing protein	NA	NA	NA	NA	NA
WP_053512358.1|362420_363470_+	Fic family protein	NA	NA	NA	NA	NA
WP_000954718.1|363717_364560_-	N-hydroxyarylamine O-acetyltransferase	NA	NA	NA	NA	NA
WP_016078253.1|368056_369190_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_079246659.1|369221_370451_-	alpha-helical pore-forming toxin family protein	NA	NA	NA	NA	NA
WP_060852712.1|370512_371832_-	HBL/NHE enterotoxin family protein	NA	NA	NA	NA	NA
WP_003308422.1|375475_376471_-	DUF4046 domain-containing protein	NA	NA	NA	NA	NA
WP_153594277.1|379456_379627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033700259.1|380890_381784_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_001043045.1|382824_383079_+	HU family DNA-binding protein	NA	A3E2K9	Sodalis_phage	48.9	1.2e-13
WP_000448514.1|383131_383323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145953776.1|383624_384772_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	41.8	2.4e-48
WP_003308343.1|387635_387887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079246660.1|389108_390338_+|transposase	IS110 family transposase	transposase	M1NSC9	Streptococcus_phage	49.1	4.4e-80
